Printer Friendly

Y[Cl.sub.3] Promotes Neuronal Cell Death by Inducing Apoptotic Pathways in Rats.

1. Introduction

Metal ions from drinking water and food have been extensively reported to be of importance in affecting our health. Rare earth elements (REEs) are widely used in medical, agricultural, and industrial fields [1]. Many REEs show medicinal benefits for human health [2]. [sup.90] Yttrium ([sup.90] Y), a high energy beta particle-radiating radioisotope, has been comprehensively used in clinical situation since 1969. [sup.90]Y therapy has two available radioembolization devices, including glass microspheres called TheraSphere and resin microspheres called SIR-Sphere [3], for management of colorectal cancer and liver metastases [4]. Yttrium oxide nanoparticle is known as free radicals scavenger to protect undifferentiated PC12 cells from oxidative stress-induced apoptosis [5].

Recently, REEs are considered as emerging trace pollutants, indicating that REEs are relatively safe [6]. Although increasing evidence shows that REEs promote the production in agriculture and poultry industry, the negative impacts of REEs accumulation in human body through the food chain have been confirmed [7]. Animal studies have also demonstrated that REEs may produce severe adverse effects by inducing imbalance of oxidative stress in human body, and leading to development of hypertension [8]. Long-term administration of REEs may cause negative outcomes. 15 REEs, including yttrium, have been biologically evaluated and proved for risk in inducing hypertension in housewives [9]. The possible explanation might be associated with the disturbance of REEs in redox balance, causing chronic oxidative stress damage and cell apoptosis [10]. Another theory may be related to their competition with those important nutritional ions, such as [Ca.sup..sup.2+]], [Zn.sup.2+], [Mg.sup.2+], and [Cu.sup.2+] [11]. The exact mechanism is still unclear.

Apoptosis occurs extensively during nervous system development and is important for the establishment of neuronal populations with correct sizes. In addition, apoptosis is one of the major mechanisms of neuronal death in pathological development. Brain functional alternation or damage may be induced by pathological neuronal apoptosis. Methamphetamine (METH) induced neuronal apoptosis may impair adult hippocampal neurogenesis, which is related to maintenance of hippocampal-dependent learning and memory [12]. Similarly, neuronal apoptosis in hippocampus, cortex, and striatum is involved in high altitude-induced memory impairment [13]. In this study, we determined whether Y[Cl.sub.3] induced neuronal cell death by regulating apoptotic pathways.

2. Materials and Methods

2.1. General. Yttrium chloride (purity > 99.99%) was obtained from Sigma-Aldrich (St. Louis, USA). The in situ cell death detection kit, POD (number 1684817), was bought from Roche Applied Science (China). SYBR[R] Premix Ex Taq[TM] II (Tli RNaseH Plus) was from TaKaRa (Code: DRR420). DAPK, XIAP, Bcl-2, Bax, caspase-3, Cyto c, and GAPDH monoclonal antibodies were purchased from Cell Signaling Technology, Inc. (China).

The study was approved by the Experimental Animal Ethics Committee of Gannan Medical College (number 2009006). Adult Wistar rats (120-140 g) were randomly divided into three groups: negative control group (drinking water) and yttrium chloride (12mmol/L and 24mmol/L) groups. The dosages of Y[Cl.sub.3] were recommended by our previous studies (data not shown). The rats were sacrificed for assays after six-month free access to water containing Y[Cl.sub.3].

2.2. Immunohistochemistry. Tissue microarray (TMA) consisting of brain cerebral cortex tissue was constructed. Formalin-fixed and paraffin-embedded cerebral cortex section was dewaxed in xylene and graded alcohols, hydrated, and washed in PBS. After pretreatment in a microwave oven, endogenous peroxidase was blocked by 3% hydrogen peroxide in methanol for 20 min, followed by avidin-biotin inhibition using a biotin-blocking kit (DAKO, Germany). Slides were then incubated with DAPK, XIAP, Bcl-2, Bax, caspase-3, Cyto c, and GAPDH antibodies, overnight in a moist chamber at 4[degrees]C, washed in PBS, and incubated with biotinylated goat anti-rat antibodies (1 : 2000, Proteintech Group). Slides were developed with DAB and counterstained with hematoxylin. Image-Pro Plus 6.0 software (Media Cybernetics, United States) was employed for evaluation and the results were presented as mean optical density (MOD) values.

2.3. In Situ Cell Apoptosis Detection. TUNEL staining was performed according to the in situ cell death detection kit protocol. Briefly, Brain cerebral cortex tissues can be pretreated as immunohistochemistry. The sections were incubated with the TUNEL labeling solution for 60 min at 37[degrees]C, and stained with POD. The images observation and analysis were referred to the immunohistochemistry.

2.4. Gene Expression Analysis. Total RNA was extracted from fresh brain cerebral cortex tissue using the Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. First-strand cDNA was generated by reverse transcription of 5 pg RNA samples. Real-time PCR was performed using a Real-Time PCR System (Applied Biosystems, USA). The primers were designed using primer premier 5.0 and the sequences were presented in Table 1. The target gene mRNA expression levels were normalized to the GAPDH expression using the 2-AACt method.

2.5. Western-Blot Analysis. Total protein was extracted from fresh brain cerebral cortex tissue. Then the extracted proteins were applied to a 12% SDS-polyacrylamide gel for electrophoresis. The proteins were transported to PVDF membrane and incubated with DAPK, XIAP, Bcl-2, Bax, caspase3, Cyto c, and GAPDH antibodies, followed by incubation with HRP-conjugated anti-mouse IgG for 1h. Proteins were detected using enhanced chemiluminescence reagent (Pierce, USA) according to the manufacturer's protocol.

2.6. Statistical Analyses. All of the results were analyzed using one-way ANOVA to examine mean differences between groups. P values < 0.05 were considered as statistically significant.

3. Results

3.1. Y[Cl.sub.3] Promoted Neuron Cells Death In Vivo. To investigate the toxicity of Y[Cl.sub.3] in rat brain, the cerebral cortex tissues were prepared for TUNEL staining. As indicated in Figure 1, Y[Cl.sub.3] treatment promoted neuron cells death in a dose-dependent manner. After treatment with 24mmol/L Y[Cl.sub.3], the apoptotic ratio of neuron cells was significantly increased, compared with that in the negative control group.

3.2. Y[Cl.sub.3] Promoted the Expression of Apoptosis Factors In Situ. To prove the effects of YC13 on cell apoptosis in neuron cells, we investigated the expression of apoptosis factors, including XIAP, Bcl-2, Bax, caspase-3, and Cyto c, by immunohistochemistry in situ (Figure 2). As a result, Y[Cl.sub.3] treatment significantly promoted upregulation of apoptosis-related factors Bax, caspase-3, and Cyto c and downregulation of antiapoptosis-related factors XIAP and Bcl-2 dose-dependently. Thus, Y[Cl.sub.3] promoted brain damaged by induction of apoptosis pathways.

3.3. Y[Cl.sub.3] Activated the Genes Expression of Apoptosis Pathways. To determine whether Y[Cl.sub.3] exhibited proapoptosis activity by regulating the gene expression of apoptotic pathways, we quantified the mRNA expression of DAPK, XIAP, Bcl-2, Bax, caspase-3, and Cyto c by real-time PCR (Figure 3). Y[Cl.sub.3] treatment upregulated DAPK, Bax, caspase-3, and Cyto c genes expression, while it significantly downregulated the genes expression of XIAP and Bcl-2.

3.4. Y[Cl.sub.3] Upregulated the Protein Expression of Apoptotic Pathways. To further determine the changes of apoptotic pathways induced by Y[Cl.sub.3] treatment in protein level, western-blot assays were applied (Figure 4). With similar trend to their change in gene expression, the apoptotic expressions of DAPK, Bax, caspase-3, and Cyto c proteins were found to be upregulated, while Y[Cl.sub.3] treatment significantly down-regulated XIAP and Bcl-2 protein expression, compared with those in the control group.

4. Discussion

One of the outstanding characters of neurodegenerative diseases is aberrant neuronal death, which can be induced by stroke, trauma, or other detrimental stimulants, such as REEs [14]. Our previous epidemiological investigation found that the health of the local residents in the south of Jiangxi Province in China, where is the place rich in REEs, has been greatly impacted and damaged. The distribution of yttrium in rats has been determined and showed that it can be severely accumulated in stomach, lungs, kidney, spleen, and thighbone as time goes on (these data are published in Chinese) [15]. To determine whether yttrium induced the neuronal cell death, we further tested the proapoptotic role of Y[Cl.sub.3] in neuronal cells.

Our results demonstrated that Y[Cl.sub.3] treatment greatly promoted neuron cells death. The chromosomal DNA fragments are the basic features of neuron cells death, which can be detected by TUNEL analysis [16]. Our study showed that the number of TUNEL-positive neuron cells we quantified was significantly altered in vivo by Y[Cl.sub.3] treatment. To further prove the neuronal cells apoptosis induced by Y[Cl.sub.3], immunohistochemistry was employed to verify the activation of apoptosis signaling pathways in situ. The caspase family of proteases is the crucial player responsible for the deliberate disassembly of the cells into apoptotic bodies. Caspases are inactive monomeric proenzymes that require dimerization and are activated by proteolytic cleavage [17,18]. But caspase 8 and caspase-9 are activated by dimerization and not by proteolytic cleavage [19]. Once activated, caspases can cleave and activate other caspases, resulting in a positively accelerated feedback loop of activation [20-22]. Caspase-3 and caspase 9 are in the pivotal junctions in apoptosis signaling pathways. Caspase-9 activates disassembly in response to agents that stimulates the release of Cyto c from mitochondria. Caspase3 appears to amplify the initiation signals of caspase-9 into full-fledged commitment to disassembly [23]. Y[Cl.sub.3] treatment effectively initiated the activation loop and significantly upregulated the activation of caspase-3 and Cyto c, leading to initiation of neuronal cell apoptosis.

Bcl-2 family proteins are the crucial players in caspases activation and apoptosis regulation. Bcl-2, an antiapoptosis protein, has been demonstrated to prevent or delay the initiation of apoptosis induced by a variety of stimuli through prevention of the release of mitochondria activators of caspases [24]. Specifically, Bcl-2 may associate with the apoptosis activating factor-1 (Apaf-1) to prevent the release of Cyto c and the activation of caspase-3 and caspase9 [25]. Another important feature of Bcl-2 family is to form a homo- or heterodimers, neutralizing the competition between these proteins. Bcl-2 can form a heterodimer with Bax, a proapoptotic protein, leading to restraining their proapoptotic activity [26, 27]. The interaction of complexes between antiapoptosis proteins and proapoptosis proteins demonstrates a simple competition model for apoptotic regulation [28]. Y[Cl.sub.3] promoted neuronal cells apoptosis might be association the imbalance of complex between Bcl2 and Bax, as indicated by upregulation of Bax and downregulation of Bcl-2. Unfortunately, we did not determine the amount changes of Bcl-2 and Bax, respectively, in their complex.

XIAP, a member of IAP family with baculovirus IAP repeat (BIR) domain, has been shown to bind to and inhibit caspase-3 and caspase-7 via the BIR2 linker region, leading to alternation of cellular localization and blockage of the caspases docking to their substrates [29]. In addition, XIAP has been demonstrated to associate with the active caspase-9/Apaf-1 complex via BIR3 domain, leading to opposing effects on the caspase activity and apoptosis [30]. However, caspase-3 can cleave XIAP in a negative feedback loop to sensitize cells to apoptosis [31]. In this study, Y[Cl.sub.3] treatment downregulated XIAP at mRNA and protein levels, leading to upregulation of caspase-3 and apoptosis. DAPK, a calcium/calmodulin-regulated protein kinase, has been implicated in modulating cell apoptosis induced by stimuli. DAPK can promote caspase-linked apoptosis and p53-regulated cell death. It has been showed that DAPK is involved in neuronal cell death, and an inhibitor of DAPK can significantly ameliorate brain injury after ischemic stroke [32]. Significantly, the expression of DAPK in cerebral cortex tissues was upregulated by Y[Cl.sub.3] treatment. However, the potential mechanism is still unclear.

Conclusively, Y[Cl.sub.3] promoted neuronal cell apoptosis by upregulating the proapoptotic factors Bax, caspase-3, Cyto c, and DAPK and downregulating the antiapoptotic factors Bcl2 and XIAP.

http://dx.doi.org/10.1155/2017/2183658

Competing Interests

The authors declare that they have no competing interests.

Authors' Contributions

Yechun Ding and Yuantong Tian contributed equally to this study.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (21167001), the National Science Foundation of Jiangxi Province (20132BAB215025 and 2012ZBAB215001), and the Education Department of Jiangxi Province (GJJ150955).

References

[1] X. Du and T. E. Graedel, "Uncovering the end uses of the rare earth elements," Science of the Total Environment, vol. 461-462, pp. 781-784, 2013.

[2] X. Ai, C. J. H. Ho, J. Aw et al., "In vivo covalent cross-linking of photon-converted rare-earth nanostructures for tumour localization and theranostics," Nature Communications, vol. 7, Article ID 10432, 2016.

[3] B. I. Carr, "Hepatic arterial90 Yttrium glass microspheres (therasphere) for unresectable hepatocellular carcinoma: interim safety and survival data on 65 patients," Liver Transplantation, vol. 10, no. S2, pp. S107-S110, 2004.

[4] S. A. Gulec, "Y-90 radiomicrosphere therapy for colorectal cancer liver metastases," Seminars in Nuclear Medicine, vol. 46, no. 2, pp. 126-134, 2016.

[5] H. Ghaznavi, R. Najafi, S. Mehrzadi et al., "Neuro-protective effects of cerium and yttrium oxide nanoparticles on high glucose-induced oxidative stress and apoptosis in undifferentiated PC12 cells," Neurological Research, vol. 37, no. 7, pp. 624-632, 2015.

[6] G. Pagano, F. Aliberti, M. Guida et al., "Rare earth elements in human and animal health: state of art and research priorities," Environmental Research, vol. 142, pp. 215-220, 2015.

[7] S.-L. Tong, W.-Z. Zhu, Z.-H. Gao, Y.-X. Meng, R.-L. Peng, and G.-C. Lu, "Distribution characteristics of rare earth elements in children's scalp hair from a rare earths mining area in southern China," Journal of Environmental Science and Health. Part A Toxic/Hazardous Substances and Environmental Engineering, vol. 39, no. 9, pp. 2517-2532, 2004.

[8] J. De Champlain, R. Wu, H. Girouard et al., "Oxidative stress in hypertension," Clinical and Experimental Hypertension, vol. 26, no. 7-8, pp. 593-601, 2004.

[9] B. Wang, L. Yan, W. Huo et al., "Rare earth elements and hypertension risk among housewives: A Pilot Study in Shanxi Province, China," Environmental Pollution, vol. 220, pp. 837-842, 2017.

[10] M. Valcheva-Traykova, L. Saso, and I. Kostova, "Involvement of lanthanides in the free radicals homeostasis," Current Topics in Medicinal Chemistry, vol. 14, no. 22, pp. 2508-2519, 2014.

[11] M.-K. Choi and Y. J. Bae, "Association of magnesium intake with high blood pressure in Korean adults: Korea national health and nutrition examination survey 2007-2009," PLOS ONE, vol. 10, no. 6, Article ID e0130405, 2015.

[12] A. Venkatesan, L. Uzasci, Z. Chen et al., "Impairment of adult hippocampal neural progenitor proliferation by methamphetamine: role for nitrotyrosination," Molecular Brain, vol. 4, no. 1, article no. 28, 2011.

[13] P. Maiti, S. B. Singh, B. Mallick, S. Muthuraju, and G. Ilavazhagan, "High altitude memory impairment is due to neuronal apoptosis in hippocampus, cortex and striatum," Journal of Chemical Neuroanatomy, vol. 36, no. 3-4, pp. 227-238, 2008.

[14] A. M. Panichev, V. K. Popov, I. Y. Chekryzhov et al., "Rare earth elements upon assessment of reasons of the geophagy in Sikhote-Alin region (Russian Federation), Africa and other world regions," Environmental Geochemistry and Health, vol. 38, no. 6, pp. 1255-1270, 2016.

[15] Y. C. Ding, H. Y. Lan, Y. Guo et al., "Study on characteristics of accumulation and distribution ofrare earth elements Yttrium in rat organs and effects of lipid metabolism in employees," Journal of Gannan Medical University, pp. 840-843, 2015 (Chinese).

[16] M. Kristiansen and J. Ham, "Programmed cell death during neuronal development: the sympathetic neuron model," Cell Death and Differentiation, vol. 21, no. 7, pp. 1025-1035, 2014.

[17] N. A. Thornberry and Y. Lazebnik, "Caspases: enemies within," Science, vol. 281, no. 5381, pp. 1312-1316, 1998.

[18] G. Liu, G. Guan, J. Fang et al., "Macleaya cordata extract decreased diarrhea score and enhanced intestinal barrier function in growing piglets," BioMed Research International, vol. 2016, Article ID 1069585, 7 pages, 2016.

[19] K. M. Boatright, M. Renatus, F. L. Scott et al., "A unified model for apical caspase activation," Molecular Cell, vol. 11, no. 2, pp. 529-541, 2003.

[20] S. J. Riedl and Y. Shi, "Molecular mechanisms of caspase regulation during apoptosis," Nature Reviews Molecular Cell Biology, vol. 5, no. 11, pp. 897-907, 2004.

[21] G. Liu, G. Yang, G. Guan et al., "Effect of dietary selenium yeast supplementation on porcine circovirus type 2 (PCV2) infections in mice," PLoS ONE, vol. 10, no. 2, Article ID e0115833, 2015.

[22] G. Liu, J. Zhong, J. Ni, M. Chen, H. Xiao, and L. Huan, "Characteristics of the bovicin HJ50 gene cluster in Streptococcus bovis HJ50," Microbiology, vol. 155, no. 2, pp. 584-593, 2009.

[23] D. R. McIlwain, T. Berger, and T. W. Mak, "Caspase functions in cell death and disease," Cold Spring Harbor Perspectives in Biology, vol. 5, no. 4, pp. 1-28, 2013.

[24] D. T. Chao and S. J. Korsmeyer, "BCL-2 family: regulators of cell death," Annual Review of Immunology, vol. 16, pp. 395-419, 1998.

[25] A. Burlacu, "Regulation of apoptosis by Bcl-2 family proteins," Journal of Cellular and Molecular Medicine,vol. 7, no. 3,pp. 249-257, 2003.

[26] P. E. Czabotar, G. Lessene, A. Strasser, and J. M. Adams, "Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy," Nature Reviews Molecular Cell Biology, vol. 15, no. 1, pp. 49-63, 2014.

[27] L. Wu, H. Liu, L. Li et al., "5,7,3',4'-tetramethoxyflavone exhibits chondroprotective activity by targeting [beta]-catenin signaling in vivo and in vitro," Biochemical and Biophysical Research Communications, vol. 452, no. 3, pp. 682-688, 2014.

[28] S. N. Willis, J. I. Fletcher, T. Kaufmann et al., "Apoptosis initiated when BH3 ligands engage multiple Bcl-2 homologs, not Bax or Bak," Science, vol. 315, no. 5813, pp. 856-859, 2007

[29] B. P. Eckelman, G. S. Salvesen, and F. L. Scott, "Human inhibitor of apoptosis proteins: why XIAP is the black sheep of the family," EMBO Reports, vol. 7, no. 10, pp. 988-994, 2006.

[30] S. M. Srinivasula, R. Hegde, A. Saleh et al., "A conserved XIAP-interaction motif in caspase-9 and Smac/DIABLO regulates caspase activity and apoptosis," Nature, vol. 410, no. 6824, pp. 112-116, 2001.

[31] M. Hornle, N. Peters, B. Thayaparasingham, H. Vorsmann, H. Kashkar, and D. Kulms, "Caspase-3 cleaves XIAP in a positive feedback loop to sensitize melanoma cells to TRAIL-induced apoptosis," Oncogene, vol. 30, no. 5, pp. 575-587, 2011.

[32] A. V. Velentza, M. S. Wainwright, M. Zasadzki et al., "An aminopyridazine-based inhibitor of a pro-apoptotic protein kinase attenuates hypoxia-ischemia induced acute brain injury," Bioorganic and Medicinal Chemistry Letters, vol. 13, no. 20, pp. 34653470, 2003.

Yechun Ding, (1) Yuantong Tian, (1) Zhaoyi Zeng, (1) Ping Shuai, (2) Haiying Lan, (2) Xianshen Zhu, (2) Yi Zhong, (3) Longhuo Wu, (1) and Xiaona Fan (4)

(1) College of Pharmacy, Gannan Medical University, Ganzhou 341000, China

(2) School of Basic Medicine, Gannan Medical University, Ganzhou 341000, China

(3) The Third Affiliated Hospital, Gannan Medical University, Ganzhou 341000, China

(4) Research Department, Gannan Medical University, Ganzhou 341000, China

Correspondence should be addressed to Xiaona Fan; fxn918@126.com

Received 30 November 2016; Accepted 5 February 2017; Published 23 February 2017

Academic Editor: Gang Liu

Caption: Figure 1: Y[Cl.sub.3] promoted neuron cells death in vivo. NC: negative control; low dose (LD): 12mmol/L; high dose (HD): 24mmol/L. The quantification bar for the MOD of positive stain cells is expressed as means [+ or -] SD, n = 5. * P < 0.05, refers to statistical significance, yttrium chloride group versus control group.

Caption: Figure 2: Y[Cl.sub.3] promoted the expression of apoptosis factors in situ. NC: negative control; low dose (LD): 12mmol/L; high dose (HD): 24mmol/L. The quantification bar for the MOD of positive stain cells is expressed as means [+ or -] SD, n = 5. * P < 0.05, refers to statistical significance, yttrium chloride group versus control group.

Caption: Figure 3: The change in genes expression of apoptosis-related pathways induced by Y[Cl.sub.3]. Values are expressed as means [+ or -] SD, n =6. "P < 0.05 as compared with the control group.

Caption: Figure 4: The change in proteins expression of apoptosis-related pathways induced by Y[Cl.sub.3]. Values are expressed as means [+ or -] SD, n = 6. * P < 0.05 as compared with the control group.
Table 1: Primer sequences used in the study for real-time PCR.

                 Primer sequence (5; [right arrow] 3;)

                     Sense                      Antisense

DAPK         TGAGAATGTGAGCGTGAGGAG        GAGCAGTGTAGGTGGTGAGAC
XIAP         TCTACTACACGGGGATTGATGA       CGAAGAAGCAGTTGGGAAAG
Bcl-2         GGTGGACAACATCGCTCTG         ACAGCCAGGAGAAATCAAACA
Bax           GCGATGAACTGGACAACAAC        GCAAAGTAGAAAAGGGCAACC
Cyto c       AGGCTGCTGGATTCTCTTACA        GTCTGCCCTTTCTCCCTTCT
Casp3         ACTGGACTGTGGCATTGAGA       AATTTCGCCAGGAATAGTAACC
GAPDH     TGGGTAGAATCATACTGGAACATGTAG     AGGGCTGCCTTCTCTTGTGAC
COPYRIGHT 2017 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Ding, Yechun; Tian, Yuantong; Zeng, Zhaoyi; Shuai, Ping; Lan, Haiying; Zhu, Xianshen; Zhong, Yi; Wu,
Publication:BioMed Research International
Article Type:Report
Date:Jan 1, 2017
Words:3366
Previous Article:Auris System: Providing Vibrotactile Feedback for Hearing Impaired Population.
Next Article:Prevalence and Risk Factors of Asthma, Rhinitis, and Eczema and Their Multimorbidity among Young Adults in Kuwait: A Cross-Sectional Study.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |