Printer Friendly

Two-step genetic screening of thrombophilia by pyrosequencing.

Venous thrombosic events are quite common; they affect ~1 in every 1000 persons per year and have a lifetime clinical prevalence of ~5%. The pathogenesis of venous thrombosic events is complex, involving the interaction of acquired risk factors with some genetic predisposition.

A wide array of methods and technologies have been used for screening of prothrombotic mutations (1-4). However, it is known that when mutation detection methods other than direct sequencing are used to identify a particular sequence change, there is always some risk that other sequence alterations occurring at the recognition site could lead to allele misclassification.

This issue has been discussed, for example, for the silent A1692C polymorphism in the factor V gene, which is erroneously identified as factor V Leiden by restriction enzyme digest detection (5). Other genotyping methods could also be affected by adjacent sequence alterations, including allele-specific amplification (6), single-strand conformational polymorphism analysis (7), oligonucleotide ligation (8), heteroduplex analysis (9), and methods based on melting curve analysis, in which unexpected results should be clarified definitively by sequencing (10).

Although DNA sequencing is still considered the "gold standard" for characterizing specific nucleotide alterations and improved technology has made automated DNA sequencing available to the clinical molecular diagnostics laboratory, DNA sequencing remains too expensive and time-consuming for most applications.

Recent studies demonstrating the robustness and speed of pyrosequencing technology, as well as its possible use for multiplex genotyping (11), have led to its use in an increasing range of genetic research areas (12-15).

The aim of our work was to establish a multiplex protocol for direct pyrosequencing analysis of a panel of coagulation factors mutations: the 3 single-nucleotide polymorphisms (SNPs) most commonly associated with thrombophilia--G1691A in factor V Leiden, G20210A in factor II, and C677T in methylenetetrahydrofolate reductase (MTHFR)--for a first-tier screening, and 3 additional polymorphisms--A1298C in MTHFR, Val34Leu in factor XIII, and 4G/5G in plasminogen activator inhibitor-1 (PAI-1)--which are believed not to have an independent effect on venous thrombosis but could be investigated in a second-tier screening because they may act synergistically with the previously mentioned factor mutations (16,17) or, in the case of factor XIII Val34Leu, exert a protective effect (18).

We used pyrosequencing to genotype 100 individuals, previously analyzed by LightCycler (Roche) or by direct sequencing, for a116 polymorphisms. Pure genomic DNA from EDTA-anticoagulated blood was isolated either by use of the semiautomated Magna Pure instrument with the Magna Pure LC DNA Isolation Kit (Roche) or manually, with the High Pure PCR Template Preparation Kit (Roche). These extraction procedures gave the same yield and PCR performance.

The 6 genomic segments containing the SNPs of interest were amplified in triplex PCR reactions with 3 pairs of primers (Eurogentec; see Table 1).

PCR conditions were optimized in preliminary experiments in which amplified products were analyzed by electrophoresis on agarose gel (4%) to optimize template concentration, magnesium concentration, and number of cycles to enhance PCR yield and specificity, which improve the success of the sequencing reaction.

Optimal PCR conditions for triplex amplification of factor V Leiden, factor II G20210A, and MTHFR C677T were as follows: 10 ng of pure genomic DNA, 10 pmol of each primer, 200 [micro]M each deoxynucleotide triphosphate (dNTP), 3 mM Mg[Cl.sub.2] and 0.5 U of HotGoldStar Taq polymerase (Eurogentec) in 20 [micro]L (final volume) of the buffer supplied (Eurogentec). Thermal cycling started with 10 min at 95[degrees]C followed by 35 cycles of 95[degrees]C for 30 s, 59[degrees]C for 30 s, and 72[degrees]C for 60 s, with a final step at 72[degrees]C for 5 min.

Triplex amplification of factor XIII Val34Leu, PAI-1 4G/5G, and MTHFR A1298C was performed with the following conditions: 10 ng of pure genomic DNA, 4.5 pmol of factor XIII primers, 25 pmol of MTHFR primers, 9 pmol of PAI-1 primers, 200 [micro]M each dNTP, 1.5 mM Mg[Cl.sub.2], and 0.5 U of HotGoldStar Taq polymerase in 30 [micro]L (final volume) of the buffer supplied (Eurogentec). Thermal cycling started with 10 min at 95[degrees]C, followed by 40 cycles of 95[degrees]C for 30 s, 58[degrees]C for 45 s, and 72[degrees]C for 60 s, with a final step at 72[degrees]C for 5 min.

At the end of PCR, 20-30 [micro]L of each biotinylated PCR products was immobilized on 3 [micro]L of streptavidin-coated Sepharose beads (Amersham Biosciences) to obtain single-stranded DNA suitable for sequencing. The immobilization, denaturation, washing, and primer annealing steps were performed with a vacuum preparation workstation according to the manufacturer's instructions (Biotage AB).

The single-stranded biotinylated PCR products were subjected to a multiplex minisequencing reaction on a PSQ96MA instrument (Biotage AB) to interrogate 3 polymorphic loci simultaneously. The multibase reading capability of pyrosequencing facilitates optimal positioning of the sequencing primers (Table 1). Sequencing was performed as described previously (19). The dispensation order to analyze the 3 sequences at the same time was selected by use of the SNP Entry module of the SNP Analysis Software (Biotage AB).

Parallel processing of 96 samples markedly reduced the handling time and pipetting steps needed. The maximum throughput was limited only by the number of PCR reactions because the multisequencing reaction lasted only 23 min for each 96-well microtiter plate. In addition, the results from the 96 completed sequencing reactions were analyzed by the pyrosequencing software in 2 min and were displayed as shown in Fig. 1 and in Fig. 1 of the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/ vol51/issue7/. Sequences are determined by computer-automated comparison of predicted patterns with raw data.

Generally, samples did not require time-consuming manual interpretation. Failure to make a genotype call at the first attempt was infrequent (~5%) and was mostly attributable to insufficient signal-to-noise ratios caused by poor PCR amplification. The accuracy, robustness, and reproducibility of the assay were very high: 100% of the results obtained with pyrosequencing (Table 1 of the online Data Supplement) were confirmed by LightCycler or sequencing analysis.

In conclusion, this method is rapid and cost-effective when compared with traditional sequencing; it is also suitable for the present challenge of high-throughput SNP genotyping: including all reagents and PCR, the cost per sample was 3 [euro]. This study shows, as has been shown previously, how a technology originally introduced into the field of basic biomedical research can be successfully adapted to the clinical laboratory.

[FIGURE 1 OMITTED]

We are grateful to Biosense for supplying the instrument and reagents and, in particular, to Dr. Elvis Meroni for excellent technical support. This work was partially supported by MURST-FIRB Grant RBAU01LSR4 001 (to F.F.).

References

(1.) Angelini A, Di Febbo C, Baccante G, Di Nisio M, Di Ilio C, Cuccurullo F, et al. Identifcation of three genetic risk factors for venous thrombosis using a multiplex allele-specific PCR assay: comparison of conventional and new alternative methods for the preparation of DNA from clinical samples. J Thromb Thrombolysis 2003;16:189-93.

(2.) Blasczyk R, Ritter M, Thiede C, Wehling J, Hintz G, Neubauer A, et al. Simple and rapid detection of factor V Leiden by allele-specific PCR amplification. Thromb Haemost 1996;75:757-9.

(3.) Bortolin S, Black M, Modi H, Boszko I, Kobler D, Fieldhouse D, et al. Analytical validation of the Tag-It high-throughput microsphere-based universal array genotyping platform: application to the multiplex detection of a panel of thrombophilia-associated single-nucleotide polymorphisms. Clin Chem 2004;50:2028-36.

(4.) Schrijver I, Lay M, Zehnder J. Diagnostic single nucleotide polymorphism analysis of factor V Leiden and prothrombin 20210G>A. A comparison of the Nanogen Eelectronic Microarray with restriction enryme digestion and the Roche LightCycler. Am J Clin Pathol 2003;119:490-6.

(5.) Liebman H, Sutherland D, Bacon R, McGehee W. Evaluation of a tissue factor dependent factor V assay to detect factor V Leiden: demonstration of high sensitivity and specificity for a generally applicable assay for activated protein C resistance. Br J Haematol 1996;95:550-3.

(6.) Patnaik M, Dlott JS, Fontaine RN, Subbiah MT, Hessner MJ, Joyner KA, et al. Detection of genomic polymorphisms associated with venous thrombosis using the Invader biplex assay. Mol Diagn 2004;6:137-44.

(7.) Corral J, Iniesta J, Gonzalez-Conejero R, Vicente V. Detection of factor V Leiden from a drop of blood by PCR-SSCP. Thromb Haemost 1996;76: 735-7.

(8.) Zotz R, Maruhn-Debowski B, Scharf R. Mutation in the gene coding for coagulation factor V and resistance to activated protein C: detection of the genetic mutation by oligonucleotide ligation assay using a semi-automated system. Thromb Haemost 1996;76:53-5.

(9.) Bowen D, Standen G, Granville S, Bowley S, Wood N, Bidwell J. Genetic diagnosis of factor V Leiden using heteroduplex technology. Thromb Haemost 1997;77:119-22.

(10.) Lay MJ, Wittwer CT. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem 1997;43:2262-7.

(11.) Palmieri O, Toth S, Ferraris A, Andriulli A, Latiano A, Annese V, et al. CARD15 Genotyping in inflammatory bowel disease patients by multiplex pyrosequencing. Clin Chem 2003;49:1675-9.

(12.) Lindgvist M, Haglund S, Almer S, Peterson C, Taipalensu J, Hertervig E, et al. Identification of two novel sequence variants affecting thiopurine methyltransferase enzyme activity. Pharmacogenetics 2004;14:261-5.

(13.) Fakhrai-Rad H, Pourmand N, Ronaghi M. Pyrosequencing: an accurate detection platform for single nucleotide polymorphisms. Hum Mutat 2002; 19:479-85.

(14.) Zhang Z, Liu W, Jia X, Gao Y, Hemminki K, Lindholm B. Use of pyrosequencing to detect clinically relevant polymorphisms of genes in basal cell carcinoma. Clin Chim Acta 2004;342:137-43.

(15.) Ronaghi M, Elahi E. Pyrosequencing for microbial typing. J Chromatogr B Analyt Technol Biomed Life Sci 2002;782:67-72.

(16.) Segui R, Estelles A, Mira Y, Espana F, Villa P, Falco C, et al. PAI-1 promoter 4G/5G genotype as an additional risk factor for venous thrombosis in subjects with genetic thrombophilic defects. Br J Haematol 2000;111:122-8.

(17.) Weisberg I, Tran P, Christensen B, Sibani S, Rozen R. A second genetic polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with decreased enryme activity. Mol Genet Metab 1998;64:169-72.

(18.) Endler G, Mannhalter C. Polymorphisms in coagulation factor genes and their impact on arterial and venous thrombosis. Clin Chim Acta 2003;330:31-55.

(19.) Ronaghi M, Uhlen M, Nyren P. A sequencing method based on real-time pyrophosphate. Science 1998;281:363-5.

DOI : 10.1373/clinchem.2005.048124

Annalisa Verri, [1] * Federico Focher, [2] Guido Tettamanti, [3] and Vittorio Grazioli [1] ([1] Istituto Clinico Humanitas, Rozzano, Italy; [2] Istituto di Genetica Molecolare, Consiglio Nazionale delle Ricerche, Pavia, Italy; [3] Dipartimento di Chimica e Biochimica Medica, Universita di Milano, Segrate, Italy; * address correspondence to this author at: Istituto Clinico Humanitas, via Manzoni, 56, 20089 Rozzano, Italy; fax 39-02-82244790, e-mail annalisa.verri@humanitas.it)
Table 1. Primers used for amplification and sequencing.

 Mutation Primer Sequence, 5' - 3'

Factor II G20210A PCR forward Biotin-CCTGAAGAAGTGGATACAGAAGG
 PCR reverse CAGTAGTATTACTGGCTCTTCCTGA
 Sequencing ACTGGGAGCATTGAG

Factor V Leiden PCR forward GGGCTAATAGGACTACTTCTAATC
(G1691A) PCR reverse Biotin-TCTCTTGAAGGAAATGCCCCATTA
 Sequencing AGCAGATCCCTGGAC

MTHFR C677T PCR forward TTGAGGCTGACCTGAAGCAC
 PCR reverse Biotin-5GTGATGCCCATGTCGGTG
 Sequencing GGTGTCTGCGGGAG

Factor XIII Val34Leu PCR forward AGCAGTTCCACCCAATAACTCT
 PCR reverse Biotin-TCATACCTTGCAGGTTGACG
 Sequencing CACAGTGGAGCTTCAG

MTHFR A1298C PCR forward GTGGCACTGCCCTCTGTC
 PCR reverse Biotin-CTCCCGAGAGGTAAAGAACGA
 Sequencing AGGAGTTGACCAGTGA

PAI-1 4G/5G PCR forward Biotin-GGCACAGAGAGAGTCTGGACAC
 PCR reverse CGCCTCCGATGATACACG
 Sequencing ACACGGCTGACTCCC
COPYRIGHT 2005 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Verri, Annalisa; Focher, Federico; Tettamanti, Guido; Grazioli, Vittorio
Publication:Clinical Chemistry
Date:Jul 1, 2005
Words:1875
Previous Article:Validating a rapid method for detecting common polymorphisms in the APOA5 Gene by melting curve analysis using LightTyper.
Next Article:Arrayed primer extension resequencing of mutations in the TP53 tumor suppressor gene: comparison with denaturing HPLC and direct sequencing.
Topics:


Related Articles
PYROSEQUENCING'S DNA TECHNOLOGY TO IDENTIFY TYPE 2 GENE.
World-Renowned Karolinska Institute Adopts Pyrosequencing (TM) Technology For Disease-Related Research.
Pyrosequencing Strenghtens Intellectual Property for Core Technology with Two New U.S. Patents Issued.
Genetic Technologies and Pyrosequencing Announce Strategic Licensing Agreement.
Access Genetics Adds HealthEast as Molecular Genetic Testing Customer.
Microarrays in clinical diagnosis.
Identify and capitalize on your lab's molecular potential.
Genetic thrombophilia, 'the pill' hike VTE risk.
Thrombophilia.
Pyrosequencing analysis of thrombosis-associated risk markers.

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters