Printer Friendly

Urine antibody tests: new insights into the dynamics of HIV-1 infection.

AIDS was recognized in 1981. Within 2 years a retrovirus, eventually termed HIV-1, was found highly associated with the syndrome (1). The urgency to prevent the spread of the virus by the blood supply led to the creation of blood-based antibody tests to detect exposure of blood donors to the virus. In 1988, investigators at New York University (2) found that antibodies to HIV-1 could be detected in the urine of patients with HIV-1 infections. The Food and Drug Administration licensed the first screening enzyme immunoassay (EIA) [3] for the detection of urine HIV-1 antibodies (Calypte Biomedical) in 1996. The supplemental Calypte Biomedical urine HIV-1 Western blot (WB; formerly Cambridge Biotech) for the one-band gp160 confirmation test for urine HIV-1 antibodies was licensed in 1998. Advances in these technologies and insights they provide to the pathogenesis of HIV-1 infection are described here.

Urine and serum specimens collected at multiple geographic sites (11896 paired specimens) were screened by EIA for antibodies to HIV-1 (Calypte HIV-1 Urine Assay) and licensed blood tests. EIA repeatedly reactive (RR) specimens were confirmed for HIV-1 antibodies by WB tests (Calypte Biomedical HIV-1 WB test). The performance characteristics of the EIA screening assays are documented. The frequency of urine-negative/serum-positive (UNSP) reactivities was 0.17%. The frequency of urine-positive/serum-negative (UPSN) reactivities was 0.24%. We attribute such reactivities to a compartmentalized mucosal immune response to HIV-1 antigens, although autoilnmune reactivities caused by mimicry between "self-antigens" and HIV-1 antigens are not excluded. We define self-antigens as those either encoded by germ-line sequences or caused by recombinational events attributable to exposure to environmental biohazardous entities (3).

An analysis was carried out to identify the factors that influence indeterminate (ID) WB reactivities in specimens that registered EIA RR. This was done by scoring the number of WB bands to HIV-1 core and env antigens. The results showed that many more bands were found in serum than in urine specimens.

Recent reports of the protective role of HIV-1 IgA in urine and vaginal lavages led us to conduct a multisite study (25 991 paired specimens) to determine the frequency of urine HIV-1 IgA reactivity according to risk factors. The results clearly showed a significantly higher occurrence of HIV-1 IgA EIA reactivity with all high risk factors.

Tests using a urine specimen from a serum HIV-1 ID subject with HIV-1vau strain of group O showed that the urine EIA assay, combined with a confirmatory urine WB test, were effective in detecting HIV-1 antibodies. A mosaic analysis of the HIV-1vau env nucleotide sequence revealed a high frequency of homologies to human chromosome 7831, a fragile chromosomal site often implicated in human malignancies of diverse types. The new insights provided by these findings in the pathogenesis of HIV-1 infection are discussed.

Materials and Methods

PRINCIPLES OF THE URINE TEST PROCEDURES

The Calypte HIV-1 Urine EIA is an EIA that utilizes a recombinant envelope protein of HIV-1 to detect antibodies to HIV-1 in human urine. The recombinant gp160 envelope protein is adsorbed onto the wells of a micro-well plate. Urine specimens and controls, along with a sample buffer, are added to the wells and incubated. If antibodies to the HIV-1 envelope protein are present in the specimen, they bind to the antigen coated on the well. A wash step removes any unbound material. A conjugate consisting of alkaline phosphatase chemically bound to goat anti-human immunoglobulin is added to each well and incubated. The conjugate binds to HIV-1 antibodies that are bound to the immobilized antigen. A wash step removes any unbound conjugate. The substrate for the enzyme, p-nitrophenylphosphate, is added to all wells and incubated. If antibodies to HIV-1 are present in the specimen, the enzyme will cause the color to change from colorless to yellow. The intensity of the color is proportional to the amount of HIV-1 antibody present in the test specimen or control. The reaction is terminated by the addition of a stop solution containing EDTA. The absorbance values are determined spectrophotometrically with a plate reader at a peak wavelength of 405 nm. The positive and negative controls included with the test kit are used in two positive-control wells and three negative-control wells. A specimen is scored either reactive or nonreactive by comparing its absorbance value to a cutoff value, which is calculated by adding the mean absorbance value of the negative controls to a value of 0.180.

Samples that are initially reactive are retested in duplicate using the original specimen. If, after repeat testing, one or both of the duplicate tests are reactive, the specimen is considered EIA RR. Before a determination of HIV-1 status can be made, subjects that test EIA RR are confirmed for HIV-1 antibody using only the additional, more specific Calypte Biomedical HIV-1 urine WB kit.

The Calypte Biomedical HIV-1 urine WB Kit is manufactured from HIV-1 propagated in an H9/HTLV-[III.sub.B] T-lymphocyte cell line. Partially purified virus is inactivated by treatment with psoralen and ultraviolet light, and detergent disruption. HIV-1 proteins are fractionated according to molecular weight by electrophoresis on a polyacrylamide slab gel in the presence of sodium dodecyl sulfate. The separated HIV-1 proteins are electrotransferred from the gel to a nitrocellulose membrane, which is then washed, blocked (to minimize nonspecific immunoglobulin binding), and packaged. Individual nitrocellulose strips are incubated with specimens and controls. If HIV-1 antibodies are present, they bind to the viral antigens present on the nitrocellulose strips. The strips are washed again to remove unbound material. Visualization of the human immunoglobulins specifically bound to HIV-1 proteins is accomplished in situ using a series of reactions with goat anti-human IgG conjugated with biotin-avidin conjugated with horseradish peroxidase, and the horseradish peroxidase substrate 4-chloro-lnaphthol. If antibodies to HIV-1 antigens are present in the specimen in sufficient concentration, bands occur corresponding to the position of one or more of the following HIV-1 proteins (p) or glycoproteins (gp) on the nitrocellulose strip: p17, p24, p31, gp41, p51, p55, p66, gp120, gp160 (the number refers to the apparent molecular mass in kilodaltons). The interpretive criterion for a positive result using urine as the sample is the presence of a gp160 band with intensity equal to or greater than the intensity of the gp160 band on the low positive urine control strip. The interpretive criteria for a positive result using serum or plasma specimens (4) are the occurrences of any two or more of the following bands: p24, gp41, and gp120/160. Each band has a reactivity score of "+" or greater. Commonly, the band at gp41 or gp160 is diffuse. Other viral bands may or may not be present. A reactivity score of + is defined as a band with intensity at least as intense as the p24 band on the weakly reactive control strip but less intense than the p24 band on the strongly reactive control strip. The reactivity is scored as ID when WB bands are present that do not meet the criteria for positivity.

PATIENT GROUPS

Medical disorders consisted of autoimmune diseases including rheumatoid arthritis, Sjogren syndrome, systemic lupus erythematosus, idiopathic thrombocytopenia purpura, myasthenia gravis, multiple sclerosis, and autoimmune hemolytic anemia. Malignancies included chronic lymphocytic leukemia, breast cancer, lung cancer, colon cancer, Hodgkin disease, and multiple myeloma. The urologic disorders included acute glomerular nephritis, acute tubular necrosis, acute renal failure, chronic renal failure (on dialysis), and nephrotic syndrome. Subjects with medical conditions included subjects that required medical treatment or hospitalization, those who had attended a clinic for sexually transmitted diseases (STDs), multiparous and pregnant women, subjects with exertion dehydration, and subjects who had received multiple blood transfusions.

CLINICAL STUDIES

A clinical study in support of US licensure of the Calypte HIV-1 urine EIA was performed on 11,344 individuals to compare the accuracy of HIV-1 urine testing with US-licensed serum testing. These studies were extended by an additional 552 individuals considered at high risk for HIV-1 infection (Table 1, combined total of 11896). Urine and serum specimens from low- and high-risk populations, patients with non-HIV-1-related medical disorders, and known HIV-1-infected individuals, including AIDS patients, were tested. Subjects at high risk for HIV-1 infection included intravenous drug users (IDUs), hemophiliacs, and sexual partners of HIV-1-infected individuals and commercial sex workers (CSWs). Subjects with medical disorders and conditions are described above.

In a study in support of the Calypte Biomedical urine HIV-1 WB, clinical trial samples were tested with the Calypte Biomedical urine HIV-1 WB Kit regardless of EIA result. For this clinical study, 2159 urine specimens from various populations were tested. These included 109 urine specimens paired with serum HIV-1 WB ID specimens and 114 urine specimens falsely positive on the HIV-1-screening EIA. The urine and serum blots from non-HIV-1 infected subjects were compared.

In another study, urine and serum samples were obtained from low- and high-risk subjects after informed consent. The low-risk site measured EIA reactivity of >25,132 life insurance applicants and was unlinked. Specimens from high-risk individuals were collected at five geographic sites. Subjects (n = 859) belonged to the following risk categories: IDU; seronegative partners of HIV-1-positive individuals (partners); individuals with a sexually transmitted disease (STD); and individuals with multiple sex partners of unknown HIV-1 status (MSP). US Food and Drug Administration-licensed blood and urine HIV-1 EIA tests were used for screening. The HIV-1 urine test measures EIA reactivity using an IgG heavy chain and light chain conjugate. EIA RR specimens then were tested on Food and Drug Administration-licensed confirmation tests. Discordant urine EIA RR specimens from seronegative subjects that were urine WB negative or indeterminate were then tested in duplicate by a research-use-only IgA heavy chain-specific gp160 urine antibody assay.

BLAST ANALYSIS

A mosaic analysis (3) was applied to HIV-1vau envelope gene sequence, GenBank no. X80020. Using the Advance Blast program (http://www.ncbi.nhn.nih.gov/BLAST/), the following parameters were set: the Homo sapiens database was selected, nr (all non-redundant GenBank CDS translations + PDB + SwissProt + PIR + PRF) was selected, the expected threshold was set at 10 and the HIV-1vau env sequence was queried. Samples of >15 nucleotides (15mer) or higher with homologies >89% with HIV-1vau were tabulated.

STATISTICAL ANALYSIS

A 2 X 2 contingency analysis for determination of P values was performed by using Graphpad InStat (Graphpad Program Software).

Results

PERFORMANCE CHARACTERISTICS OF THE CALYPTE BIOMEDICAL TEST FOR HIV-I ANTIBODIES

A study in support of licensure for the Calypte HIV-1 Urine EIA compared the frequency of the occurrence of antibodies to HIV-1 in paired urine and serum specimens that were obtained from subjects at multiple geographic sites representative of US populations. EIA RR specimens were confirmed by WB assays for IgG antibodies. This survey extends that reported previously (5) but differs in that 552 high-risk individuals were added to the original cohort (Table 1, combined total of 11896). Data are recorded according to risk groups.

Results are summarized in Table 1. As reported previously (5), the sensitivity of the urine test was 98.73%. Ten serum samples matched to WB urine-positive subjects were serum EIA nonreactive. Therefore, the sensitivity of the serum tests was calculated at 99.15%. The combined use of urine and serum EIA tests detected a higher frequency HIV-1 antibody-positive subjects than either test alone.

The data in Table 1 bring out several interesting points: of the 11896 subjects tested, 29 (0.24%) were UPSN, a result consistent with the compartmentalization of the immune response to HIV-1 infection; the preponderance of UPSN reactivities were in the high-risk cohort; and 14 of 1111 (1.26%) of the known HIV-1-positive cohort subjects were either urine negative/indeterminate or urine negative/serum positive (UNSP). As noted below, we carried out a systematic study of the factors contributory to ID.

[FIGURE 1 OMITTED]

FREQUENCY OF EIA RR IN COHORTS ACCORDING TO SPECIMEN COLLECTION SITES

Collated data provided a valuable perspective (Table 1) of the frequency of antibodies to HIV-1. However, they did not provide insights of unique epidemiologic or public health interest. Table 2 summarizes the EIA RR survey data according to specimen collection site. Of the 25,132 subjects tested in the low-risk cohort, 253 (1.0%) were EIA RR for antibody in urine paired with seronegative specimens. EIA RR was the most frequent for subjects in site 6 of the high-risk groups. Specimens from this cohort were collected from patients in methadone clinics, many of whom presumably were IDUs.

[FIGURE 2 OMITTED]

FREQUENCY OF UPSN AND UNSP RR ACCORDING TO HIV-1 RISK CATEGORIES

These studies were carried out to determine the occurrence of WB-confirmed UPSN and UNSP reactivities according to category of risk activity. The results summarized in Fig. 1 show that the only subjects that had discordant reactivities (UPSN/UNSP) were in IDU or IDU/MSP cohorts. Only one discordant reactivity (UNSP) was found in the low-risk cohort.

IgA HIV-1 EIA RR ACCORDING TO RISK CATEGORIES

While we were conducting the EIA surveys summarized above, a group of subjects was detected whose urine was repeatedly reactive for HIV-1 IgA antibodies. The corresponding sera were nonreactive for HIV-1 antibodies in licensed tests. The repeatedly reactive EIA urine tests were not confirmable by urine WB. To clarify these results, we used a conjugate for the IgA heavy chain to further characterize urine IgA reactivity. Fig. 2 summarizes the results for the different risk groups. The frequency of IgA antibody in urine was most common in the seronegative partners of HIV-1-positive subjects (partners), and STD and MSP cohorts. These results were consistent with a compartmentalized immunologic response to such antigens in seronegative subjects. It would appear that the HIV-1 IgA envelope antibody can be detected in an EIA format but not by WB. Either the antibodies were expressed as the result of antecedent exposure to HIV-1 or the reactivities described may represent autoimmune responses elicited because of antigenic mimicries between self-antigens and HIV-1.

FREQUENCY OF BANDS IN WB OF ID SPECIMENS

A total of 1096 urine and 994 serum specimens with ID reactivity were analyzed by WB. This cohort represents a subgroup of the 2159 subjects tested in support of the urine WB clinical trials. Results for gag, pol, and env antigens were compared. Table 3 shows that bands were found in only 17 urine specimens (1.6%). The majority (11 of 17) occurred in the medical disorders and conditions cohort. The results for serum specimens stood in marked contrast. Bands were found in 336 of 994 specimens (33.8%). Bands to env antigens occurred in only 12 of 994 serum specimens (1.20%). Of these, 11 occurred in sera of the high-risk cohort. On the whole, these results suggest that band occurrence is a not random event; that it is much more common in serum than in urine; that it occurs most commonly to core antigens, particularly p24; and that there is reasonable evidence that specimens from patients with medical disorders and conditions are a major contributor to WB ID reactivities. The latter is consistent with the autoimmune reactivity of HIV-1 infected subjects to self-antigens that have homologies with HIV-1 antigens.

OCCURRENCE OF EIA RR IN SUBJECTS WITH NON-HIV-1 MEDICAL DISORDERS

This survey was performed to determine the frequency of EIA RRs not confirmable or ID by WB in urine and serum specimens obtained from 375 patients (Table 1) with medical disorders and conditions other than HIV-1 infection. Table 4 shows that 69 of 375 (18.4%) of urine tests were EIA RR. In the autoimmune and STD cohorts, urine EIA RR responses occurred at frequencies of 20.4% and 17.9%, respectively. In the corresponding serum assays, four (1.1%) were EIA RR. EIA RR responses were confined to the STD cohort. Of these four EIA RR responses, two were confirmable by WB. The other two were ID.

UPSN REACTIVITY IN A PATIENT POSITIVE FOR A GROUP 0 HIV-1 ISOLATE

A 41-year-old French woman originally clinically diagnosed in 1986 with leukoneutropenia associated with cervical carcinoma progressed to CD4 T-cell depletion with opportunistic infections and eventually died in 1992. Her serum WB reactivity was consistently ID (lack of env serum WB bands). The initial diagnosis presumed to be idiopathic CD4+ T-cell lymphocytopenia (ICL) became a diagnosis of AIDS upon isolation of a group O strain of HIV-1, referred to as HIV-1vau. Therefore, it was of interest to determine whether the urine and serum antibody tests described here were suitable for detecting HIV-1 antibodies. Urine EIA tests were performed using both recombinant gp160 antigen derived from an HIV-1 M strain (H9/HTLV-IIIB) and urine WBs using HIV-1 Group M viral lysate. The results presented in Table 5 show that both serum and urine specimens reacted with HIV-1 group M gag proteins (p24 and p55). The serum reacted with pol (p31 and p66), but the urine did not. On the other hand, urine reacted with gp160, but the serum did not. This result provides further evidence for the compartmentalized immune response to HIV-1 infection.

GENETIC ANALYSIS of HIV-1vau env SEQUENCE

Studies of genetic abnormalities in veterans with Persian Gulf War syndrome (3) led to analogous investigation of the patient described above who had no known risk factors for HIV-1 infection. Our central interest based on reactivity of urine to HIV-1 gp160 was in the HIV-1vau env nucleotide sequence. Basically, a mosaic analysis involved the determination of signature segment homologies to known human chromosomal sequences. Mosaic analysis of the HIV-1vau env sequence was carried out using the Advance Blast program described in Materials and Methods. Table 6 shows that signature segments of HIV-1vau env had homologies with 14 different human chromosomes. Segments from chromosome 7 predominated. Of these, six segments had homologies with 7831. This is of interest because 7831 is a fragile chromosomal site involved in mutations and recombinations. Mutations in 7831 have been implicated in several human malignancies (6-9). In addition, a 37mer segment of African green monkey simian immunodeficiency virus (SIVagm) env was found.

Discussion

It is recognized that there is an initial window of HIV-1 seronegativity immediately after HIV-1 infection. However, conventional wisdom rejects the concept that subjects can be persistently infected with HIV-1 yet remain nonreactive in the licensed serum EIA assays for HIV-1 antibodies. Based on the recent report by Sullivan et al. (10), this perspective requires modification. These investigators (10) documented that subjects that were reverse transcription-PCR-positive for HIV-1 were persistently seronegative for HIV-1 antibody. Moreover, two of the eight subjects studied by Sullivan et al. served as blood donors. Therefore, UPSN reactivities as reported here are important in assessing the occurrence of exposure to HIV-1.

The occurrence of UPSN reactivity in urine tests for antibodies to HIV-1 (5) required further analysis of the EIA assay used to screen specimens. A recombinant gp160 antigen was used because it had superior performance characteristics. In our initial survey (5), parallel urine and serum tests were performed on 11344 subjects. EIA reactivities that were repeatedly positive were confirmed by urine WB. The serum test detected 99.15% of all antibody-positive individuals. The urine test detected 98.73% of the same cohort. Twenty-five assays had discordant results. Of these, 10 were urine positive but serum nonreactive or indeterminate (UPSN). Fifteen were urine negative or indeterminate but serum positive (UNSP). Table 1 summarizes the results of a more extended study in which 11 896 paired urine and serum specimens were tested. Of these, 0.24% were UPSN and 0.17% were UNSP. As pointed out previously (5), the combined use of urine and serum tests detected a greater number of antibody-positive subjects than either test alone. Any decision to use both tests simultaneously rests on the circumstances under which they are to be used, a clinical or public health judgment. Whether dual testing should be performed for blood banking remains an open question. Nonetheless, it is noteworthy that urine tests for antibody (Table 5) were effective in detecting antibodies to the HIV-1vau group O strain.

The occurrence of ID results in WB tests for antibody confounds the interpretation of results. Accordingly, we carried out studies to determine which HIV-1 core, pol, or env antigens were involved. Urine (1096) and serum (994) specimens obtained from subjects of different risks for HIV-1 infection were tested for the frequency of WB bands. Twelve of 994 serum specimens (1.2%) had bands to env antigens. Of these, 11 were from high-risk subjects. These results show that ID reactivities for the most part were not attributable to HIV-1 env antigens. The results with core antigens stood in marked contrast. When sera were tested, 336 of 994 subjects (33.8%) had bands. Only 17 subjects (1.6%) had bands when 1096 urine specimens were tested. Thus, when band number is used as a parameter of ID reactivity, urine specimens had a minimal response. When they occurred, they were found primarily in the medical disorder and conditions group. It is of interest that the frequency of bands in sera from the same cohort (73 of 199; 36.7%) and from the high-risk group (123 of 371; 33.2%) were not different. In serum tests, ID reactivity could frequently be attributed to p24. A reasonable explanation of the described findings is that in many cases ID results are caused by autoimmune reactivity to self-antigens (11,12). This notion is supported by the finding that many subjects in the medical disorders and conditions group with chronic autoimmune diseases often gave ID reactivity in WB tests. Considered together, Tables 1 and 3 suggest that urine assays for antibodies to HIV-1 are sensitive and accurate. Bands to env antigens in urine WB confirmatory tests appear to be a more reliable indicator of exposure to HIV-1 antigens than core antigens.

There appear to be at least three indicators of immunologic exposure to HIV-1 antigens in high-risk subjects who, nonetheless, remain seronegative: UPSN reactivity that we report here, cell-mediated immune (CMI) reactivity to HIV-1 antigens in subjects at high risk for HIV-1 infection, and antibodies in mucosal lavages of seronegative subjects. CMI reactivity to HIV-1 antigens in seronegative subjects is well documented. Clerici and co-workers (13-15) reported HIV-1-specific T-cell reactivity to env antigens in seronegative healthcare workers exposed to HIV-1 contaminated blood. Pinto et al. (16) reported env-specific (gp160) cytotoxic T-cell reactivity in seronegative subjects who had been exposed to accidental needle sticks contaminated with HIV-1-positive blood. In their publication, Pinto et al. (16) cited 10 publications reporting CMI responses to HIV-1 antigens in high-risk seronegative subjects. Mazzoli et al. (17) reported the occurrence of serum CMI reactivity, and IgA (reactivity to an HIV-1 gp160) in urine and vaginal wash specimens obtained from seronegative sexual partners who were HIV-1 positive.

The report by Rowland-Jones et al. (18) deals with a different type of cohort. Six seronegative CSWs in Gambia, West Africa, who were at high risk for HIV-1 infection, demonstrated specific cytotoxic T-cell reactivity to HIV-1 antigens. The nef, pol, p24, and p17 peptides were used for cytotoxicity tests. The strongest responses were to pol and nef. Kaul et al. (19) studied three cohorts of Kenyan women of different risks for HIV-1 infection: 21 HIV-1-resistant CSWs, 19 HIV-1-infected CSWs, and 28 low-risk women. Resistance was defined as persistent seronegative reactivity to HIV-1 antigens and negative reverse transcription-PCR assays for HIV-1 sequences over 3 or more years of commercial sex work. Cervicovaginal lavage specimens from all subjects were tested for HIV-1-specific IgA and IgG. T-helper lymphocyte responses (CMI) to HIV-1 antigens also was determined. HIV-1-specific IgA was present in cervicovaginal lavages of 16 of 21 (76%) of HIV-1-resistant CSWs, in 5 of 19 (26%) HIV-1-infected women, and in 3 of 28 (11%) low-risk women. CMI reactivity was present in 11 of 25 (55%) of HIV-1-resistant women, in 4 of 18 HIV-1-infected women, and in 1 of 25 (4%) low-risk women. The authors suggest a protective mucosal immune response to HIV-1 infection that can be independent of CMI responsiveness.

Considered together, the described findings document an important role of mucosal immunity (compartmentalization) mediated by IgA in resistance to HIV-1 infection. We found, as shown in Fig. 2, that subjects of all high-risk groups had higher frequencies of HIV-1 IgA EIA reactivity than the low-risk cohort. Because such HIV-1 IgA EIA RRs were not confirmable by WB, it appears that WB tests for HIV-1 IgA were ineffective or that the EIA RR occurred because of autoreactivity (20-23) to self-antigens elicited by HIV-1 or other environmentally acquired agents. Such results suggest that inappropriate immunizations with HIV-1 antigens may provoke deleterious results.

The occurrence of antibodies, particularly IgA, in mucosal tissues is a well-recognized barrier to bacterial or viral infections (24,25). Two recent publications (26,27) presented in detail a histologic description of the local mucosal immune response in the reproductive tissues of both sexes. The mucosal barrier to HIV-1 infection has been discussed (28). Here we direct attention to interesting experiments in nature (29) in which subjects repeatedly exposed to infection by HIV-1 remain seronegative. Four representative reports are discussed. Beyrer et al. (30) studied a cohort of Thai prostitutes designated as HIV-1 "highly exposed but persistently seronegative". In this cohort, sera were persistently negative for IgG and IgA. However, cervicovaginal lavages from 6 of 16 subjects were HIV-1 IgA EIA RR. In seropositive controls, 11 of 11 and 8 of 11 vaginal lavages were positive for IgG and IgA antibodies, respectively. These results showed that high-risk seronegative subjects had IgA in their genital mucosa, that it likely was produced locally, and that it probably served as a barrier to systemic HIV-1 infection. In a similar investigation, Belec et al. (31) studied 150 paired serum and vaginal secretions obtained from HIV-1 seronegative women who resided in West Africa. Antibody (IgG) was detected in 2.5% of the vaginal secretions. Antibodies in such specimens were broadly reactive with HIV-1 core and env antigens. The authors made two interesting comments: in the subjects studied, the immune response to HIV-1 appeared to be restricted to the vaginal mucosa; and the cervicovaginal mucosa is an immunocompetent tissue possessing antigen-processing cells and lymphocytes. We discussed above (17,19) the occurrence of mucosal IgA in highly exposed but persistently seronegative subjects. Considered together, the results of the studies discussed above suggest that in a small number of subjects, exposure to HIV-1 infection can lead to resistance to infection, that in these subjects, it does not depend on serum antibody, that there is a compartmentalized barrier to infection, and that in the described women, the barrier to infection was the cervicovaginal mucosa.

Based on the findings we report here and on the literature summarized above, we propose that antibody found in UPSN subjects is of local origin, i.e., is derived compartmentally. Functionally, a substantial portion of it may be IgA. Studies of locally produced IgA are important because IgA neutralizes viruses extra- and intracellularly (32,33). IgA also has an important excretory function, i.e., IgA may bind HIV-1 antigens within the mucosal lamina propria and then excrete it through the epithelium into the lumen (34). However, these dynamics do not explain the seronegative responses to HIV-1 that we and others have found. There must be a powerful active mechanism that suppresses the serum antibody response. Shearer and Clerici (29,35) propose a Th1-Th2 switch mediated by cytokine cross-regulation.

HIV-1 is an insidious virus that infects humans: It replicates in a wide variety of tissues, i.e., is pantropic; it permanently integrates its gene sequences into the host cell genome; it has an extraordinarily high mutation/ recombination rate; multiple subtypes are known (see below) to infect a subject at the same time in a single transmitting event; HIV-1 subtypes not only recombine with each other but may also recombine with human endogenous retroelements (11) or human chromosome segments (3,36); HIV-1 infection may activate human endogenous retroelements with or without recombination; and because of compartmentalization, the population dynamics of HIV-1 subtypes differ in different tissue compartments (see below). This latter phenomenon was documented recently by Kiessling et al. (37).

Katz and Skalka (38) recently reviewed the recombination genetics of retroviruses. Here we focus on the population dynamics of HIV-1 subtypes and restrict consideration to representative publications that bring out valuable principles. Broadly speaking, three types of virus dynamics can be considered: monotypic, in which a single subtype causes infection; multitypic, in which more than one subtype causes infection; and infections by "mosaics" that are recombinants between or among single subtypes. All of these dynamics are known to occur in humans and in the individual tissue compartments. Moreover, mosaic subtypes generated in a given tissue compartment are known (see below) to differ from those in a different tissue compartment in the same host.

The report by Robertson et al. (39) provides a perspective of the global distribution of M and O HIV-1 subtypes and the relative frequency of recombinants. One hundred fourteen HIV-1 stains were compared by analyzing gag and env sequences. Phylogenetic trees then were constructed. Of the 114 strains, 10 appeared to be recombinants among just the M subtypes. Recombinants between M and O subtypes also were found. All of the recombinants were from geographic areas where multiple subtypes were known to circulate. The authors note that a proportion of subjects were co-infected with strains of different subtypes. This can occur singly or sequentially. The authors discuss the importance of the global frequency of such recombinants, their biological significance, their putative impact on vaccine design, and anti-HIV-1 drug effectiveness. Ramos et al. (40) carried out molecular epidemiologic studies of HIV-1 strains in Rio de Janeiro. Seventy-nine subjects were screened at the molecular level over a period of 1 year. Heteroduplex analysis, restriction fragment length polymorphism analysis, and gene sequencing were used to distinguish between cotransmission and superinfection. Their results showed that 88-89% of isolates were monotypic, 7.6% were recombinants, and 3.8% were dual infections. Recombination between gag and pol sequences was more common than between env and pol sequences. The authors direct attention to the heterogeneous nature of the strains active in the epidemic. The generation of new subtypes with altered infectivity is confounded by the higher concentrations of chemokine receptors per cell in the mucosal tissue compared with the blood lymphocyte counterparts (41).

Fisher et al. (42) analyzed molecular variants within a single HIV-1 isolate. In brief, proviral clones were derived from tissues of a single HIV-1-infected patient, and their biological properties were compared. The authors report that hybrid genomes (env sequences) generated viruses that differed in their ability to replicate in various human cell lines in vitro. The authors suggest that variation exists in vivo among HIV-1 viruses endogenous to host tissues. When such viruses are propagated serially in vitro, heterogeneity is diminished, probably through a process of selection. The authors point out the importance of clarifying how well in vitro-adapted HIV-1 strains reflect their in vivo counterparts.

One hallmark of HIV-1 infection is the diversity of strains found in different tissue compartments in the same individual. Kiessling et al. (37) compared cloned sequences of virus populations derived from semen and peripheral blood mononuclear cells (PBMCs). Protease gene sequence analysis revealed differences in the virus populations derived from different tissue compartments. Further evidence for the diversification of HIV-1 populations in tissue compartments resulted from studies of HIV-1 strains derived from the blood and genital compartments. Poss et al. (43) analyzed proviral env gene sequences (V1, V2, and V3) in infected cells obtained from cervical secretions and PBMCs. Specimens were obtained from six women who had just seroconverted. Three patterns of diversity were found: homogeneity between cervical and PBMC-derived strains, variants of cervical and PBMC origin had modest heterogeneity within each genotype, and multiple variants occurred within each compartment. Zhu et al. (44) carried out a similar study by comparing HIV-1 gp160 sequences in longitudinal specimens obtained from five "acute seroconverters" and their corresponding sexual partners (transmitters). These investigators reported that the quantitative homoduplex tracking assay used, combined with selective sequencing, was superior in detecting genetic diversity of HIV-1 strains than conventional PCR techniques; that virus populations of transmitters were compartmentalized, i.e., HIV-1 variants in genital populations were different from those derived from PBMCs or the blood plasma; that the virus populations of both transmitters and recipients were diverse; that there was a strong selective pressure by recipients on variants in the transmitted virus population; that up to the time of seroconversion by recipients, the variants that propagated were relatively homogeneous genetically; and that the selection made by the recipient on the donor virus populations was for a minor subpopulation.

Epstein et al. (45) reported on the tissue-specific evolution (brain and spleen) of HIV-1 variants in children with AIDS. The authors used the term "quasispecies" to describe HIV-1 variants. In brief, V3 domain sequences were analyzed in variants that were derived from the brain and spleen. The authors found that brain and spleen HIV-1 populations differed from each other (tissue compartmentalization and selection) and that each population evolved independently. The authors discuss "immune pressure" and "escape mutants" in the selection of variants in the two tissue compartments. In studies of Thai subjects, Artenstein et al. (46) reported "the first evidence of dual HIV-1 infection of humans by subtypes B and E".

From this brief review, it is clear that genetic diversity and tissue compartmentalization is a hallmark of HIV-1 infection. The dynamics of the pathogenesis of AIDS, the effects of antiviral drugs, the epidemiology of HIV-1 infections, and vaccine design and administration all are impacted by the described genetic diversity and tissue compartmentalization.

The report by Charneau et al. (47) raises the important question of whether the occurrence of CD4+ T-cell lymphocytopenia before the onset of an aberrant AIDS syndrome is causally related to HIV-1 infection. The parallel question is whether HIV-1 infection serves as an accelerant to CD4+ T-cell lymphocytopenia that leads to a terminal illness. In their study, the patient at the time of death had no CD4 T cells; therefore, it is reasonable to assume that the cervical carcinoma in the same patient was not a confounding medical condition with regard to these questions. We previously suggested (48) that a study of ICL patients provides an important approach to understanding the underlying host molecular mechanisms in the pathogenesis of AIDS. Although HIV-1 is considered the sole and primary cause of AIDS, it is apparent that HIV-1 infection may accelerate underlying disease processes. This hypothesis has implications for both antiretroviral therapies and HIV-1 vaccine program development.

Our mosaic studies of the HIV-1vau env sequence suggest additional mechanisms by which HIV-1 infection may have pathologic consequences. For example, the subject studied by Charneau et al. (47) was an agricultural worker exposed to farm-related toxic materials. In this study, we describe homologies between HIV-1vau env sequences and chromosomal segments in which 7831 is prominently involved. The possibility that there is interaction between precursor sequences of HIV-1vau, 7831 sequences, and farm-related toxic materials is suggested by our recent studies of Persian Gulf War veterans (3). In our earlier study, we found genetic abnormalities that possibly arose from exposure to environmental toxins.

The homologies between HIV-1vau env sequences and segments of 7831 suggest the possibility that sequences of the latter may have been implicated in the genetic evolution of HIV-1vau. As described in our recent report on the pathogenesis of Persian Gulf War syndrome (3), environmental biohazardous materials may have participated in such evolutionary events, i.e., there is an interaction at the molecular level between antecedents to HIV-1vau sequences, environmental toxins, and fragile sites in 7831. The activation, induction, and recombination of endogenous retroelements is a well-recognized phenomenon. The mosaic analysis also disclosed a occurrence of SIVagm homology with the HIV-1vau env nucleotide sequence. Possibly, such sequences were of poliovirus vaccine origin and may have been involved in recombinational events during the evolution of the HIV-1vau genome. (49). On the other hand, the complex viral isolation techniques involved in the isolation of HIV-1vau adds to the uncertainty of its biological and molecular origins.

The considerations outlined above provide a framework for future studies that developed from the EIA surveys summarized here and provide new insights into the pathogenesis of HIV-1 infection and AIDS.

We thank of Miger Ornopia and Atefeh Farvard for excellent technical assistance. We also thank the contributors to the clinical studies: Melissa Kanar, Toni Guipre, Mario Clerici, Luc Montagnier, Emily Carrow, Alberto Beretta, Lawrence Attia, Jack DeHovitz, Robert Stout, Joseph Masci, David Rubin, Jay Levy, Susan Stranford, and Roy Stevens.

References

(1.) Barre-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, et al. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 1983;220:868-71.

(2.) Cao Y, Friedman-Kien AE, Chuba JV, Mirabile M, Hosein B. IgG antibodies to HIV-1 in urine of HIV-1 seropositive individuals. Lancet 1988;1:831-2.

(3.) Urnovitz HB, Tuite JJ, Higashida JM, Murphy WH. RNAs in the sera of Persian Gulf War veterans have segments homologous to chromosome 22811.2. Clin Diagn Lab Immunol 1999;6:330-5.

(4.) Hausler WJ Jr. Report of the Third Consensus Conference on HIV testing sponsored by the Association of State and Territorial Public Health Laboratory Directors. Infect Control Hosp Epidemiol 1988; 9:345-9.

(5.) Urnovitz HB, Sturge JC, Gottfried TD. Increased sensitivity of HIV-1 antibody detection. Nat Med 1997;3:1258.

(6.) Hurlstone AF, Reid G, Reeves JR, Fraser J, Strathdee G, Rahilly M, et al. Analysis of the CAVEOLIN-1 gene at human chromosome 7831.1 in primary tumours and tumour-derived cell lines. Oncogene 1999;18:1881-90.

(7.) Huang H, Qian J, Proffit J, Wilber K, Jenkins R, Smith DI. FRA7G extends over a broad region: coincidence of human endogenous retroviral sequences (HERV-H) and small polydispersed circular DNAs (spcDNA) and fragile sites. Oncogene 1998;16:2311-9.

(8.) Latil A, Cussenot 0, Fournier G, Baron JC, Lidereau R. Loss of heterozygosity at 7831 is a frequent and early event in prostate cancer. Clin Cancer Res 1995;1:1385-9.

(9.) Koike M, Tasaka T, Spira S, Tsuruoka N, Koeffler HP. Allelotyping of acute myelogenous leukemia: loss of heterozygosity at 7831.1 (D7S486) and q33-34 (D7S498, D7S505). Leuk Res 1999;23: 307-10.

(10.) Sullivan PS, Schable C, Koch W, Do AN, Spira T, Lansky A, et al. Persistently negative HIV-1 antibody enzyme immunoassay screening results for patients with HIV-1 infection and AIDS: serologic, clinical, and virologic results. AIDS 1999;13:89-96.

(11.) Urnovitz HB, Murphy WH. Human endogenous retroviruses: nature, occurrence, and clinical implications in human disease. Clin Microbiol Rev 1996;9:72-99.

(12.) Via CS, Morse HC, Shearer GM. Altered immunoregulation and autoimmune aspects of HIV infection: relevant murine models. Immunol Today 1990;11:250-5.

(13.) Clerici M, Levin JM, Kessler HA, Harris A, Berzofsky JA, Landay AL, et al. HIV-specific T-helper activity in seronegative health care workers exposed to contaminated blood. JAMA 1994;271:42-6.

(14.) Clerici M, Giorgi JV, Chou CC, Gudeman VK, Zack JA, Gupta P, et al. Cell-mediated immune response to human immunodeficiency virus (HIV) type 1 in seronegative homosexual men with recent sexual exposure to HIV-1. J Infect Dis 1992;165:1012-9.

(15.) Clerici M, Berzofsky JA, Shearer GM, Tacket CO. Exposure to human immunodeficiency virus (HIV) type I indicated by HIV-specific T helper cell responses before detection of infection by polymerase chain reaction and serum antibodies. J Infect Dis 1991;164:178-82.

(16.) Pinto LA, Sullivan J, Berzofsky JA, Clerici M, Kessler HA, Landay AL, et al. ENV-specific cytotoxic T lymphocyte responses in HIV seronegative health care workers occupationally exposed to HIV-contaminated body fluids. J Clin Investig 1995;96:867-76.

(17.) Mazzoli S, Trabattoni D, Lo Caputo S, Piconi S, Ble C, Meacci F, et al. HIV-specific mucosal and cellular immunity in HIV-seronegative partners of HIV-seropositive individuals. Nat Med 1997;3:1250-7.

(18.) Rowland-Jones S, Sutton J, Ariyoshi K, Dong T, Gotch F, McAdam S, et al. HIV-specific cytotoxic T-cells in HIV-exposed but uninfected Gambian women. Nat Med 1995;1:59-64.

(19.) Kaul R, Trabattoni D, Bwayo JJ, Arienti D, Zagliani A, Mwangi FM, et al. HIV-1-specific mucosal IgA in a cohort of HIV-1-resistant Kenyan sex workers. AIDS 1999;13:23-9.

(20.) Garry RF. Extensive antigenic mimicry by retrovirus capsid proteins. AIDS Res Hum Retroviruses 1990;6:1361-2.

(21.) Kulberg AJ. Structural homology between HIV-1 tat protein and various human proteins. AIDS Res Hum Retroviruses 1990;6: 1059-60.

(22.) Bisset LR. Molecular mimicry in the pathogenesis of AIDS: the HIV/MHC/mycoplasma triangle. Med Hypotheses 1994;43: 388-96.

(23.) Shearer GM, Bernstein DC, Tung KSK, Via CS, Redfield R, Salahuddin SZ, et al. A model for the selective loss of major histocompatibility complex self-restricted T cell immune responses during the development of acquired immune deficiency syndrome (AIDS). J Immunol 1986;137:2514-21.

(24.) Underdown BJ, Schiff JM. Immunoglobulin A: strategic defense initiative at the mucosal surface. Annu Rev Immunol 1986;4: 389-417.

(25.) Hanson LA, Ahlstedt S, Andersson B, Carlsson B, Cole MF, Cruz JR, et al. Mucosal immunity. Ann N Y Acad Sci 1983;409:1-21.

(26.) Pudney J, Anderson DJ. Immunobiology of the human penile urethra. Am J Pathol 1995;147:155-65.

(27.) Brandtzaeg P. Mucosal immunity in the female genital tract. J Reprod Immunol 1997;36:23-50.

(28.) Miller CJ, McGhee JR, Gardner MB. Mucosal immunity, HIV transmission, and AIDS. Lab Investig 1993;68:129-45.

(29.) Shearer GM, Clerici M. Protective immunity against HIV infection: has nature done the experiment for us? Immunol Today 1996;17: 21-4.

(30.) Beyrer C, Artenstein AW, Rugpao S, Stephens H, Van Cott TC, Robb ML, et al. Epidemiologic and biologic characterization of a cohort of human immunodeficiency virus type 1 highly exposed, persistently seronegative female sex workers in northern Thailand. J Infect Dis 1999;179:59-67.

(31.) Belec L, Tevi-Benissan C, Gresenguet G, Meillet D, Pillot J. HIV-1 antibody serum negativity with vaginal secretions positivity. Lancet 1994;343:1046-7.

(32.) Bomsel M, Heyman M, Hocini H, Lagaye S, Belec L, Dupont C, et al. Intracellular neutralization of HIV transcytosis across tight epithelial barriers by anti-HIV envelope protein dIgA or IgM. Immunity 1998;9:277-87.

(33.) Mazanec MB, Kaetzel CS, Lamm ME, Fletcher D, Nedrud JG. Intracellular neutralization of virus by immunoglobulin A antibodies. Proc Natl Acad Sci U S A 1992;89:6901-5.

(34.) Mazanec MB, Nedrud JG, Kaetzel CS, Lamm ME. A three-tiered view of the role of IgA in mucosal defense. Immunol Today 1993;14:430-5.

(35.) Clerici M, Shearer GM. The Th1-Th2 hypothesis of HIV infection: new insights. Immunol Today 1994;15:575-81.

(36.) Koga Y, Lindstrom E, Fenyo EM, Wigzell H, Mak TW. High levels of heterodisperse RNAs accumulate in T cells infected with human immunodeficiency virus and in normal thymocytes. Proc Natl Acad Sci U S A 1988;85:4521-5.

(37.) Kiessling AA, Fitzgerald LM, Zhang D, Chhay H, Brettler D, Eyre RC, et al. Human immunodeficiency virus in semen arises from a genetically distinct virus reservoir. AIDS Res Hum Retroviruses 1998;14(Suppl 1):S33-41.

(38.) Katz RA, Skalka AM. Generation of diversity in retroviruses. Annu Rev Genet 1990;24:409-45.

(39.) Robertson DL, Sharp PM, McCutchan FE, Hahn BH. Recombination in HIV-1. Nature 1995;374:124-6.

(40.) Ramos A, Tanuri A, Schechter M, Rayfield MA, Hu DJ, Cabral MC, et al. Dual and recombinant infections: an integral part of the HIV-1 epidemic in Brazil. Emerg Infect Dis 1999;5:65-74.

(41.) Patterson BK, Landay A, Andersson J, Brown C, Behbahani H, Jiyamapa D, et al. Repertoire of chemokine receptor expression in the female genital tract: implications for human immunodeficiency virus transmission. Am J Pathol 1998;153:481-90.

(42.) Fisher AG, Ensoli B, Looney D, Rose A, Gallo RC, Saag MS, et al. Biologically diverse molecular variants within a single HIV-1 isolate. Nature 1988;334:444-7.

(43.) Poss M, Martin HL, Kreiss JK, Granville L, Chohan B, Nyange P, et al. Diversity in virus populations from genital secretions and peripheral blood from women recently infected with human immunodeficiency virus type 1. J Virol 1995;69:8118-22.

(44.) Zhu T, Wang N, Carr A, Nam DS, Moor-Jankowski R, Cooper DA, et al. Genetic characterization of human immunodeficiency virus type 1 in blood and genital secretions: evidence for viral compartmentalization and selection during sexual transmission. J Virol 1996; 70:3098-107.

(45.) Epstein LG, Kuiken C, Blumberg BM, Hartman S, Sharer LR, Clement M, et al. HIV-1 V3 domain variation in brain and spleen of children with AIDS: tissue-specific evolution within host-determined quasispecies. Virology 1991;180:583-90.

(46.) Artenstein AW, Van Cott TC, Mascola JR, Carr JK, Hegerich PA, Gaywee J, et al. Dual infection with human immunodeficiency virus type 1 of distinct envelope subtypes in humans. J Infect Dis 1995;171:805-10.

(47.) Charneau P, Borman AM, Quillent C, Guetard D, Chamaret S, Cohen J, et al. Isolation and envelope sequence of a highly divergent HIV-1 isolate: definition of a new HIV-1 group. Virology 1994;205:247-53.

(48.) Urnovitz HB, Stevens RW. AIDS research priorities. Science 1995; 267:1249-50.

(49.) Urnovitz HB, Murphy WH. Human endogenous retroviruses. Clin Microbiol Rev 1996;9:585.

Howard B. Urnovitz, [1] * Jerrilyn C. Sturge, [1] Toby D. Gottfried, [1] and William H. Murphy [2]

[1] Calypte Biomedical, Berkeley, CA 94710.

[2] Department of Microbiology and Immunology, The University of Michigan School of Medicine, Ann Arbor, MI 48109-0620.

[3] Nonstandard abbreviations: FIA, enzyme immunoassay; WB, Western blot; RR, repeatedly reactive; UNSP, urine negative/serum positive; UPSN, urine positive/serum negative; ID, indeterminate; p, protein; gp, glycoprotein; STD, sexually transmitted disease; IDU, intravenous drug user; CSW, commercial sex worker; MSP, multiple sexual partners; SIVagm; African green monkey simian immunodeficiency virus; ICL, idiopathic CD4+ T-cell lymphocytopenia; CMI, cell-mediated immune; and PBMC, peripheral blood mononuclear cell.

* Address correspondence to this author at: Calypte Biomedical, 1440 Fourth St., Berkeley, CA 94710. Fax 510-526-5381; e-mail hervdoc@aol.com.

Received May 17, 1999; accepted June 28, 1999.
Table 1. Performance characteristics of the Calypte urine HIV-1 EIA/WB
tests compared with serum HIV-1 antibody tests. (a)

Cohort No. tested UPSP (b) UNSN UPSN UNSP

Low risk 7082 7 7074 1 0
Known HIV-1 1111 1097 0 0 14
positive
High risk (c) 1329 180 1121 22 (d) 6
Unknown risk 1999 22 1975 2 0
Medical 375 2 369 4 0
disorders (e)

Total 11 896 1308 10 539 29 20
Frequency, % 0.24 0.17

(a) Only EIA RRs were further tested by WB.

(b) UPSP, urine positive, seropositive; UNSN, urine negative or
indeterminate, seronegative or indeterminate.

(c) Principally persons that had sexual relations with HIV-1-positive
subjects (partners), multiple (MSP) or same-sex partners, or IDUs.

(d) One UPSN had 46 600 copies/mL HIV-1 reverse transcription-PCR and
was RR for p24 antigen.

(e) Medical disorders and conditions included subjects who had chronic
disorders that required medical treatment or hospitalization,
autoimmune disorders, malignancies, STDs, urologic disorders,
multiparous or pregnant women, exertion/dehydration, and multiple
blood transfusions.

Table 2. Frequency of urine HIV-1 antibody RR according to specimen
collection site.

 Risk No. SNR (c) SRR URR/SRR URR/SNR (%)
Site (a) group (b) tested

1 Low 25 132 25 125 7 6 253 (1.0)
2 High 92 90 2 2 10 (11.1)
3 High 104 93 11 11 8 (8.6)
4 High 73 73 0 0 7 (9.6)
5 High 149 149 0 0 13 (8.7)
6 High 441 421 20 15 55 (13.1)

Total 25 991 25 951 40 34 346 (1.3)
 (d)

(a) Site 1, life insurance reference laboratory; sites 2-5, New York
City hospitals and clinics; site 6, methadone clinics.

(b) Risk groups are described in Table 1.

(c) SNR, serum EIA nonreactive; SRR, serum EIA RR; URR, urine EIA RR.

(d) Three hundred forty URR/SNR were either urine WB negative or ID;
six were urine WB positive.

Table 3. Frequency of bands to HIV-1 antigens in W13-indeterminate
specimens.

 Frequency

Cohort No. tested No. with p17 p24 p31
 bands (a)

HIV-1 low risk
 Serum 315 31 (9.8)% 2 23 1
 Urine 315 0 (0.0)% 0 0 0
HIV-1 high risk
 Serum 371 (b) 123 (33.2)% 28 74 1
 Urine 391 2 (0.5)% 0 1 0
Medical disorders
and conditions
 Serum 199 (d) 73 (36.7)% 13 34 3
 Urine 281 11 (3.9)% 2 5 0
Special studies
(f)
 Serum 109 109 (100)% 17 60 1
 Urine 109 4 (3.7)% 0 2 0
Total
 Serum 994 336 (33.8)%
 Urine 1096 17 (1.6)%

 Frequency

Cohort gp41 p51 p55 p66 gp120 gp160

HIV-1 low risk
 Serum 0 5 0 4 0 0
 Urine 0 0 0 0 0 0
HIV-1 high risk
 Serum 5 17 4 14 3 3 (c)
 Urine 0 0 0 0 0 0
Medical disorders
and conditions
 Serum 0 16 5 10 0 1 (e)
 Urine 0 3 1 4 0 0
Special studies
(f)
 Serum 0 18 2 12 0 0
 Urine 0 0 0 1 1 0
Total
 Serum
 Urine

(a) Bands include viral and non-viral. Values in parentheses are
percentages.

(b) Twenty serum specimens were not tested by WB.

(c) The three serum specimens were of insufficient band pattern
and intensity to meet the criteria for positivity.

(d) Eighty-two of the 281 serum specimens were not tested by WB.

(e) One serum specimen had a single +/- gp160 band.

(f) Urine specimens paired with serum WB indeterminates.

Table 4. Urine EIA RR in subjects with non-HIV-1 medical disorders
and conditions.

 EIA reactivity

 Urine Serum

Medical disorders and No. IR RR NR IR
conditions tested (b)

Autoimmune diseases 49 16 10 39 1
Malignancies 53 13 9 44 0
STD 207 50 37 170 19
Urologic disorders (e) 24 10 10 14 0
Multiparous 10 0 0 10 0
Pregnant 15 2 1 14 0
Exertion/dehydration 8 0 0 8 0
Multiple transfusions 9 3 2 7 0

Total 375 94 69 306 20
Frequency, % 25.1 18.4 81.6 5.3

 EIA reactivity

 Serum WB reactivity serum (a)

Medical disorders and RR NR Pos Neg Ind
conditions

Autoimmune diseases 0 49 0 0 0
Malignancies 0 53 0 0 0
STD 4 203 2 (c) 0 2 (d)
Urologic disorders (e) 0 24 0 0 0
Multiparous 0 10 0 0 0
Pregnant 0 15 0 0 0
Exertion/dehydration 0 8 0 0 0
Multiple transfusions 0 9 0 0 0

Total 4 371 2 0 2
Frequency, % 1.10 98.9

(a) Only serum EIA RR specimens were tested by WB.

(b) IR, initially reactive; NR, non-repeatedly reactive;
Pos, positive; Neg, negative; Ind, indeterminate.

(c) The matched urine specimens were EIA RR.

(d) One matched urine specimen was EIA RR, one was EIA
non-repeatedly reactive.

(e) Includes proteinuria, bacteriuria, hematuria, and glucosuria.

Table 5. HIV-1vau group 0 antibody reactivity to HIV-1 group M
antigens.

 WB pattern (a)

Specimen Collection date EIA gag pol env

Serum November 1990 RR p24, p55 p31, p66 NR (b)
 December 1990 RR p24, p55 p31, p66 NR
 February 1991 RR p24, p55 p31, p66 NR
 February 1992 RR p24, p55 p31, p66 NR
Urine February 1992 RR (c) p24, p55 NR gp160

(a) Pasteur Diagnostics WB using HIV-1 group M viral lysate.

(b) NR, nonreactive.

(c) Calypte Biomedical EIA using gp160 recombinant HIV-1 group M
antigen.

Table 6. HIV-lvau group 0 env nucleotide sequence homology with
human chromosome sequences. (a)

Chromosome Chromosome Accession Nucleotide segment with >89%
 region no. homology with VAU

X Xp22 A0005297 agctgtaaccaactatatgcc
 Xp11.3-11.4 AL023875 tgaatatgagctaaaaaatgtgaca
 Xg25-26.3 AL022162 ccccagtccaaatgaata
 Xg25-g27.1 HS119E23 aattggcttgacataact
2 2g31 HSTITINN2 agaagaatatgaccaata
4 4g25 A0004049 aaactcaaacaatacaaaag
 4g25 A0004065 aaaacataactgaaagatattta
 4p16.3 HS361H4C gtaaatataatcaaactgat
 4g21 A0004061 tataaaaatagctataat
5p 5p15.2 A0002123 cctaataaccctaaatacta
 5q A0004634 agggttcttgcatctgttgta
 5q A00051781 tgtggatttaccacctcttga
6 6 AF055066 gtggggctgcaagaata
 6p21.3 HS172K2 cagcataatatttgggca
 6p21.2-21.31 HS391022 acactattgtgccagc
 6g21 HS142L7 ttagaaacctttatacaga
 6g24 HS28C20 acctcaggacaataatcttg
7 7p21-p22 A0005248 attctaagtgcagcaggaagc
 7g21-g31.1 A0004774 acattgttcgtgctt
 7g31.3 A0002533 aaattcaatatatggaaaaatt
 7g21-7g22 A0000056 agaggtgaaacagtgtgactt
 7g31.2 A0004416 aagacaaacaggagaaaa
 7p13-p14 A0005483 tgaattgtacagatatcaaaa
 7p13-p14 A0005247 caggctctattctatg
 7p21 A0005228 gcttgcagactctttaaagc
 7p14-p15 A0005154 aaagtcataatacaata
 7g21.2-g31.1 A0004991 aaacaggatttaatgg
 7g31 A0002487 cactgactggaacaaagccttaa
 7g33-q35 A0004853 aattcttttattgtaaca
 7g31.3 A0002499 atatgaaagatatatgg
 7g31.2 A0002543 ggcccagcaacactt
 7g31 A0002432 aggaggaacaggagaaggaggtggag
 7g22-g31.1 A0004522 tcatagggcagaggaca
8 8g21 AF068862 catcaaatgaaacaatgtata
16 16p13.3 A0004509 aagaatatttcagacagtgggga
 16p12 A0004525 aagatcaattgtactaatat
17 17 A0005209 aggaggaacaggagaaggaggtggaga
 17 HSMLCIG4 taggagcactaataggtgta
18 18 A0006211 tctctaaaggaaatataacaa
19 19p12 A0004026 gtcaaacataactggaatgatt
 19g12 A0005597 catcagtaaagtggaataa
20 20p12 HS873P14 ccatggaataaaacacatcctaac
21 21g22.1 AF107258 actatatgccacagtctatt
 21g22.2 AF015720 atatcaaaatagtattaat
 21g22, HS229042 gaacaacaggagaaaaa
22 22g12.1 A0003072 aaatgactttcttgtg
 22g12.3-13.2 HS327J16 cacagtggtgaagatgcagaa
 22g11.2 HS175E3 acaaatttcttttta
 22g11.2 A0002472 ctttcttgtgtacaaatg
 22g12 HS345P10 aaaggtatcttttga
 22g11.2 A0000077 tctttaagtgtaatga
 22g11.21-12.2 HS221G9 atgcacctcccatcccaggaa
 22g11.2 A0004032 ggagaaggaggtggagacgaag
NA (b) SIVagm env U03998 ttctttttaactgtcatggagaattc-
 ttttattgtaa

Chromosome VAU nucleotide position

X 88-108
 246-270
 234-251
 2053-2070
2 1205-1222
4 435-454
 1031-1053
 1060-1080
 2085-2102
5p 855-874
 2292-2312
 2336-2356
6 1830-1846
 193-210
 648-665
 1792-1810
 2318-2337
7 1609-1629
 151-166
 274-295
 453-473
 494-511
 386-406
 514-529
 237-2456
 2452-2468
 692-707
 1008-1030
 1154-1171
 1454-1470
 1725-1739
 2232-2258
 2414-2430
8 557-577
16 826-848
 1225-1244
17 2232-2258
 2108-2127
18 797-821
19 1365-1386
 1862-1880
20 1402-1425
21 99-118
 398-417
 1993-2009
22 362-377
 1102-1122
 1123-1142
 368-387
 621-635
 677-692
 1331-1351
 2242-2263
NA (b) 1132-1169

(a) A survey of mosaic segments from the Homo sapiens databank of
the Blast program (http://www.ncbi.nim.nih.gov/BLAST/). Sample
sequences represent >89% homology with HIV-lvau (GenBank no. X80020.
Some segments may have representation on other human chromosome sites.

(b) NA, not applicable.
COPYRIGHT 1999 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1999 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Oak Ridge Conference
Author:Urnovitz, Howard B.; Sturge, Jerrilyn C.; Gottfried, Toby D.; Murphy, William H.
Publication:Clinical Chemistry
Article Type:Survey
Date:Sep 1, 1999
Words:8847
Previous Article:In vitro diagnostics in diabetes: meeting the challenge.
Next Article:Development, characterization, and use of monoclonal antibodies made to antigens expressed on the surface of fetal nucleated red blood cells.
Topics:


Related Articles
HIV testing 101 (Part 1 of 2).
Detecting recent Human Immunodeficiency Virus type 1 infection: why and how? (Cover Story).
New testing for very early HIV diagnosis.
HIV testing: an update.
1 in 40 patients presenting to UK emergency departments has HIV.

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters