Printer Friendly

jefA (Rv2459), a drug efflux gene in Mycobacterium tuberculosis confers resistance to isoniazid & ethambutol.

Efflux pump mediated multidrug resistance has become a significant complicating factor in the chemotherapy of bacterial infections. Efflux pumps are plasma membrane proteins having ability to extrude various antimicrobial substances outside the cell by an energy dependent manner. The main function of these efflux pumps is to extrude out environmental toxic substances entering the cell wall as well as metabolic wastes of the cell, thus providing protection to the cell from the toxic effect of these substances (1). It is thought that these pumps arose so that noxious substances could be transported out of the bacterium allowing its survival, and their increased expression is associated with resistance to alien substances including drugs. These pumps are often called multidrug efflux pumps (2). On the basis of bioenergetics and structural criteria multidrug efflux pumps are divided into two major classes. Secondary multidrug transporters utilize the trans-membrane electrochemical gradient of proton or sodium ion to drive the extrusion of drugs from the cell. These include transporters of major facilitator superfamily (MFS), small multidrug resistance family (SMR), resistance nodulation division family (RND) and multidrug and toxic compound extrusion family (MATE). On the other hand, ABC (ATP binding cassette) type multidrug transporters use the free energy of ATP hydrolysis to pump drugs out of the cell (3). Though p-glycoprotein (P-gp) discovered by Juliano and Ling (4) is the most studied and characterized efflux pump in eukaryotes, involved in resistance to anticancer drugs (5), a number of efflux pumps have also been identified and characterized in bacteria, especially in Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Staphylococcus aureus, etc (6). In tuberculosis, responses to chemotherapy have been greatly challenged by the increasing drug resistance. Multidrug resistance (MDR, resistance to at least isoniazid and rifampicin) has grown up into its more deadly form, extensive drug resistance (XDR), in which Mycobacterium tuberculosis isolates are resistant to isoniazid and rifampicin as well as any fluoroquinolone and at least one of three injectable second-line drugs i.e., amikacin, kanamycin, or capreomycin (7). Mutations in the genes associated with the mode of action of the drugs have been considered as the main mechanism for drug resistance in M. tuberculosis. Alternative mechanisms such as decreased cell wall permeability to drugs and active efflux pumping are likely to be important for several drugs specially in isolates in which no mutation in target genes are found. M. tuberculosis, being the causative agent of tuberculosis, has been studied for the presence and activity of a number of efflux pump genes and their encoded products (8-17). One of the open reading frames (ORF) in the genome sequence of M. tuberculosis, Rv2459, annotated as gene encoding probable drug efflux protein (Welcome Trust Sanger Institute, http://www.sanger.ac.uk/ Projects/M_tuberculosis/Gene_list/functional_classes/ III.A.6.shtml), was studied in the present work. In our earlier microarray and real-time PCR based studies, this gene has been identified to be overexpressed in isoniazid and ethambutol induced cultures of multidrug resistant M. tuberculosis (18) (Indian Patent application No. 2071/DEL/2007) and we have named it as jefA. We further investigated the phenotypic effect of jefA overexpression in [H.sub.37]Rv in order to know its role in conferring resistance to common anti-tubercular drugs in M. tuberculosis.

Material & Methods

Bacterial strains, plasmids, media and reagents: Reference strain M. tuberculosis [H.sub.37]Rv (TMC 102) was obtained from Mycobacterial Repository Centre at National JALMA Institute for Leprosy & Other Mycobacterial Diseases, Agra. Competent cells of [H.sub.37]Rv, E. coli XL1Blue (19) and replicative plasmid pSD5 (20) were obtained from stocks earlier prepared by Dr A.K. Tyagi. For growth of M. tuberculosis, MiddleBrook 7H9 broth with ADC supplement (7H9-S) and 7H11 agar with OADC supplement (7H11-S; Difco, USA) were used. Luria Bertani (LB) medium was used for culturing E. coli. Resazurin sodium salt powder was obtained from Sigma, USA.

Antibiotics and inhibitors: Rifampicin, isoniazid, ethambutol, streptomycin, oloxacin, norloxacin, kanamycin and efflux pump inhibitors carbonyl cyanide m-chlorophenylhydrazone (CCCP) and verapamil were obtained from Sigma, USA. Rifampicin and CCCP were dissolved in dimethyl sulphoxide (DMSO, Sigma, USA), while rest of the drugs were dissolved in distilled water (D/w; Span Diagnostics, India). All drugs and inhibitors were filter sterilized through 0.22 [micro]m filters (Millipore, USA).

Primer designing and amplification of Rv2459 (jefA): Forward and reverse primers (TBc1-F & TBc1-R) for whole gene amplification were designed using DNA sequence of Rv2459 taken from Tuberculist web server (http://genolist.pasteur.fr/TubercuList/). Primers were lanked with recognition sequences of restriction enzymes NdeI and MluI at their 5' end with six additional base pairs at extreme 5' end in both the primers. PCR was set up in a 25 [micro]l reaction volume for amplification of whole gene with 1X CERTAMP buffer, 1.5 units of CERTAMP enzyme (BioTools, Spain), 800 [micro]M dNTP mix (Bangalore Genei, India), 3 mM Mg[Cl.sub.2] (Bioron GmbH, Germany), 1.5 [micro]M each of forward and reverse primers and 2 [micro]l [H.sub.37]Rv DNA (boiled and snap chilled). The cycle parameters of PCR included initial denaturation at 94[degrees]C for 5 min followed by 35 cycles of 94[degrees]C for 1 min, 60[degrees]C for 30 sec and 72[degrees]C for 2 min, followed by a final extension of 5 min at 72[degrees]C. This resulted in an amplification of 1551 bp (1527 bp Rv2459 + 12 bp sequence of recognition sites of restriction enzymes NdeI and MluI + 12 extra bp, 6 each at 5' end of both the primers). The sequences of primers are given in Table I. Primers for detection of jefA (Rv2459-F and Rv2459-R) and that of polA (polA-F and polA-R) were designed by using free online software Primer3 with default parameters (21). The 1551 bp amplified PCR product (insert) having flanking restriction sequences was run on agarose gel electrophoresis and eluted from the gel by using QIAGEN kit (QIAGEN GmbH, Germany) or GFX DNA purification kit (Amersham Pharmacia, UK). Insert and vector pSD5, both were double digested with restriction enzymes NdeI and MluI (MBI Fermentas, USA). For restriction digestion, 1 [micro]g of DNA was digested with 10 units of MluI and 20 units of NdeI and incubated at 37[degrees]C for 3-4 h. Restricted insert and vector were ligated by using 4 units of T4 DNA ligase (Bangalore Genei, India) with overnight ligation at 22[degrees]C. Ligation was also performed using Quick Ligase (New England Biolabs, UK) at room temperature for 10 min.

Transformation in E. coli: Ligation mixture was subjected to transformation in E.coli XL1Blue cells (efficiency [10.sup.7] cfu/[micro]g) by heat shock treatment and streaked on LB agar plates with kanamycin (25 [micro]g/ ml) and incubated at 37[degrees]C overnight. Single colonies thus obtained were inoculated in 5 ml LB broth with kanamycin (25 [micro]g/ml) and incubated at 37[degrees]C overnight. Plasmid DNA from overnight culture of E. coli was isolated by alkaline lysis method with TEG (25 mM Tris-Cl pH 8, 10 mM EDTA, 50 mM glucose), NaOH and potassium acetate. Recombinant plasmids were verified by sequencing, restriction digestion with MluI and NdeI and further verified by PCR amplification of whole gene of jefA from plasmid DNA isolated from E. coli cells.

Electroporation in M. tuberculosis: Plasmid DNA (100 ng) containing jefA gene (pSD5-jefA) was mixed with 25 [micro]l of electrocompetent cells of [H.sub.37]Rv (efficiency [10.sup.4] cfu/[micro]g). Electroporation was done in a Cell Porator (Gibco BRL, USA) at 330 [micro]F, 8 KQ and 375 volts. Cells were revived in 1 ml 7H9 medium at 37[degrees]C for 24 h and then streaked on 7H11 plates with kanamycin (25[micro]g/ml), alongwith plates streaked with [H.sub.37]Rv as negative control, and incubated for 25 days at 37[degrees]C. Cells were also electroporated with only plasmid DNA (pSD5) as expression control. Colonies obtained were grown on 7H11 medium plates with kanamycin and adapted in 7H9 broth with kanamycin for 7 days at 37[degrees]C in a shaker incubator at 200 rpm. Growth was stored in 1 ml aliquots for further use. Recombinant clones were verified by sequencing.

RNA isolation: RNA from M. tuberculosis cultures were isolated by TRI Reagent (Sigma, USA). Briely, two loopful of growth in 400 [micro]l D/w was incubated with 100 [micro]l lysozyme (20 mg/ml, Sigma, USA) for 15 min at 37[degrees]C. TRI Reagent (800 [micro]l) was added and incubated at room temperature for 5 min. Suspension was passed through 1 ml (26 gauge) syringe needle 5 times and centrifuged at 12,000 g for 5 min. Deproteinization was done with 200 [micro]l chloroform followed by centrifugation at 6000 g for 5 min. Upper aqueous layer was collected and RNA was precipitated with 0.75 per cent isopropanol and washed with 150 [micro]l of 75 per cent ethanol with centrifugation at 10,000 g for 15 min. Pellet was air-dried and resuspended in 30 [micro]l of diethyl pyrocarbonate (DEPC, Sigma, USA) treated D/w. RNAs were treated with DNaseI enzyme (1U/10 [micro]l of RNA, Ambion, USA) prior to real-time RT-PCR.

Real-Time RT-PCR: Overexpression of jefA in recombinant [H.sub.37]Rv was confirmed by real-time reverse transcription PCR in a Light Cycler using RNA Amplification SYBR Green I kit (Roche Diagnostics, Germany) using the protocols of the manufacturer. For real-time RT-PCR, primers used were same as described in Table I (Rv2459 F & R and polA F & R). The annealing temperatures of both the primers were 60[degrees]C. The starting amounts of RNAs for jefA and polA amplifications were equalized for each sample. The crossing point ([C.sub.P]) values of jefA amplification were recorded for each sample i.e., clones harbouring recombinant plasmid pSD5 containing jefA gene ([H.sub.37]Rv-pSD5-jefA), clones harbouring only plasmid pSD5 with no jefA insert ([H.sub.37]Rv-pSD5) and reference strain [H.sub.37]Rv. Mean [DELTA][C.sub.P] values were calculated and normalized to that of a housekeeping gene polA by [2.sup.-[DELTA][DELTA]Ct] method (22). Relative quantification was done to determine over-expression of jefA gene in [H.sub.37]RvpSD5-jefA as compared to that of [H.sub.37]Rv-pSD5. [DELTA][C.sub.P] values were also calculated and normalized for clones and reference strain [H.sub.37]Rv.

MIC determination by REMA: MICs of [H.sub.37]Rv-pSD5-jefA, [H.sub.37]Rv-pSD5 and of [H.sub.37]Rv were determined by Resazurin microtitre assay (REMA) plate method (23-26) with concentrations of drugs ranging from 0.125 to 16 [micro]g/ml. MICs of the clones were also determined in the presence of efflux pump inhibitors CCCP (0.5 [micro]g/ml), verapamil (5 (g/ml) and CCCP + verapamil. The concentrations of the inhibitors were decided after studying the effect of concentration dependent titration performed with these inhibitors on [H.sub.37]Rv. Briely, 100 [micro]l 7H9-S medium was dropped in every well of 96-well microtitre plates (only medium, medium with CCCP, medium with verapamil and medium with CCCP + verapamil in separate rows) except peripheral wells where 250 [micro]l D/w was dropped to prevent evaporation during incubation. Two-fold serial dilutions of drugs were made directly into the wells. 100 [micro]l mycobacterial inoculum of turbidity resembling 0.1 MacFarland index were added to each well except peripheral wells containing D/w. Medium control (only medium without drug, inhibitor and inoculum), growth control (medium without drug and inhibitor but with inoculum) and inhibitor controls (medium without drug but with inhibitor/s and inoculum) were also made in each plate. Plates were covered and incubated for 7 days at 37[degrees]C. After 7 days 30 [micro]l of 0.02 per cent resazurin sodium salt solution was added to each well and again incubated for further 24 h at 37[degrees]C. A change in colour of the resazurin dye from blue to pink was considered as positive growth and MIC was determined as corresponding concentration in the first blue colour in a row. All the experiments were repeated at least three times.

Phylogenetic and structural analysis: Distance relationship of JefA with homologous sequences within mycobacterial species, other organisms and human was studied. Protein sequence of JefA was derived from TubercuList web server http://genolist.pasteur.fr/TubercuList/) and BLASTp was performed through NCBI server (27). Multiple sequence alignment was done using ClustalW (28) with the related sequences obtained from BLASTp. Phenograms for distance relation analysis within mycobacterial species as well as within other organisms were generated using free online programme Phylodendron ([c] 1997 by DG Gilbert) as well as by NCBI web server using Neighbour-Joining method. Trans-membrane regions in JefA protein were predicted by TMpred (29) and TMHMM server version 2.0 (http://www. cbs.dtu.dk/services/TMHMM/).

Results

Real-time RT-PCR analysis of clones: Real-time reverse transcription PCR using SYBR Green I format confirmed over-expression of jefA in M. tuberculosis [H.sub.37]Rv containing recombinant vector ([H.sub.37]Rv-pSD5-/ef4) with respect to [H.sub.37]Rv containing only pSD5 vector ([H.sub.37]Rv-pSD5) as well as reference strain M. tuberculosis [H.sub.37]Rv. A greater than 16 fold overexpression of jefA has been detected by real-time RT-PCR in clones with recombinant vectors as compared to those with non-recombinant vectors by the 2-MCt method22. CP and [DELTA][C.sub.P] values in each case are shown in Table II. Relative normalized value [DELTA][DELTA][C.sub.P] for recombinant and non-recombinant clones was >4, while that of recombinant clones and [H.sub.37]Rv was >3, showing a greater than 16 fold over-expression of jefA gene in recombinant clones.

MIC determination of clones by REMA and effect of efflux pump inhibitors: There was no significant change in MICs of rifampicin, oloxacin and norloxacin in clones. However, in the case of other three drugs (ethambutol, isoniazid and streptomycin), the levels of resistance increased in jefA overexpressing clones. Whereas MIC of streptomycin was found increased by 8-fold only (from 0.125 to 1 [micro]g/ml), MICs of isoniazid and ethambutol showed an increase of 64fold (from 0.125 to 8 [micro]g/ml) and 16 fold (0.5 to 8 [micro]g/ml) respectively (Table III). When efflux pump inhibitors CCCP, verapamil and a combination of CCCP and verapamil were used in parallel wells in REMA, MICs showed a decrease in the case of these three drugs. CCCP lowered the MIC of streptomycin by 2-fold whereas verapamil singly as well as with CCCP lowered the MIC by 4-fold. While MIC of isoniazid was not lowered by verapamil, CCCP lowered the MIC by 2-fold. In case of ethambutol, CCCP lowered its MIC by 8 fold (from 8 to 1 [micro]g/ml), which was greater than the decrease effected by verapamil (from 8 to 4 [micro]g/ml). However, slight increase in MIC of rifampicin (from 0.125 to 0.25 [micro]g/ml) was not decreased with pump inhibitors and therefore this increase was not considered as effect of efflux pump.

Phylogenetic analysis: Homology search and multiple sequence alignment of JefA with other bacterial sequences showed presence of close homologous regions (Fig. 1), whereas with human proteins showed very little identity i.e. <27 per cent with any of the human protein (Table IV) with rarer alignments (Fig. 2). It is evident from the phylogenetic tree drawn within mycobacterial species that the amino acid sequence of JefA is well conserved in M. tuberculosis and M. bovis. Other mycobacterial species showing close relation to JefA sequence are M. ulcerans and M. vanbaalenii (Fig. 3a). Among other organisms, Salinospora, Streptomyces, Verminephrovector, Frankia and Serratia are the genera showing closely related homologues of JefA but distant than mycobacterium (Fig. 3b). All homologues are membrane drug transport/efflux proteins suggesting a common structural and functional behaviour of these sequences. Transmembrane region prediction analysis showed that it is a protein with 14 transmembrane helices (TMH) suggesting its location as a transmembrane protein in the cell (Fig. 4a). Due to unavailability of a modeled template with significant amino acid identity (>40%), structure of JefA could not be completely understood. However, homology derived structure prepared from nearest available model (Fig. 4b), suggests that amino acids, forming TMH 1, 8 and 11, participate in ethambutol specificity and those forming TMH 2, 7 and 10 participate in isoniazid specificity in JefA.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Discussion

Multidrug resistance in tuberculosis has become an increasing threat around the world. Various important antitubercular drugs like streptomycin, rifampicin, isoniazid, ethambutol and luoroquinolones have become therapeutically ineffective in a section of cases due to development of multidrug resistance. This multidrug resistance is also important in the case of non-tuberculous mycobacteria (NTM), which are naturally resistant to a number of therapeutically relevant anti-tubercular drugs.

Mycobacterial drug efflux pumps have been known since the identification of LfrA in M. smegmatis (30,31). Since its discovery, a number of genes have been identified and characterized in mycobacterial species. These genes have been shown to increase the MICs of antibacterial substances when overexpressed in a suitable host (8,10,14). Several genes which are thought to encode efflux pump proteins are still unexplored. The ORF, Rv2459, which has been characterized in this study, has been described in M. tuberculosis database as 'probable conserved integral membrane transport protein' (http://genolist.pasteur.fr/TubercuList/). After detecting its overexpression in multidrug resistant isolates of M. tuberculosis in our microarray and realtime PCR based studies (18) (Indian Patent application No. 2071/DEL/2007), it has been designated as 'jefA\ In the present work, this gene has been amplified from standard laboratory strain M. tuberculosis [H.sub.37]Rv, subcloned in E. coli, and finally cloned in [H.sub.37]Rv itself through a mycobacteria-E. coli expression shuttle vector pSD520 to make it overexpress its phenotype. Cloned [H.sub.37]Rv cells showed >16 fold increased expression of jefA as confirmed by real-time RTPCR analysis. A comparison of MICs of drugs in recombinant versus non-recombinant clones by REMA showed that MICs for isoniazid and ethambutol were increased significantly (16 to 64 fold) in recombinant clones followed by, to a relatively lesser amount, that of streptomycin. An increase in MICs of isoniazid and ethambutol suggests that jefA is actively involved in extrusion of these drugs. This also reconfirms the results published with multidrug resistant isolates (18). Experiments with protonophore CCCP and calcium channel blocker verapamil, singly or together, indicated that active efflux of these drugs from the bacterial cell was responsible for the increase in their MICs. The blocking effect of CCCP and verapamil brought down, although not fully, the increase in isoniazid and ethambutol MICs. The decrease in MIC of ethambutol by CCCP was greater than that for isoniazid. It may be presumed that the concentration of CCCP required to lower isoniazid MIC should be greater than what was taken. However, increasing the CCCP concentration can rather affect the natural growth of the bacteria as observed in our parallel experiments to determine the optimum concentration of the inhibitors after performing concentration dependent titration of the wild type bacterial growth (data not shown). On the other hand, verapamil showed only little effect in both the cases. Inclusion of reserpine could also have added some information about decrease in MIC of drugs in jefA clones, which may be similar or little different. Small decrease in the MIC of streptomycin by both the inhibitors in the clones, compared to other drugs, suggests a mild involvement of jefA in streptomycin resistance. Moreover, the greater effect of verapamil on streptomycin MIC than that by CCCP suggests possible involvement of another ABC family pump in streptomycin resistance. Although no increase was found in the MICs of luoroquinolones-oloxacin and norloxacin in the present study, these drugs are assumed to be potential targets for efflux mediated resistance (30-32). As the drugs tested in the present study are used commonly in anti-TB therapy, we have concerned on clinically relevant drugs and not included other synthetic compounds in the study which may be possible efflux pumps substrates.

[FIGURE 3a OMITTED]

[FIGURE 3b OMITTED]

[FIGURE 4 OMITTED]

When JefA protein sequence was searched in databases for its homologous sequences, 39, 35 and 34 per cent amino acid identity was found with QacA family drug transporter proteins of Salinispora arenicola, Verminephovector eiseniae and Frankia species respectively. This suggests that JefA is closely related to drug transport proteins. Phylogenetic relationship of JefA showed that within mycobacterial species its amino acid sequence is well conserved especially within M. ulcerans and M. bovis. Relation of JefA with its homologues within other organisms shows that JefA amino acid sequence is conserved within high GC Gram positive organisms. The homology of JefA with membrane efflux proteins of other bacteria as well as its transmembrane region analysis indicated the nature and location of JefA as a transmembrane efflux pump containing 14 TMH. Although specificity of most of these sequences particularly for isoniazid and ethambutol is not known, homology in these sequences is suggestive of common specificity for other synthetic compounds, which may be the preferred substrates for these homologous pumps and which can be one of the natural defense mechanisms. Little identity of JefA with any of the human proteins and their rarer alignment suggests presence of non-homologous regions in JefA structure, which can be important as potential drug targets.

Although mutations in drug target genes are still thought to be the primary mechanism of resistance, they alone are unable to account for all cases of INH and EMB resistance in M. tuberculosis (33-37). Hence, there is a need to look for alternative mechanisms such as efflux pumps in such situations. The role of efflux pumps in conferring INH and EMB resistance has been described in M. tuberculosis, where an efflux pump of resistance nodulation division (RND) family, mycobacterial membrane protein large (mmpL7), has been found to confer INH resistance14, and another gene, iniA, encoding a pump component has been observed to assist an efflux pump to provide resistance to INH and EMB (13). Microarray based studies have also identified an efflux pump gene efpA (Rv2846c) to be induced by INH treatment (38,39).

Our study provides significant new information about efflux mechanisms contributing in INH and EMB resistance through a MFS family efflux pump, JefA, which acts as alternative/additional mechanism of resistance to these drugs in M. tuberculosis. The increase in MICs of these drugs, when jefA was cloned in M. tuberculosis and the decrease in their MICs by efflux pump inhibitors CCCP and verapamil support its nature as a gene encoding efflux pump of major facilitator superfamily, which is also indicated by the transmembrane region prediction analysis of JefA as well as by its phylogenetic analysis. It can further be investigated in jefA knock-out strains to reinforce the observations. In conclusion, our results suggest that jefA gene contributes in isoniazid and ethambutol resistance in M. tuberculosis through an efflux pump mediated mechanism. Its actual epidemiological significance can be assessed only by the study of naturally occurring INH and EMB resistant isolates from patients. Since no known structural model of a close homologue of JefA with a significant sequence identity (>40%) has been identified based on BLASTp (27) and SWISS MODEL (40) analysis, further characterization of JefA requires alternative bioinformatics methods, X-ray crystallography or NMR spectroscopy analysis of JefA to explain on the basis of structure-function relationship, why it is preferentially associated with ethambutol and isoniazid resistance and not with other drugs tested.

Acknowledgment

Authors acknowledge Shri Yash Gupta for help in bioinformatic analysis. Technical help of Shriyuts Rajesh Singh, Dhaniram, Jitendra Yadav and Harishankar is also acknowledged. Authors acknowledge the Department of Biotechnology (Government of India), and Central TB Division (Government of India), New Delhi, for financial support. The first (AKG) and third authors (ML) acknowledge the Council of Scientific and Industrial Research and Indian Council of Medical Research, New Delhi respectively, for Senior Research Fellowship.

Received August 17, 2009

References

(1.) Piddock LJ. Multidrug resistance efflux pumps--not just for resistance. Nat Rev Microbiol 2006; 4: 629-36.

(2.) Webber MA, Piddock LJV. The importance of efflux pumps in bacterial antibiotic resistance. J Antimicrob Chemother 2003; 51: 9-11.

(3.) Putman M, vanVeen HW, Konings WN. Molecular properties of bacterial multidrug transporters. Microbiol Mol Biol Rev 2000; 64: 672-93.

(4.) Juliano RL, Ling V. A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim Biophys Acta 1976; 455: 152-62.

(5.) Kuo MT. Roles of multidrug resistance genes in breast cancer chemoresistance. Adv Exp Med Biol 2007; 608: 23-30.

(6.) Poole K. Efflux mediated antimicrobial resistance. J Antimicrob Chemother 2005; 56: 20-51.

(7.) Centers for Disease Control and Prevention (CDC). Revised definition of extensively drug-resistant tuberculosis. MMWR Morb Mortal Wkly Rep 2006; 55: 1176.

(8.) DeRossi E, Branzoni M, Cantoni R, Milano A, Riccardi G, Ciferri O. mmr, a Mycobacterium tuberculosis gene conferring resistance to small cationic dyes and inhibitors. J Bacteriol 1998; 180: 6068-71.

(9.) De Rossi E, Ainsa JA, Riccardi G. Role of mycobacterial efflux transporters in drug resistance: an unresolved question. FEMS Microbiol Rev 2006; 30: 36-52.

(10.) Ainsa JA, Blokpoel MC, Otal I, Young DB, De Smet KA, Martin C. Molecular cloning and characterization of Tap, a putative multidrug efflux pump present in Mycobacterium fortuitum and Mycobacterium tuberculosis. J Bacteriol 1998; 180: 5836-43.

(11.) Choudhuri BS, Bhakta S, Bank R, Basu J, Kundu M, Chakrabarti P. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis. Biochem J2002; 367: 279-85.

(12.) Siddiqi N, Das R, Pathak N, Banerjee S, Ahmed N, Katoch VM, et al. Mycobacterium tuberculosis isolate with a distinct genomic identity overexpresses a tap-like efflux pump. Infection 2004; 32: 109-11.

(13.) Colangeli R, Helb D, Sridharan S, Sun J, Varma-Basil M, Hazbon MH, et al. The Mycobacterium tuberculosis iniA gene is essential for activity of an efflux pump that confers drug tolerance to both isoniazid and ethambutol. Mol Microbiol 2005; 55: 1829-40.

(14.) Pasca MR, Guglierame P, De Rossi E, Zara F, Riccardi G. MmpL7 gene of Mycobacterium tuberculosis is responsible for isoniazid efflux in Mycobacterium smegmatis. Antimicrob Agents Chemother 2005; 49: 4775-7.

(15.) Pasca MR, Guglierame P, Arcesi F, Bellinzoni M, De Rossi E, Riccardi G. Rv2686c-Rv2687c-Rv2688c, an ABC luoroquinolone efflux pump in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2004; 48: 3175-80.

(16.) Gupta AK, Chauhan DS, Srivastava K, Das R, Batra S, Mittal M, et al. Estimation of efflux mediated multi-drug resistance and its correlation with expression levels of two major efflux pumps in mycobacteria. J Commun Dis 2006; 38: 246-54.

(17.) Ramon-Garcia S, Martin C, DeRossi E, Ainsa JA. Contribution of the Rv2333c efflux pump (the Stp protein) from Mycobacterium tuberculosis to intrinsic antibiotic resistance in Mycobacterium bovis BCG. J Antimicrob Chemother 2007; 59: 544-7.

(18.) Gupta AK, Katoch VM, Chauhan DS, Sharma R, Singh M, Venkatesan K, et al. Microarray analysis of efflux pump genes in multidrug resistant Mycobacterium tuberculosis during stress induced by common anti-tuberculous drugs. Microb Drug Resist 2010; 16: 21-8.

(19.) Bullock WO, Fernandez JM, Short JM. XL1-Blue: A high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques 1987; 5: 376-8.

(20.) DasGupta SK, Jain S, Kaushal D, Tyagi AK. Expression systems for study of mycobacterial gene regulation and development of recombinant BCG vaccines. Biochem Biophys Res Commun 1998; 246: 797-804.

(21.) Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: Methods in molecular biology. Totowa, NJ: Humana Press; 2000. p. 365-86. Available at: http://fokker.wi.mit.edu/primer3/input.htm.

(22.) Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 2001; 25: 402-8.

(23.) Palomino JC, Martin A, Camacho M, Guerra H, Swings J, Portaels F. Resazurin microtiter assay plate: simple and inexpensive method for detection of drug resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2002; 46: 2720-2.

(24.) Martin A, Camacho M, Portaels F, Palomino JC. Resazurin microtitre assay plate testing of Mycobacterium tuberculosis susceptibilities to second-line drugs: rapid, simple and inexpensive method. Antimicrob Agents Chemother 2003; 47: 3616-9.

(25.) Nateche F, Martin A, Baraka S, Palomino JC, Khaled S, Portaels F. Application of the resazurin microtitre assay for detection of multidrug resistance in Mycobacterium tuberculosis in Algiers. J Med Microbiol 2006; 55: 857-60.

(26.) Jadaun GP, Agarwal C, Sharma H, Ahmed Z, Upadhyay P, Faujdar J, et al. Determination of ethambutol MICs for Mycobacterium tuberculosis and M.avium isolates by resazurin microtitre assay. J Antimicrob Chemother 2007; 60: 152-5.

(27.) Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. JMolBiol 1990; 215: 403-10.

(28.) Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994; 22: 4673-80.

(29.) Hofmann K, Stoffel W. TMbase- A database of membrane spanning protein segments. Biol Chem Hoppe-Seyler 1993; 374: 166-70.

(30.) Liu J, Takiff HE, Nikaido H. Active efflux of fluoroquinolones in Mycobacterium smegmatis, mediated by LfrA, a multidrug efflux pump. J Bacteriol 1996; 178: 3791-5.

(31.) Takiff HE, Cimino M, Musso MC, Weisbrod T, Martinez R, Delgado MB, et al. Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis. Proc Natl Acad Sci USA 1996; 93: 362-6.

(32.) Silva PE, Bigi F, Santangelo MP, Romano MI, Martin C, Cataldi A, et al. Characterization of P55, a multidrug efflux pump in Mycobacterium bovis and Mycobacterium tuberculosis. Antimicrob Agents Chemother 2001; 45: 800-4.

(33.) Ahmad S, Mokaddas E. Contribution of AGC to ACC and other mutations at codon 315 of the katG gene in isoniazid-resistant Mycobacterium tuberculosis isolates from the Middle East. Int J Antimicrob Agents 2004; 23: 473-9.

(34.) Ahmad S, Jaber AA, Mokaddas E. Frequency of embB codon 306 mutations in ethambutol-susceptible and -resistant clinical Mycobacterium tuberculosis isolates in Kuwait. Tuberculosis (Edinb) 2007; 87: 123-9.

(35.) Hazbo'n MH, Bobadilla delValle M, Guerrero MI, VarmaBasil M, Filliol I, Cavatore M, et al. Role of embB codon 306 mutations in Mycobacterium tuberculosis revisited: a novel association with broad drug resistance and IS6110 clustering rather than ethambutol resistance. Antimicrob Agents Chemother 2005; 49: 3794-802.

(36.) Parsons LM, Salfinger M, Clobridge A, Dormandy J, Mirabello L, Polletta VL, et al. Phenotypic and molecular characterization of Mycobacterium tuberculosis isolates resistant to both isoniazid and ethambutol. Antimicrob Agents Chemother 2005; 49: 2218-25.

(37.) Plinke C, Rusch-Gerdes S, Niemann S. Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother 2006; 50: 1900-2.

(38.) Fu LM. Exploring drug action on Mycobacterium tuberculosis using Affymetrix oligonucleotide genechips. Tuberculosis (Edinb) 2006; 86: 134-43.

(39.) Wilson M, DeRisi J, Kristensen HH, Imboden P, Rane S, Brown PO, et al. Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization. Proc Natl Acad Sci USA 1999; 96: 12833-8. "

(40.) Guex N, Peitsch MC. SWISS-MODEL and the Swiss PdbViewer: An environment for comparative protein modeling. Electrophoresis 1997; 18: 2714-23.

Reprint requests: Dr V.M. Katoch, Secretary, Department of Health Research, Ministry of Health & Family Welfare & Director-General, Indian Council of Medical Research, Ansari Nagar, New Delhi 110 029, India e-mail: vishwamohan_katoch@yahoo.co.in

Anuj Kumar Gupta *, Vineel P. Reddy (+), Mallika Lavania *, D.S. Chauhan *, K. Venkatesan **, V.D. Sharma *, A.K. Tyagi (+) & V.M. Katoch *, (#)

Departments of * Microbiology & Molecular Biology & ** Biochemistry, National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Agra & (+) Department of Biochemistry, University of Delhi, South Campus, New Delhi, India

(#) Present address: Secretary to Govt. of India, Department of Health Research, Ministry of Health & Family Welfare & Director-General, Indian Council of Medical Research, Ramalingaswami Bhawan, Ansari Nagar, New Delhi 110 029, India
Table I. Bacterial strains, plasmids and oligos used in this study

Strains/Plasmids Description Source/Reference

Strains:

XL1Blue E. coli strain recA1 endA1 Bullock et al,
 gyrA96 thi-1 hsdR17 supE44 1987 (19)
XL1Blue-pSD5-jefA XL1Blue harbouring Present study
 pSD5-jefA
[H.sub.37]Rv M. tuberculosis reference Mycobacterial
 laboratory strain Repository Centre,
 NJIL&OMD, Agra
[H.sub.37]Rv-pSD5 H37Rv harbouring pSD5 Present study
 vector
[H.sub.37] H37Rv harbouring pSD5-jefA Present study
 Rv-pSD5-jefA

Plasmids:
pSD5 E. coli-mycobacterium DasGupta et al,
 shuttle vector with 1998 (20)
 mycobacterial hsp60
 promoter, [Kn.sup.r],
 oriM, pl5A
pSD5-jefA pSD5 vector containing jefA Present study
 gene in its multiple
 cloning site

Oligos:
TBc1 (F) 5'>GAATTACATATGTCCCACACT- Present study
 GCAA TGACACCG<3'
TBc-1 (R) 5'>GAATTTACGCGTTTAGCTGGCGGGG Present study
 GTCCGG<3'
Rv2459 (F) 5'>TGGACGTCAACATCGTCAAT<3' Present study
Rv2459 (R) 5'>GTGACCCCGAACACAAAACT<3' Present study
PolA (F) 5'> TTTCACTGCTCGATGACGAC<3' Present study
PolA (R) 5'> TACCGGCACTTTCCATCTTC<3' Present study

Table II Overexpression of jefa gene in recombinant clones as
determined by real-time

gene Crossing points (CP) values

 Mean [C.sub.P] Mean [C.sub.P]
 (Cl # jefA) (a) (Cl # pSD5) (b)
 (A) (B)

jefA 19.18 24.62
polA 19.49 20.25
Relative normalized
difference
([DELTA][DELTA]CP)

gene Crossing points (CP) values

 Mean [C.sub.P] [DELTA]CP
 (H37Rv) (c) (jefA & pSD5)
 (C) (B)-(A)

jefA 25.55 5.44
polA 22.58 0.76
Relative normalized 4.68
difference
([DELTA][DELTA]CP)

gene Crossing points (CP) values

 [DELTA]CP
 (jefA & Rv)
 (C)-(A)

jefA 6.37
polA 3.09
Relative normalized 3.28
difference
([DELTA][DELTA]CP)

(a) Clones containing recombinant vector ([H.sub.37]Rv-pSD5-jefA);

(b) Clones containing non-recombinant vector (H37Rv-pSD5);

(c) Reference strain H37Rv. polA was used as reference gene

Table III. MIC of anti-tubercular drugs in bacterial strains
harbouring foreign DNA

 MIC ([micro]g/ml)

 [H.sub.37] [H.sub.37]Rv-
Drugs [H.sub.37]Rv Rv-pSD5 pSD5-jefA

RIF <0.125 <0.125 0.25
RIF+CCCP <0.125 <0.125 0.25
RIF+VER <0.125 <0.125 0.25
RIF+CCCP+VER <0.125 <0.125 0.25
INH <0.125 <0.125 8
INH+CCCP <0.125 <0.125 4
INH+VER <0.125 <0.125 8
INH+CCCP+VER <0.125 <0.125 4
EMB 0.5 0.5 8
EMB+CCCP 0.5 0.5 1
EMB+VER 0.5 0.5 4
EMB+CCCP+VER 0.5 0.5 1
STR 0.25 <0.125 1
STR+CCCP 0.25 <0.125 0.5
STR+VER 0.25 <0.125 0.25
STR+CCCP+VER 0.25 <0.125 0.25
OFL 0.25 0.25 0.25
OFL+CCCP 0.25 0.25 0.25
OFL+VER 0.25 0.25 0.25
OFL+CCCP+VER 0.25 0.25 0.25
NOR 0.25 0.25 0.25
NOR+CCCP 0.25 0.25 0.25
NOR+VER 0.25 0.25 0.25
NOR+CCCP+VER 0.25 0.25 0.25

RIF, rifampicin; INH, isoniazid; EMB, ethambutol; STR,
streptomycin; OFL, ofloxacin; NOR, norfloxacin; CCCP, carbonyl
cyanide m-chlorophenylhydrazone; MIC, minimum inhibitory
concentration; VER, verapamil

Table IV. Organisms, which show maximum homology with amino
acid sequence of JefA

 Identity within proteomeso

 Identity
Protein description Organism (%)

Mycobacteria:
 Putative integral membrane M. bovis BCG pasteur 100
 transport protein
 Putative transmembrane M. tuberculosis 100
 transport protein [H.sub.37]Ra
 Probable conserved M. bovis 99
 membrane transport protein
 Conserved integral M. ulcerans 77
 membrane transport protein
 Drug resistance transporter, M. vanbaalenii 30
 EmrB/QacA
Other bacteria:
 Drug resistance transporter, Salinispora arenicola 39
 EmrB/QacA
 Putative eflux membrane Streptomyces 36
 protein avermitilis
 Drug resistance transporter, Verminephovector 35
 EmrB/QacA eiseniae
 Drug resistance transporter Frankia species 34
 EmrB/QacA
 Major facilitator superfamily Serratia 34
 MFS_1 proteamaculans
Human:
 Vesicular acetylcholine Homo sapiens 27
 transporter (VAChT)
 solute carrier family 17 Homo sapiens 25
 (sodium phosphate)
 solute carrier family Homo sapiens 23
 2 (facilitated glucose
 transporter)
 sodium-dependent inorganic Homo sapiens 21
 phosphate cotransporter
 SLC17A8 protein Homo sapiens 21
COPYRIGHT 2010 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Gupta, Anuj Kumar; Reddy, Vineel P.; Lavania, Mallika; Chauhan, D.S.; Venkatesan, K.; Sharma, V.D.;
Publication:Indian Journal of Medical Research
Article Type:Report
Geographic Code:9INDI
Date:Aug 1, 2010
Words:5995
Previous Article:Safety & immunogenicity of tgAAC09, a recombinant adeno-associated virus type 2 HIV-1 subtype C vaccine in India.
Next Article:A new approach on stress-related depression & anxiety: Neuro-Psycho-Physical-Optimization with Radio Electric Asymmetric-Conveyer.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters