Printer Friendly

Type IV secretion system is not involved in infection process in citrus.

1. Introduction

Xanthomonas citri subsp. citri (Xcc) is a Gram-negative plant pathogenic bacteria that causes severe disease in many economically important citrus plants [1]. The citrus canker induced by Xcc is a destructive disease characterized by canker lesions on leaves, stems, and fruits; furthermore the pathogen induces defoliation, which results in reduced yield and premature fruit drop [2]. Control is difficult in areas where the disease is already established, and plant eradication is the only effective way to control and prevent the disease spread. Recurrent and severe attacks of the pathogen are responsible for serious economic losses in citrus groves around the world [2].

The focus of the present study is aimed at understanding the role of bacterial secretory systems, specifically the type IV secretory system (T4SS). Seven secretory systems are known and described in prokaryotic organisms, and each one is related to a physiological process [3-5]. Of these, the best studied is the type III secretory system (T3SS), which enables bacterial pathogens to deliver effector proteins into eukaryotic cells [6]. Some bacterial pathogens, including species from Chlamydia, Xanthomonas, Pseudomonas, Ralstonia, Shigella, Salmonella, Escherichia, and Yersinia, depend on the T3SS to induce damage to the host. In contrast, other organisms including Agrobacterium tumefaciens, Helicobacter pylori, and Legionella pneumophila depend on the type IV secretory system (T4SS) for virulence induction [7].

The T3SS contains at least twenty distinct proteins, which are subdivided into three parts. The basal body of the system [8-11] is associated with an ATPase and likely facilitates the entry of substrates into the secretion apparatus [12]. Thisbasal body is also associated with a protein needle (the second part of the T3SS), which binds the bacterium to host cells and acts as a conduit for effectors secretion. The third part of the T3SS is composed of three proteins that are exported through the bacterial needle and form a pore on the surface of the host cell, which facilitates the export of toxins into the target cytoplasm [13].

On the other hand, the T4SS is a multiprotein complex that consists of a protein channel (encoded by virB and virD) through which proteins or protein-DNA complexes can be translocated between bacteria (cell-to-cell communication) and into host cells [14]. Translocation is driven by a number of cytoplasmic ATPases that potentially energize large conformational changes in the translocation complex [15]. There are three functional types of T4SS. The first type, found in many Gram-positive and Gram-negative bacteria and some Archaea, functions in conjugation and in the transfer of TDNA into plant cells by A. tumefaciens. A second type of T4SS mediates DNA uptake in the transformation process (found in H. pylori). A third type of T4SS is used to transfer toxic effector proteins or protein complexes into the cytoplasm of host cells (found in Bordetella pertussis, Legionella pneumophila, Pseudomonas aeruginosa, and Xcc) 15].

Substrates transported by the T4SS modulate various cellular processes including apoptosis, vesicular traffic, and ubiquitination; furthermore, the number of type IV effector proteins continues to increase [16-19]. However, most of these substrates have not been functionally characterized, and their role in bacterial pathogenesis remains unknown [20].

In many bacteria, these two secretory systems types are well characterized; however, in Xanthomonas spp. only the T3SS has been intensively studied [1], in contrast to the limited number of studies involving the T4SS [21, 22]. In Xcc the T4SS deserves more attention, especially since the genome contains two copies of this system (chromosomal and plasmid-borne) [23]. The plasmid copy is homologous to others Xanthomonads that contain the T4SS on extrachromosomal DNA. However, only Xcc and Xanthomonas campestris contain the chromosomal copy of the T4SS.

To understand the conditions that stimulate expression of T4SS genes in Xcc we used qPCR to analyze the in vitro and in planta expression of 18 ORFs from the T4SS (both chromosomal and plasmid copies) and 7 hypothetical ORFs flanking the T4SS. To validate the qPCR data, we compared expression of 29 ORFs from the T3SS, which are known to be expressed in planta.

Our results showed that the T4SS is not induced during the infection process in Xcc, but may be very important in cell-to-cell communication.

2. Materials and Methods

2.1. Microbiological Procedures. Xcc strain 306 was previously sequenced by da Silva et al. [23]. Xcc was maintained in sterile tap water and grown on nutrient agar (NA) medium containing 3 g beef extract, 5 g peptone, and 15 g agar in 1L of distilled water at 28[degrees]C. After 24 h, three single colonies were transferred to new NA plates and incubated for 12 h at 28[degrees]C. These Xcc solid cultures were used as pre-inoculum for in planta and in vitro studies. For in planta studies, preinoculum cultures were aseptically transferred to sterile flasks containing 50 mL of nutrient broth (NB) and the bacterial concentration was adjusted to 108 CFU/mL ([OD.sub.600] = 0.3). This bacterial suspension was taken up in a 1 mL needleless syringe and used to infiltrate orange leaves (Citrus sinensis cv. pera) grown in 20 L capacity pots. A total of nine plants were inoculated (20 leaves per plant) and maintained for 72 h in a growth room at 28[degrees]C, with a 12 h photoperiod and light intensity ~2,000 lux. Three plants were used for each incubation period. After multiplication, inoculated leaves were collected, sliced into thin strips with a razor blade, and placed in a beakers with sterile distilled water in an ice bath with gentle agitation. Samples from each plant were placed in separate beakers for bacterial exudation. After 5 min, leaf debris was removed by filtration through gauze, and bacterial cells were recovered by centrifugation at 5,000 xg for 5 min at 4[degrees]C. Total RNA was extracted immediately, as described below. For in vitro studies, 1 mL of each Xcc suspension at [10.sup.8] CFU/mL were aseptically transferred to three Erlenmeyer flasks and incubated for 12 h at 28[degrees]C with shaking (200 rpm). After incubation, bacterial cells were harvested by centrifugation at 5,000 xg for 5 min. Total RNA was extracted as described below. Thus, we obtained three independent biological replicates for Xcc growth in vitro and in planta. All cultivation media were obtained from Difco Chemical Co., Detroit, USA. For confirmatory RT-qPCR, the same procedures were followed except the plant incubation period was only 72 h, due to RNA quality and concentration sufficient to yield reliable results. The time point 72 hours was the shortest period to allow obtaining satisfactory bacterial mass to the proposed analyzes involving gene expression. The bacterial cells concentration in short time (12 or 24 hours) don't allows this study. For this reason, some works are using culture media that mimic vegetable conditions to investigate the infectious process under these time scales [24, 25].

2.2. Extraction of RNA from Xcc. Each inoculated flask represented one independent biological replicate. RNA was extracted using an Illustra-RNAspin Mini RNA Isolation Kit (Amersham Biosciences) following the manufacturer's instructions. To ensure that samples did not contain DNA, PCR was performed using RNA samples treated with DNase I as a template. PCR conditions consisted of an initial denaturing step of 94[degrees]C for 3 min, followed by 35 cycles of a denaturation at 94[degrees]C for 30 s, annealing at 60[degrees]C for 30 s, and elongation at 72[degrees]C for 2 min. A final elongation step of 72[degrees] C for 4 min was performed, and then samples were maintained at 4[degrees]C until needed. The amplification reaction was conducted in a total volume of 25 [micro]L containing 200 ng RNA in 2.5 [micro]L, PCR buffer (2.5 [micro]L, Invitrogen), 1.5 mM Mg[Cl.sub.2], 0.2 mM dNTP, 300 nM 16S rRNA primer [26], and 1U Taq DNA polymerase (Invitrogen). The products were electrophoresed in a 1% agarose gel with TAE buffer, stained with ethidium bromide, and visualized using a UV transilluminator. No products were observed (data not shown). To verify the quality of extracted RNA, the samples were analyzed by electrophoresis in a 1% agarose gel using TAE buffer followed by ethidium bromide staining. The A260/280 ratio of RNA samples was measured, and RNA was quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). RNA samples were stored at -80[degrees]C until needed.

2.3. Gene Expression Using RT-qPCR. First strand cDNA synthesis and all RT-qPCR reactions were done using the SuperScript III First-Strand Synthesis SuperMix for RT-qPCR (Invitrogen) as recommended by the manufacturer's specifications except for the amount of cDNA in each reaction, which was 20 ng. All PCR was performed with SYBR Green on a 7500 Real-Time PCR instrument (Applied Biosystems) using three biological replicates and three technical replicates (one for each biological replicate). PCR was for 2 min at 50[degrees]C, 10 min at 95[degrees]C, followed by 40 cycles of 15 s at 95[degrees]C, and 1 min at 60[degrees]C. To determine PCR efficiency, standard curves were generated using cDNA samples at five dilutions and measured in triplicate. rpoB, atpD, and gyrB were used as reference genes in all experiments [26]. To perform relative expression analysis, we used the [2.sup.-[DELTA][DELTA]] CT method [27]. Primer features are presented in Table 1.

3. Results and Discussion

3.1. qPCR Results for the T3SS. The results obtained from Xcc growing in planta or in vitro are presented in Figure 1. From the 29 T3SS genes analyzed by qPCR, only hrpA was downregulated at 72 h after inoculation (Figure 1(b)). hpa1, hpaB, hrpD6, hrpE, and hrpF showed the highest rates of expression, whereas phaE, hrpG, hrpX, and hrcA showed the lowest levels of expression. Interestingly, hrpB4 and hrpXct, which were shown to be necessary for Xcc pathogenesis [28], were not among the most upregulated genes in this study.

3.2. qPCR Results for the T4SS. The results for the expression levels of T4SS genes in planta and in vitro are shown in Figure 2. All genes associated with the T4SS were downregulated on Citrus leaves 72 h after inoculation (Figure 2(c)). We also analyzed the expression of hypothetical genes located near virB in chromosomal DNA (XAC2606, XAC2611, XAC2613, and XAC2622) and in plasmid pXAC64 (XACb0035, XACb0042, XACb0043, XACb0048, andXACb0049) (Figure 2(d) and Table 1). ORFs representing hypothetical genes in both the chromosome and plasmid were down-regulated when Xcc was cultivated in Citrus sinensis for 72 h. An exception was XAC2611, where expression was similar when Xcc was cultivated in culture medium or in planta (Figure 2(d)).

Our results clearly show different gene expression profiles for the T3SS and T4SS in Xcc during Citrus infection. The T4SS was previously described in A. tumefaciens, where it mediates the transfer of DNA and protein substrates to plants and other organisms via a cell contact-dependent mechanism [14]. In Xcc, the genome sequence revealed the presence of two virB operons, one on the chromosome and a second copy in the 64 kb plasmid pXAC64 [23]. The chromosomal genes virB1, virB3, virB4, virB8, virB9, and virB11 and the plasmid-encoded genes virB1, virB2, virB4, virB6, virB9, and virB11 were all down-regulated in planta (Figure 2(c)). This was somewhat surprising because the T4SS is essential for a successful infection in many Gram-negative pathogenic bacteria [29]. The fact that ORFs representing hypothetical genes in both the chromosome and plasmid near the virB genes were also down-regulated under the same condition (Figure 2(d)) indicates that they could be related to the T4SS system in Xcc. Recent studies in Brucella suis [30] and in A. tumefaciens [31] showed that alterations in VirB8 result in protein dimerization, a process that modifies the T4SS structure and affects bacterial virulence. In Streptococcus suis [32], the knockout of the virD4-89K and virB4-89K of the T4SS eliminated the lethality of a highly virulent strain and impaired its ability to trigger host immune responses in mice. Recent studies continue to demonstrate the importance of the T4SS and its components in virulence; thus the lack of induction of Xcc T4SS genes in the present study is intriguing. However, in Xanthomonas campestris pv. campestris T4SS deletion mutant displayed the same virulence as wild type and authors conclude that T4SS is not involved in pathogenicity in that Xanthomonas [33].

Wang et al. [34] presented evidence that in planta transfer of a 37 kb plasmid (pXcB) from Xanthomonas aurantifolii to Xanthomonas citri can occur via T4SS. Thus, at least the T4SS copy present in Xcc plasmid can play a hole in horizontal gene transfer.

All but one of the twenty-nine genes from the T3SS of Xcc were up-regulated in planta. Laia et al. [28] showed that Xcc mutants containing mutations in hrpB4 or hrpXct failed to cause disease and growth in citrus leaves was lower than the wild-type Xcc strain 306. These two genes, which are not among the most up-regulated genes in the present study, are part of the hrp (hypersensitive reaction and pathogenicity) system and comprise part of the T3SS [35]. In the related pathogen, Xanthomonas campestris pv. vesicatoria (Xcv), a hrpB4 mutant was unable to cause disease in susceptible pepper plants or the hypersensitive reaction in pepper plants carrying the respective compatible R gene [36]. Previously, hrpXv was shown to be necessary for transcriptional activation of five hrp genes (loci hrpB to hrpF) 37], and hrpB4 was required for complete functionality of the T3SS in Xcv [36]. Thus it is apparent that a gene does not have to be strongly up-regulated during infection to play an important role in virulence. Multiple genes, including hpaA, hpaE, hpaF, hpaP, hrpB, hrpB1, hrpB2, hrpB7, hrpD5, hrpM, hrpW, hrcC, hrcQ, hrcS, hrcT, and hrcV, were expressed at levels similar to hrpXct and hrpB4 and are good candidates for further studies into their roles in citrus canker disease.

Among the most up-regulated genes, hrpD6 warrants further attention. A hrpD6 mutant of Xanthomonas oryzae pv. oryzae (Xoo) failed to trigger a hypersensitive response in tobacco and was nonpathogenic in rice because the mutation in hrpD6 impacts the secretion of T3SS effectors, such as Hpa1, which is translocated through the T3SS [38].

Our qPCR data showed that hpal was the most up-regulated gene during Citrus sinensis infection by Xcc, followed by hrpD6 (Figure 1(b)). Conversely, hrpA, which encodes an important component of the T3SS pilus [39], was downregulated in our study. Previously, hrpA mutants of Pseudomonas syringae pv. tomato DC3000 showed reduced accumulation of structural components of the hrp pilus [39]. Haapalainen et al. [40] showed that soluble plant cell signals induce the expression of hrp/hrc genes and specifically upregulate hrpA. Interestingly, they found that HrpA does not accumulate to high levels intracellularly, suggesting that some kind of feedback regulation takes place between secretion and production of HrpA, perhaps through degradation of intracellular HrpA. Our work shows that this may also be applicable to hrpA gene in Xcc: its mRNA may be degraded faster, just as happen with HrpA in Pseudomonas syringae.

4. Conclusions

Our finds confirm that the T3SS genes are induced in the successful infection of Citrus sinensis by Xcc, and therefore are excellent targets to help control or decrease the severity of citrus canker, whereas T4SS seems not have any relation with virulence. On the other hand, our results show that T4SS is not induced under the same infection conditions, which could indicate that it is not necessary for infection but only for cell-to-cell communication.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

http://dx.doi.org/10.1155/2014/763575

Acknowledgments

This work was supported by grants from Fundacao de Amparo a Pesquisa do Estado de Sao Paulo (FAPESP), Fundo de Defesa da Citricultura (FUNDECITRUS), Coordenacao de Aperfeicoamento de Pessoal de Nivel Superior (CAPES), and Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq) for the biological tests and fellowship Grants, and by Grants from Fundacao de Amparo a Pesquisa do Estado de Minas Gerais (CBB-APQ-04425-10) for Xcc functional database creation. The funding agencies had no role in study design, data collection and analysis, decision to publish, or preparation of the paper.

References

[1] J. Boch and U. Bonas, "Xanthomonas AvrBs3 family-type III effectors: discovery and function," Annual Review of Phytopathology, vol. 48, pp. 419-436, 2010.

[2] J. H. Graham, T. R. Gottwald, J. Cubero, and D. S. Achor, "Xanthomonas axonopodis pv. citri: factors affecting successful eradication of citrus canker" Molecular Plant Pathology, vol. 5, no. 1, pp. 1-15, 2004.

[3] W. Bitter, E. N. G. Houben, J. Luirink, and B. J. Appelmelk, "Type VII secretion in mycobacteria: classification in line with cell envelope structure," Trends in Microbiology, vol. 17, no. 8, pp. 337-338, 2009.

[4] D. Buttner and U. Bonas, "Regulation and secretion of Xanthomonas virulence factors," FEMS Microbiology Reviews, vol. 34, no. 2, pp. 107-133, 2010.

[5] E. J. M. Stoop, W. Bitter, and A. M. van der Sar, "Tubercle bacilli rely on a type VII army for pathogenicity," Trends in Microbiology, vol. 20, no. 10, pp. 477-484, 2012.

[6] P. Troisfontaines and G. R. Cornelis, "Type III secretion: more systems than you think," Physiology, vol. 20, no. 5, pp. 326-339, 2005.

[7] B. Coburn, I. Sekirov, and B. B. Finlay, "Type III secretion systems and disease," Clinical Microbiology Reviews, vol. 20, no. 4, pp. 535-549, 2007.

[8] J. L. Hodgkinson, A. Horsley, D. Stabat et al., "Three-dimensional reconstruction of the Shigella T3SS transmembrane regions reveals 12-fold symmetry and novel features throughout," Nature Structural & Molecular Biology, vol. 16, no. 5, pp. 477-485, 2009.

[9] T F Moraes, T Spreter, and N. C. Strynadka, "Piecing together the Type III injectisome of bacterial pathogens," Current Opinion in Structural Biology, vol. 18, no. 2, pp. 258-266, 2008.

[10] O. Schraidt, M. D. Lefebre, M. J. Brunner et al., "Topology and organization of the Salmonella typhimurium type III secretion needle complex components," PLoS Pathogens, vol. 6, no. 4, article e1000824, 2010.

[11] T. Spreter, C. K. Yip, S. Sanowar et al., "A conserved structural motif mediates formation of the periplasmic rings in the type III secretion system," Nature Structural and Molecular Biology, vol. 16, no. 5, pp. 468-476, 2009.

[12] Y. Akeda and J. E. Galon, "Chaperone release and unfolding of substrates in type III secretion," Nature, vol. 437, no. 7060, pp. 911-915, 2005.

[13] P-J. Mattel, E. Faudry, V Job, T. Izoro, I. Attree, and A. Dessen, "Membrane targeting and pore formation by the type III secretion system translocon," FEBS Journal, vol. 278, no. 3, pp. 414-426, 2011.

[14] P J. Christie, K. Atmakuri, V Krishnamoorthy, S. Jakubowski, and E. Cascales, "Biogenesis, architecture, and function of bacterial type IV secretion systems," Annual Review of Microbiology, vol. 59, pp. 451-485, 2005.

[15] K. Wallden, A. Rivera-Calzada, and G. Waksman, "Type IV secretion systems: versatility and diversity in function," Cellular Microbiology, vol. 12, no. 9, pp. 1203-1212, 2010.

[16] K. S. De Felipe, S. Pampou, O. S. Jovanovic et al., "Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer," Journal of Bacteriology, vol. 187, no. 22, pp. 7716-7726, 2005.

[17] H. Nagai, J. C. Kagan, X. Zhu, R. A. Kahn, and C. R. Roy, "A bacterial guanine nucleotide exchange factor activates ARF on Legionella phagosomes," Science, vol. 295, no. 5555, pp. 679-682, 2002.

[18] S. Ninio and C. R. Roy, "Effector proteins translocated by Legionella pneumophila: strength in numbers," Trends in Microbiology, vol. 15, no. 8, pp. 372-380, 2007

[19] X. Pan, A. Luhrmann, A. Satoh, M. A. Laskowski-Arce, and C. R. Roy, "Ankyrin repeat proteins comprise a diverse family of bacterial type IV effectors," Science, vol. 320, no. 5883, pp. 1651-1654, 2008.

[20] M. I. Marchesini, C. K. Herrmann, S. P Salcedo, J.-P Gorvel, and D. J. Comerci, "In search of Brucella abortus type iv secretion substrates: screening and identification of four proteins translocated into host cells through virb system," Cellular Microbiology, vol. 13, no. 8, pp. 1261-1274, 2011.

[21] M. C. Alegria, D. P. Souza, M. O. Andrade et al., "Identification of new protein-protein interactions involving the products of the chromosome- and plasmid-encoded type IV secretion loci of the phytopathogen Xanthomonas axonopodis pv. citri," Journal of Bacteriology, vol. 187, no. 7, pp. 2315-2325, 2005.

[22] D. P. Souza, M. O. Andrade, C. E. Alvarez-Martinez, G. M. Arantes, C. S. Farah, and R. K. Salinas, "A component of the Xanthomonadaceae type IV secretion system combines a VirB7 motif with a N0 domain found in outer membrane transport proteins," PLoS Pathogens, vol. 7, no. 5, Article ID e1002031,2011.

[23] A. C. R. Da Silva, J. A. Ferro, F. C. Reinach et al., "Comparison of the genomes of two Xanthomonas pathogens with differing host specificities," Nature, vol. 417, no. 6887, pp. 459-463, 2002.

[24] A. Facincani, L. Moreira, M. Soares et al., "Comparative proteomic analysis reveals that T3SS, Tfp, and xanthan gum are key factors in initial stages of Citrus sinensis infection by Xanthomonas citri subsp. citri" Functional & Integrative Genomics, pp. 1-13, 2013.

[25] M. R. Soares, A. P. Facincani, R. M. Ferreira et al., "Proteome of the phytopathogen Xanthomonas citri subsp. citri: a global expression profile," Proteome Science, vol. 8, article 55, 2010.

[26] T. R. Jacob, M. L. Laia, J. A. Ferro, and M. I. T. Ferro, "Selection and validation of reference genes for gene expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp. citri during infection of Citrus sinensis," Biotechnology Letters, vol. 33, no. 6, pp. 1177-1184, 2011.

[27] K. J. Livak and T. D. Schmittgen, "Analysis of relative gene expression data using real-time quantitative PCR and the 2-[DELTA][DELTA]CT method," Methods, vol. 25, no. 4, pp. 402-408, 2001.

[28] M. L. Laia, L. M. Moreira, J. Dezajacomo et al., "New genes of Xanthomonas citri subsp. citri involved in pathogenesis and adaptation revealed by a transposon-based mutant library," BMC Microbiology, vol. 9, article 12, 2009.

[29] H. Nagai and T. Kubori, "Type IVB secretion systems of legionella and other gram-negative bacteria," Frontiers in Microbiology, vol. 2, article 136, 2011.

[30] L. Andrieux, G. Bourg, A. Pirone, D. O'Callaghan, and G. Patey, "A single amino acid change in the transmembrane domain of the VirB8 protein affects dimerization, interaction with VirB10 and Brucella suis virulence," FEBS Letters, vol. 585, no. 15, pp. 2431-2436, 2011.

[31] D. Sivanesan and C. Baron, "The dimer interface of Agrobacterium tumefaciens VirB8 is important for type IV secretion system function, stability, and association of VirB2 with the core complex," Journal of Bacteriology, vol. 193, no. 9, pp. 2097-2106, 2011.

[32] Y. Zhao, G. Liu, S. Li et al, "Role of a type IV-like secretion system of Streptococcus suis 2 in the development of streptococcal toxic shock syndrome," Journal of Infectious Diseases, vol. 204, no. 2, pp. 274-281, 2011.

[33] Y.-Q. He, L. Zhang, B.-L. Jiang et al., "Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the phytopathogen Xanthomonas campestris pv. campestris," Genome Biology, vol. 8, no. 10, article R218, 2007.

[34] Y. Wang, M. Xiao, X. Geng, J. Liu, and J. Chen, "Horizontal transfer of genetic determinants for degradation of phenol between the bacteria living in plant and its rhizosphere," Applied Microbiology and Biotechnology, vol. 77, no. 3, pp. 733-739,2007

[35] G. R. Cornelis and F. Van Gijsegem, "Assembly and function of type III secretory systems," Annual Review of Microbiology, vol. 54, pp. 735-774, 2000.

[36] O. Rossier, G. Van Den Ackerveken, and U. Bonas, "HrpB2 and hrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant," Molecular Microbiology, vol. 38, no. 4, pp. 828-838, 2000.

[37] K. Wengelnik and U. Bonas, "HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria," Journal of Bacteriology, vol. 178, no. 12, pp. 3462-3469,1996.

[38] X. Guo, H. Zou, Y. Li, L. Zou, and G. Chen, "HrpD6 gene determines Xanthomonas oryzae pv. oryzae to trigger hypersensitive response in tobacco and pathogenicity in rice," Wei Sheng Wu XueBao, vol. 50, no. 9, pp. 1155-1163, 2010.

[39] E. Roine, J. Saarinen, N. Kalkkinen, and M. Romantschuk, "Purified HrpA of Pseudomonas syringae pv. tomato DC3000 reassembles into pili," FEBS Letters, vol. 417, no. 2, pp. 168-172, 1997.

[40] M. Haapalainen, K. Van Gestel, M. Pirhonen, and S. Taira, "Soluble plant cell signals induce the expression of the type III secretion system of Pseudomonas syringae and upregulate the production of pilus protein HrpA," Molecular Plant-Microbe Interactions, vol. 22, no. 3, pp. 282-290, 2009.

Tiago Rinaldi Jacob, (1) Marcelo Luiz de Laia, (2) Leandro Marcio Moreira, (3) Janaina Fernandes Goncalves, (2) Flavia Maria de Souza Carvalho, (4) Maria Ines Tiraboschi Ferro, (1) and Jesus Aparecido Ferro (1)

(1) Faculdade de Ciencias Agrarias e Veterinarias de Jaboticabal, Departamento de Tecnologia, Universidade Estadual Paulista (UNESP), 14.884-900 Jaboticabal, SP, Brazil

(2) Departamento de Engenharia Florestal, Faculdade de Ciencias Agrarias, Universidade Federal dos Vales do Jequitinhonha e Mucuri, 39.100-000 Diamantina, MG, Brazil

(3) Departamento de Ciencias Biologicas (DECBI), Instituto de Ciencias Exatas e Biologicas (ICEB) and Nucleo de Pesquisas em Ciencias Biologicas (NUPEB), Universidade Federal de Ouro Preto, 35.400-000 Ouro Preto, MG, Brazil

(4) Embrapa Informatica Agropecuaria, CNPTIA-EMBRAPA, Campinas, SP, Brazil

Correspondence should be addressed to Jesus Aparecido Ferro; jesus@fcav.unesp.br

Received 17 August 2013; Accepted 10 January 2014; Published 23 February 2014

Academic Editor: Joseph Falkinham

Table 1: General features of the T3SS and T4SS primer sequences.

XACID        Gene    Gene ID            Product (NCBI
                                         Annotation)

XAC0293      hrpB    1154364            ATP-dependent
                                         RNA helicase
XAC0393      hpaF    1154464             HpaF protein
XAC0394      hrpF    1154465             HrpF protein
XAC0396      hpaB    1154467             HpaB protein
XAC0397      hrpE    1154468             HrpE protein
XAC0398     hrpD6    1154469            HrpD6 protein
XAC0399     hrpD5    1154470            HrpD5 protein
XAC0400      hpaA    1154471             HpaA protein
XAC0401      hrcS    1154472             HrcS protein
XAC0402      hrcR    1154473             Protein T3SS
XAC0403      hrcQ    1154474             HrcQ protein
XAC0404      hpaP    1154475             HpaP protein
XAC0405      hrcV    1154476             HrcV protein
XAC0406      hrcU    1154477          HrcU protein T3SS
XAC0407     hrpBl    1154478            HrpBl protein
XAC0408     hrpB2    1154479            HrpB2 protein
XAC0409      hrc]    1154480             HrcJ protein
XAC0410     hrpB4    1154481            HrpB4 protein
XAC0411     hrpB5    1154482          Protein T3SS HrpB
XAC0412      hrcN    1154483         T3SS ATPase protein
XAC0413     hrpB7    1154484            HrpB7 protein
XAC0414      hrcT    1154485             HrcT protein
XAC0415      hrcC    1154486             HrcC protein
XAC0416      hpal    1154487       Hpal protein monovalent
XAC0459      phaE    1154530   cation/H + antiporter subunit E
XAC0618      hrpM    1154689       Glucosyltransferase MdoH
XAC1265      hrpG    1155336             HrpG protein
XAC1266     hrpXct   1155337             HrpX protein
                                        Heat-inducible
XAC1520      hrcA    1155591           transcriptional
XAC1994      hrpX    1156064     repressor HrpX-like protein
XAC2047      phaE    1156118         PHA synthase subunit
XAC2606       --     1156677         Hypothetical protein
XAC2611       --     1156682         Hypothetical protein
XAC2612     virB6    1156683            VirB6 protein
XAC2613       --     1156684         Hypothetical protein
XAC2614     virB4    1156685            VirB4 protein
XAC2615     virB3    1156686            VirB3 protein
XAC2616     virB2    1156687            VirB2 protein
XAC2617     virBl    1156688            VirBl protein
XAC2618     virBll   1156689            VirBll protein
XAC2619     virBlO   1156690            VirBlO protein
XAC2620     virB9    1156691            VirB9 protein
XAC2621     virB8    1156692            VirB8 protein
XAC2622       --     1156693         Hypothetical protein
XAC2623     virD4    1156694            VirD4 protein
XAC2922      hrpW    1156993             HrpW protein
XAC3122      hrpA    1157193      ATP-dependent RNA helicase
XACb0035      --     1158522         Hypothetical protein
XACb0036    virBl    1158523            VirBl protein
XACb0037    virBll   1158524            VirBll protein
XACb0038    virBlO   1158525            VirBlO protein
XACb0039    virB9    1158526            VirB9 protein
XACb0040    virB8    1158527            VirB8 protein
XACb0041    virB6    1158528            VirB6 protein
XACb0042      --     1158529         Hypothetical protein
XACID        Gene    Gene ID      Product (NCBI Annotation)
XACb0043      --     1158530         Hypothetical protein
XACb0044    virB5    1158531            VirB5 protein
XACb0045    virB4    1158532            VirB4 protein
XACb0046    virB3    1158533            VirB3 protein
XACb0047    virB2    1158534            VirB2 protein
XACb0048      --     1158535         Hypothetical protein
XACb0049      --     1158536         Hypothetical protein

XACID           Primers (Forward)              Primers (Reverse)

XAC0293        GCCGTATCCCGTTGACCTT           ACCGCCCCTTCATCTCTTTT

XAC0393         GGCGAGCGTTTTGACAA             CCGGAGATCCTGGCAGTTT
XAC0394          GCCGCGACGCAGTTG              CGGTGATCGAGTTGTTCAA
XAC0396        GTCCGTGTACGCGCAAGAC             TGACGCCGGCATCATTG
XAC0397        ACGAGGCCCAGAAGTCCAT         CCACGTT GAAGTCCAGATCATTT
XAC0398        ACCGATACGGTCACCCAAGA            GATCCGCCGCCTTGGT
XAC0399        GCCCTGAAGTGCGTTCGTTA           TCACGGACGGGTCTTGCT
XAC0400         CGCCACCCCAACAGAAAA            ACGGCATCAGCTCCATCAA
XAC0401     CG ACGAT CTAGTGCG ATTTACCT         CGACCACCGGCAAGGA
XAC0402         ACACGGGAACGCGAAAAA           CCTTGGGCCAGATCTGTTGT
XAC0403        GCAGCTGGAAGTGGACCAA            GGCTGCAAACCCGACAAC
XAC0404        TGTCGATGGCACGAAATACC             CCCAACCGCGCCATT
XAC0405        GCCGCAAGTTGGTCGAGTT           CTCTGCCATATCGCGATTCC
XAC0406         AGCCGCGGTGCTCTTTG              TAGTCGCCGGCCGATTT
XAC0407         CTGCGGCCAGAGCTGAAG            ACCGCGCTTGATGGAAATC
XAC0408        CAGCGCAGCAGATCAAGTTG            CGCCGACGCTGACATTG
XAC0409          GAGCGGCACGCCAATC           TGT CGAGATCAAGCCATCCTT
XAC0410         GGACAACACGCGGATCGA             GTCCGTCCAGCGCTGAA
XAC0411         CGCACGCCTGGGATATG              AGGCCGGATTCGTTCCA
XAC0412        TCGATGGGCACCTGATTCTC           CGTCGATTGCCGGGTACT
XAC0413         CCGCGCTGATGGACAAG            GCTGCAGGATCGTGTCGATA
XAC0414        ATCCAGCAATCCGACAGCAT           CACCGGTGCGGACAGTTT
XAC0415         CAGATGCGGCTGGATGTG            CCGTCCACGGTGTTGGAT
XAC0416         GCAGCAGGCCGGTCAGT        TT CAT CAGCAT CTGGGT GTATT G
XAC0459         CCATCCCGGCTTCATCTG            GCGATGCCGTGAATGTTG
XAC0618         CAAGGGCCTGCACTGGAT           GCATCAACAGACCCCACATC
XAC1265         CGGCAAGCCGATCGTATT           GAAAAGAGCAGCCAGGCAAT
XAC1266     GCCTACAGCTACAT GAT CACCAAT         TGCGGCCACTTCGTTGA
XAC1520        AGTTCGCGTTTCGGCATATC           CGGTTCTGCACCTCGTTGT
XAC1994       CTGGTCTGATGCGAGCTTTCT          GCGTACTCGTCCACGATCAA
XAC2047        AGCAGGGTGCATCGAAGAAG           TTTTCGGAGCCGCCTTTT
XAC2606        CCCTCAGTGTGGGCCAGAT            AGGAGGCGGTTGAGGGATA
XAC2611          GGGAGCCCGCAATGTG            GGAGGCGTGGGAATATCATCT
XAC2612        TGCAGCAGGGAGGATTAGGA             CGGCGGTGCGGTGAT
XAC2613       CGAAGGGAGATGGAAGCAGTT          GCTCAACAGATCGGCTGGAA
XAC2614        GACGTCGCTTGGTGGAGAAA            TTCCTCGGCGCGAATCT
XAC2615         GCCCCGCCATGTTTTTG              CGCCCGCACCAATGAA
XAC2616         TCGCCGATGCCAAAATG         CAGCAACG AAAT GAATAGCAAT G
XAC2617       CGTATCGAGTCGTCGCGTAAT            CACCAGGCGTCCACCAA
XAC2618       CGCTGGT CAACCACATT CC           CCTGGCGTCCTCAATCGT
XAC2619      CCATTGCAGCTCTCTTGATTCTC          GAATCCTCCCCGCTTTGC
XAC2620        GCT GAGCCCGAACGAAAAA         GCT CCCAT CCACCAGT GAA
XAC2621        TCGTCATGGCAGATGCGTAT           CCGAAGTTGGGCTCAAGCT
XAC2622       GGCGGATTCCAATATGCAGTT           TGGCCCGATCAAGGTGTAG
XAC2623       TCGCTGGAATCCATTGACCTA          TCAAATCCGAAACGCGAAAT
XAC2922         GGCGGACACACCGACATC           TGCCTTTCAGGGTGGAGTCTT
XAC3122         TGCGCGCTCTGAATTCG           GGACTGGGTAAGATCTTCATGCA
XACb0035       CGAGACGAGAACGGCCATT            TGTCACGCAGCAATTCGAA
XACb0036      CGTTACAACCTCGCCAAATATG          CTGCCCGCCTTGAGATTG
XACb0037        CCCGGAAGCGGTTGAGT             CGTGAGCGACCCCTTGTG
XACb0038     TCTACGTGAACAAAGACCTCGATT          CGCTTGGCTCCGTCGAT
XACb0039        GCTCACGCGGCGAAGTT           GCACTTGCTTGACACGATCATC
XACb0040      CTCGAACAAGCTCAAACAGGAA          AACAGCAGCAACCCGATGA
XACb0041        GCGCAGCTCGTCATCGT              CGCGGACACCCAACATG
XACb0042        CCGGGAACCCGCTTTTA             GGAAGCCACTGCCGAAACT
XACID           Primers (Forward)              Primers (Reverse)
XACb0043        TTCGCGGCCCTCATCTC           AGGGCGACTTGTTGAACTTGTT
XACb0044        CAGGCCGCCTACGAGAAG           GGGATTGGCGAACAGGTCTT
XACb0045      GGAACAGGCAAAAGACGTCAAC          CCCGACAAGGTTTGAACGA
XACb0046     TCTTGCGATGAGCTTTTATTTCC        CCCAAAGT GAT CGCGTGATT
XACb0047        CGATCTGGCGGCTAACGT            ATGCGAGCTGCGGAAGAA
XACb0048       GGCGGATGACGTTGAAGCT           CGCGGTAACGACCTCATAAAC
XACb0049       ACCACGGATCCTGGCAAAT             AGCAGCCCCCGTGAACA

XACID         Amplicon       System
                (bp)

XAC0293          81           T3SS
XAC0393          57           T3SS
XAC0394          62           T3SS
XAC0396          53           T3SS
XAC0397          66           T3SS
XAC0398          55           T3SS
XAC0399          54           T3SS
XAC0400          59           T3SS
XAC0401          68           T3SS
XAC0402          58           T3SS
XAC0403          57           T3SS
XAC0404          58           T3SS
XAC0405          58           T3SS
XAC0406          51           T3SS
XAC0407          60           T3SS
XAC0408          69           T3SS
XAC0409          54           T3SS
XAC0410          52           T3SS
XAC0411          63           T3SS
XAC0412          63           T3SS
XAC0413          60           T3SS
XAC0414          54           T3SS
XAC0415          59           T3SS
XAC0416          57           T3SS
XAC0459          54           T3SS
XAC0618          86           T3SS
XAC1265          54           T3SS
XAC1266          63           T3SS
XAC1520          91           T3SS
XAC1994          90           T3SS
XAC2047          63           T3SS
XAC2606          58         H_T4SS_C
XAC2611          59         H_T4SS_C
XAC2612          56          T4SS_C
XAC2613          59         H_T4SS_C
XAC2614          53          T4SS_C
XAC2615          54          T4SS_C
XAC2616          62          T4SS_C
XAC2617          57          T4SS_C
XAC2618          56          T4SS_C
XAC2619          61          T4SS_C
XAC2620          59          T4SS_C
XAC2621          61          T4SS_C
XAC2622          59         H_T4SS_C
XAC2623          59          T4SS_C
XAC2922          58           T3SS
XAC3122          76           T3SS
XACb0035         55         H_T4SS_P
XACb0036         74          T4SS_P
XACb0037         58          T4SS_P
XACb0038         64          T4SS_P
XACb0039         58          T4SS_P
XACb0040         60          T4SS_P
XACb0041         55          T4SS_P
XACb0042         52         H_T4SS_P
XACID       Amplicon (bp)    System
XACb0043         58         H_T4SS_P
XACb0044         57          T4SS_P
XACb0045         57          T4SS_P
XACb0046         59          T4SS_P
XACb0047         56          T4SS_P
XACb0048         56         H_T4SS_P
XACb0049         51         H_T4SS_P

This table provides primers sequences, ORFs identification ID, genes
name, and respective Xanthomonas citri subsp. citri secretory systems.
T4SS: type IV secretion system; T3SS: type III secretion system; C:
chromosomal copy; P: plasmid copy; H: hypothetical genes associated
with the T4SS.
COPYRIGHT 2014 Hindawi Limited
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Jacob, Tiago Rinaldi; de Laia, Marcelo Luiz; Moreira, Leandro Marcio; Goncalves, Janaina Fernandes;
Publication:International Journal of Microbiology
Article Type:Report
Date:Jan 1, 2014
Words:5079
Previous Article:Simultaneous production of biosurfactants and bacteriocins by probiotic Lactobacillus casei MRTL3.
Next Article:Optimization of amylase production from B. amyloliquefaciens (MTCC 1270) using solid state fermentation.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters