Printer Friendly

cDNA Cloning and Expression of Proliferating Cell Nuclear Antigen (PCNA) in White Leg Shrimp (Litopenaeus vannamei) Challenged With Vibrio anguillarum.

Byline: Faiz Muhammad, Shao Ming-Yu, Shi Xioli, Muhammad Shafi and Xiao-Ling Liu

Abstract

Key word: cDNA cloning, PCNA, bacterial challenge, Litopenaeus vannamei, DNA polymerase d.

INTRODUCTION

Proliferating cell nuclear antigen (PCNA) was referred to as an auxiliary protein for mammalain DNA polymerase-d (Bravo et al., 1987; Prelich et al., 1987). It has pivotal function in nucleic acid metabolism and is involved in many different cellular processess like repair (Celis and Madsen, 1986), UV- induced DNA damage (Kelman, 1997; Wood et al., 2007), cell- cycle control and chromatin remodeling ( Tsuirmot, 1998; Maga and Hubscher, 2003), and catalysis stimulation (Hutton et al., 2008). Besides that, the role of PCNA has also been reported in spermatogenesis and oogensis in vertebrates and invertebrates including Mursupenaeus japonicus (Zuber et al., 1989; Goldlewski et al., 1999; Miura et al., 2002; Zhang et al., 2010). PCNA has also been reported to be involved in cell proliferation during zebrafish larval development (Meule et al.,2006).

The PCNA has been isolated from several organisms including mammals (Almendral et al., 1987; Matsumoto et al., 1987; Yamaguchi et al., 1991), insects (Yamaguchi et al., 1990; Tammariello and Denlinger, 1998; Ruike et al., 2006), higher plants (Lopez et al., 1995, 1997; Strzalka and Ziemienowicz, 2007; O'Reilly et al., 1989), marine phytoplankton (Guerini et al., 2000), protozoa (Lin and Carpenter, 1998) and fungi (Bauer and Burgers,1990; Hamada et al., 2002).

Xie et al. (2010) have investigated the PCNA in penaeid shrimp Fenneropenaeus chinensis and examined the response of immune tissues against bacteria (V. anguillarum) and white spot syndrome virus (WSSV). Zhang et al. (2010) have studied the molecular mechanism of gonadal development in Marsupenaesu japonicus.

In the present study, PCNA of white leg shrimp, Litopenaeus challenged with Vibrio angullarium has been cloned and expressed in immune related tissues of L. vannamei. The aim of this study was to have indepth knowledge of the effect of bacterial-stimulated responses of lymphoid organ, hepatopancreas, gill and muscle. The work will provide important contribtions to the existing knowledge of host pathogen relationship.

MATERIALS AND METHODS

Experimental shrimps

Shrimps (L. vannamei), average size 12.25 cm and average body weight 15.3g, were obtained from Qingdao Fish Market and acclimatized in tanks before the experiment. The seawater was aerated continuously using airstones. The temprature was maintained at 17+-1degC throughout the acclimatization and experiment period. Shrimps were fed with polychete twice a day. The sea water was renewed twice a day. The shrimps were divided into two groups (control and treated) in tanks.

Bacterial challenge

The bacterial challenge experiment was initiated by injecting each shrimp with 100 ul of Vibrio anguillarum (1.8x107 cells per mL). A similar control group of shrimp were injected with 100 ul of sterile PBS (pH 7.2).

The tissues including lymphoid organ, hepatopancreas, gills and muscle were dissected and frozen in liquid nitrogen for total RNA extraction. Four individuals were randomly sampled at each time point of 2, 6, 12, 24, and 48 h post-injection.

Total RNA extraction

The tissues were homogenised in D solution (Guanidine thiocyanate 48g, sodium lauryl sarcosinate 0.5g and 0.75mol/L sodium citrate 3.33ml pH 7) followed by phenol/chloroform extraction. Total RNA was precipitated in isopropanol washed with ethanol and dissolved in DEPC (diethyl pyrocarbonate) water. The concentration were measured with spectrophotometry and the integrety of RNA was checked on 1.2% agorase gel. The RNA was stored at -80degC until use (Qiu et al., 2009).

First strand cDNA synthesis

The cDNA prepared from total RNA by Moloney Murine Leukemia virus transcriptase at 37degC for 15 min followed by 85degC for 5s with oligo-dT adaptor primer following the protocol of manufacture (a reverse transcription system (Promega) (Qiu et al., 2009).

Cloning of full length LvPCNA and sequencing

The short fragment of LvPCNA was cloned using degenerated primers from conserved regions of availabe sequences and designed a pair of primers PCNA-F2 (TTGCCATCTTGTGAGTTTGC) and PCNA-R2 (TGCCTCCTCCTCCTTGTCTA). The obtained PCR product was separated by 1.2% agarose gel, and purified by PCR purification kit. The product was ligated with PMD18-T vector (Takara) and transfered into the competent cells (E.coli DH5a). The selected clones were screened with M13 forward and reverse primers, and the positive clones were sequenced by Huada Institute for Gene Research Center. The similarity analysis of L. vannamei PCNA (LvPCNA) with other known sequences was done using Blast programs (www.ncbi.nim.nih.gov/). The RACE amplification was conducted using the specific primers (CCTGCACAAAGGAAGGAGTC for 5' end and CAGATACGTGCGAACTCCCCAGAAG for 3' end) of LvPCNA. The PCR condition for RACE profile was 94degC, 4 min; 94degC, 30 s; 68degC, 30 s; 72degC, 1 min; 35 cycles; 72degC, 5 min.

The target RACE product was purified, subcloned, sequenced, and assembled.

Statistical analysis

Data were presented as the mean +- standard error. Significant differences between means were tested using one-way analysis of variance followed by least significant difference tests, using the SPSS statistical package (version 13.0) at a significance level of p less than 0.05.

RT-PCR analysis of LvPCNA mRNA expression

The real time (RT) PCR analysis was performed on ABI 7500 real time detection system in the presence of SYBR-green. 152 bp fragment of PCR product was amplified using forward and reverse primers of LvPCNA (forward: TGTCGCTCGTGTCCCTCA and reverse: ACGGTGTCTGCGTTATCCTG). The total volume of 20 ul, containing 10 ul of 2 X SYBR Green Master Mix, 1 ul of diluted cDNA, 1 ul of each primer, 0.4 ul of ROX reference dye (50X) and the total volume was adjusted with PCR graded water. The PCR profile was 95degC for 10 min; followed by 40 cycles of 95degC for15 s; 60degC, for 1 min. Each plate was run with the internal control (b-actin) gene as reference gene In the end of PCR analysis of amplification products was taken based on the dissociation curve. Data were analyzed using the 7500 System Sequence Detection Software Version 1.4.0.25 (PE Applied Biosystems, Foster City, CA, USA). The results were presented as fold transcription relative to that of the b-actin gene with the what is this 2-DDCt method.

RESULTS

Full length and phylogenetic analysis of Lv PCNA LvPCNA had a total of 1131 bp nucleotide sequence which was deposited in GenBank (accession No: JN546075.1). The sequence analysis showed that there is a 112 bp 5'UTR, a 233 bp of 3'UTR and ORF of 786 bp which encodes 261 amino acids. Its molecular mass is 28.8 KDa and predicted isoelectric point (pl) 4.470. It has 24 strong basic amino acids, 40 strongly acidic amino acids, 93 hydrophobic amino acids and 67 polar amino acids. The protein blast (blastp) search of the NCBI showed that LvPCNA had high homology with other animals such as 98% with M. japonicas, 98% with F. chinensis, 84% with Eriocheir sinensis, 82% with Spodoptera frugiperda and 80% with Drosophila melanogaster. Multiple alignment of LvPCNA showed that it was well conserved among other examined organisms; and the eukaryotic conserved domains of PCNA were also noted in the multiple amino acid sequence (Figs. 1, 2).

The constructed phylogenetic tree based on the amino acid sequence of PCNA indicated that LvPCNA has close evolutionary line with crustacean, followed by insects and comparatively less related with human (Fig. 3).

Tissue distribution

The real-time RT-PCR revealed that expression LvPCNA is present in all the investigated tissues and noted transcripts level is significantly high in muscle and gill than in lymphoid organ and hepatopancreas (Fig. 4). The expression level of muscle is 1.7 times higher than the hepatopancreas, while the comparison with gill showed no difference; similarly it is 1.3 times higher than lymphoid organ.

Expression level of LvPCNA in tissues challenged with bacteria

The expression of LvPCNA in hepatopancreas of L. vannamei after Vibrio challenge is shown in Figure 4. In hepatopancreas the highest expression was noted at 12 h and 48 h, while at other time points it showed inhibitory response.

DISCUSSION

PCNA has been cloned in several species including crustaceans, such as F. chinensis, M. japonicus and Eriocheir japonica sinensis (Chines mitten crab). We have successfully cloned PCNA in L. vannamei an important aquaculture species. The multiple alignment of LvPCNA showed that it has certain conserved domains of eukaryotic PCNA like interdomain connecting loop, a C terminal tail and Center loop. These conserved domains were also discussed in F. chinensis (Xie et al., 2008 ), M. japonicas (Zhang et al., 2010) and Eriocheir japonica sinensis (Zha et al., 2010). For replication and other nucleic acid metabolisms the domains are important (Tsurimot, 1998; Maga and Hubscher, 2003). The homology of LvPCNA and deduced amino acid analysis showed that it is closest to arthropods and it denoted high conservation among other counterpart species. Earlier it has been reported (Xie et al., 2008, Zhang et al., 2010) that PCNA expression level in nonproliferating cells is either absent or is at low level (Xie et al., 2008).

Our analysis in LvPCNA suggest that the PCNA is well expressed in proliferating tissues. The present study support the existing knowledge of expression pattern in tissues of examined crustacean organism. In human the PCNA has role for prognosis of tumor and cancer development (Lee et al., 1995) because of active role in proliferation. Besides crustacean and human, the proliferation of PCNA has also been examined by Liu et al. (2005) in dinoflagellate (Prorocentrum donghaiens) and in green algae (Dunaliella salina) and considered it as a marker of cell proliferation.

The present study suggests that PCNA is well expressed in gill, muscle, lymphoid organ and hepatopancrease respectively and these expression patterns are in accordance with F. chinensis (Xie et al., 2008).

It is the first study of hepatopancreas after bacterial challenge. Earlier in F. chinensis (Xie et al., 2008) the HPT investigated after Vibrio anguillarum challenge and reported up regulation at 6, 24, 72 and 96 h respective. In hepatopancreas the up regulation was observed after 12 and 48 h. The present experiment revealed that LvPCNA is involved in immune responses, however, in depth immune related experiments are still needed, which will be more important to know the immune role of PCNA in crustaceans.

ACKNOWLEDGEMENT

The first author is grateful to China Government Scholarship Council for Ph.D. scholarship. The present study is part of Ph.D. dissertation.

REFERENCES

ALMENDRAL, J.M., HUEBSCH, D., BLUNDELL, P.A., MACDONALD-BRAVO, H. AND BRAVO, R., 1987. Cloning and sequence of the human nuclear protein cyclin: homology with DNA-binding proteins. Proc. natl. Acad. Sci. USA., 84: 1575-1579.

BAUER, G.A. AND BURGER, P.M.J., 1990. Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucl. Acids Res., 18: 261-265.

BRAVO, R., FRANK, R., BLUNDELL, P.A. AND MACDONALD-BRAVO, H., 1987. Cyclin/PCNA is the auxiliary protein of DNA polymerase-d. Nature, 326: 515-517.

CELIS, J.E. AND MADSEN, P. 1986. Increased nuclear cyclin/PCNA antigen staining of no S-phase transformed humanamnion cells engaged in nucleotide excision DNA repair. FEBS Lett., 209: 277-283.

GOLDLEWSKI, A., BOLOZ, W. AND CHILARSKI, A., 1999. The anti-PCNA reaction in the seminiferous tubule cells of lewis rat testis. Part II: the unilateral inflammatory effect of Freund's complete adjuvant. Fol. Histochem. Cytobiol., 37: 81-82.

GUERINI, M.N., QUE, X., REED, S.L. AND WHITE, M.W., 2000. Two genes encoding unique proliferating-cell nuclear antigens are expressed in Toxoplasma gondii. Mol. Biochem. Parasitol., 109: 121-131.

HAMADA, F., NAMEKAWA, S., KASAI, N. NARA, T., KIMURA, S., SUGWARA, F. AND SAKAGUCHI, K., 2002. Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus. Eurp. J. Biochem., 269: 164-174

HUTTON, R.D., ROBERTS, J.A., PENEDO, J.C. AND WHITE, M.F., 2008. PCNA stimulates catalysis by structure- specific nucleases using two distinct mechanisms: substrate targeting and catalvtic step. Nucl. Acids Res., 36: 6720-6727.

KELMAN, Z., 1997. PCNA: Structure, functions and interactions. Oncogene, 14: 629-640.

LEE, C.S., REDSHAW, A. AND BOAG, G., 1995. Assesment of cell proliferatin in human laryngeal cancers using PCNA and ki-67 antigen immunostaining. Cell. Vis., 2: 296-300.

LIN, S. AND CARPENTER, E. J., 1998. Identification and preliminary characterization of PCNA gene in the marine phytoplankton Dunaliella tertiolecta and Isochrysis galbana. Mol. Mar. Biol. Biotech., 7: 62-71.

LIU, J., JIAO, N., HONG, H., LUO, T. AND CAI, H., 2005. Proliferating cell nuclear antigen (PCNA) as a marker of cell proliferation in the marine dinoflagellate Proracentnum donghalense and the green alga Dunallella salina. Teodoresco. J. appl. Phycol., 17: 323-330.

LOPEZ, I., KHAN, S., VAZQUEZ-RAMOS, J. AND HUSSEY, P.J., 1995. Molecular cloning of a maize cDNA clone encoding a putative proliferating cell nuclear antigen. Biochem. biophys. Acta, 1260: 119-121.

LOPEZ, I., KHAN, S., VAZQUEZ, J. AND HUSSEY, P.J., 1997. The proliferating cell nuclear antigen (PCNA) gene family in Zea mays is composed of two members that have similar expression programmes. Biochem. biophys. Acta, 1353: 1-6.

MAGA, G. AND HUBSCHER, U., 2003. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J. Cell Sci., 116: 3051-3060.

MATSUMOTO, K., MORIUCHI, T., KOJI, T. AND NAKANE, P.K., 1987. Molecular cloning of cDNA coding for rat proliferating cell nuclear antigene (PCNA)/cyclin. EMBO. J., 6: 637-642.

MEULEN, V.D. T., SCHIPPER, H., VAN DEN BOOGAART, J.G., HUISING, M.O., KRANENBARG, S., AND VAN LEEUWEN, J.L., 2006. Endurance exercise differentially stimulates heart and axial muscle development in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. comp. physiol., 291: R1040-R1048.

MIURA, C., MIURA, T., AND YAMASHITA, M., 2002. PCNA protein expression during spermatogenesis of the Japanese ell (Anguilla japonica ). Zool. Sci., 19: 87-91.

O'REILLY, D.R., CRAWFORD, A.M. AND MILLER, L.K., 1989. Viral proliferating cell nuclear antigen of cycling and no cycling cells in synchronized pea roots tips. Planta, 202: 188-195.

PRELICH, G., TAN, C.K., KOSTURA, M., MATHEWS, M.B., SO, A.G., DOWNEY, K.M. AND STILLMAN, B., 1987. Functional identity of proliferating cell nuclear antigen and a DNA polymerase-d auxiliary protein. Nature, 326: 517-520.

QIU, L., JIANG, S., HUANG, J., WANG, W., ZHU, C, AND SU, T., 2009. Molecular cloning and mRNA expression of cyclophilin A gene in black tiger shrimp (P. monodon). Fish & Shellfish Immunol., 26: 115-121.

RUIKE, T., TAKEUCHI, R., TAKATA, K., OSHIGE, M., KASAI, N., SHIMANOUCHI, K., KANI, Y., NAKAMURA, R., SUGAWARA, F. AND SAKAGUCHI, K., 2006. Characterization of a second proliferating cell nuclear antigene (PCNA2) from Drosophila melanogaster. FEBS J., 273: 5062-5073.

STRZALKA, W. AND ZIEMIENOWICZ, A., 2007. Molecular cloning of Phaseolus vulgaris cDNA encoding proliferating cell nuclear antigen. J. Pl. Physiol., 164: 209-213.

TAMMARIELLO, S.P. AND DENLINGER, D.L., 1998. Cloning and sequencing of proliferating cell nuclear antigen (PCNA) from the flesh fly, Sarcophaga crassipalpis, and its expression in response to cold shock and heat shock. Gene, 215: 425-429.

TSURIMOTO, T., 1998. PCNA, a multifunctional ring on DNA, Biochem. biophys. Acta, 1443: 23-39.

WOOD, A., GARG, P. AND BURGER, M.J.P., 2007. A ubiquitin binding motif in the translesion DNA polymerase Rev 1 mediates its essential functional interaction with ubiquitinated PCNA in response to DNA damage. J. biol. Chem., 5: 5-14.

XIE, Y., WANG, B., LI, F., JIANG, H. AND XIANG, J., 2008.

Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. Part B, 151: 225-229.

YAMAGUCHI, M., NISHIDA, Y., MORIUCHI, T., HIROSE, F., HUI, C.C., ZUZUKI, Y. AND MATSUKAGE, A., 1990. Drosophila proliferating cell nuclear antigen (Cycling) gene: structure, expression during development and specific binding of homeodomain proteins to its 5'-flanking region. Mol. Cell. Biol., 10: 872-879.

YAMAGUCHI, M., HAYASHI, Y., HIROSE, F., MATSUOKA, S., MORIUCHI, T., SHIROISHI, T., MORIWAKI, K. AND MATSUKAGE, A., 1991. Molecular cloning and structural analysis of mouse gene and pseudogenes for proliferating cell nuclear antigen. Nucl. Acids Res., 19: 2403-2410.

ZHA, P.L., CHEN, Y.K.C., SUN, HONGYING, S., SONG, D. AND ZHOU, K., 2010. Identification , mRNA expression and characterization of proliferating cell nuclear antigen gene from Chinese mitten crab Eriocheir japonica sinensis. Comp. Bochem. Physiol. Part A., 157: 170-176.

ZHANG, Z., BINGLING, S., WANG, Y., CHEN,Y., WANG, G., LIN, P. AND ZOU, Z., 2010. Molecular cloning of proliferating cell nuclear antigen and its differential expression analysis in the developing ovary and testis of penaeid shrimp Marsupenaeus japonicus. DNA Cell Biol., 29: 163-170.

ZUBER, M., YASUI, W., TAN, E.M. AND RYOJI, M., 1989. Quantitation and subcellular localization of proliferating cell nuclear antigen (PCNA/cyclin) in oocytes and egges of Xonopus laevis. Exp. Cell Res., 182: 384-393.

1Key Laboratory of Marine Genetics and Breeding, Ocean University of China, Ministry of Education, Qingdao 266003, P.R. China.

2Centre of Excellence in Marine Biology, University of Karachi, Pakistan

3College of Life Sciences, Yantai University. Yantai 264005, China

Corresponding author: balouch_17@yahoo.com
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Muhammad, Faiz; Ming-Yu, Shao; Xioli, Shi; Shafi, Muhammad; Liu, Xiao-Ling
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Aug 31, 2012
Words:2771
Previous Article:Development and Growth of Exochomus quadripustulatus (Coleoptera: Coccinellidae): a Predator of Mussel Scale Lepidosaphes ulmi (Homoptera:...
Next Article:Evaluation of In-burrow Baiting Technique for Control of Rodents in Groundnut Crop.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters