Printer Friendly

Triptolide inhibits colon-rectal cancer cells proliferation by induction of G1 phase arrest through upregulation of p21.

ARTICLE INFO

Keywords:

Cell cycle

Colon-rectal cancer

Triptolide

Triprerygium wilfordii

p21

ABSTRACT

Triptolide, a diterpene triepoxide compound extracted from the traditional Chinese medicine herb Tripterygium wilfordii Hook F., is a potential cancer chemotherapeutic for tumors. However, the mechanism of anti-proliferative mechanism of triptolide in colon cancer cells is not entirely clear. Triptolide markedly inhibited HT29 and SW480 cells proliferation in a dose- and time-dependent manner. Triptolide decreased ERK and AKT phosphorylation, and GABPa expression in colon cancer cells. Beta-catenin expression and phosphorylation were not altered by incubation of triptolide. However, we found that triptolide repressed expression of LEF/TCF. Although it did not significantly affect cells apoptosis, triptolide induced GI phase arrest dose-dependently. Further detection for the expression of cell cycle-related proteins suggesting that triptolide stimulate expression of p21 and repress cyclin Al. Increased p21 binded to CDK4/CDK6, therefore blocked function of CDK4/CDK6. and subsequently contribute to the G1 arrest. These data suggested that triptolide is a potential agent for treatment of colon cancer, and its anti-proliferation effect mainly occur through G1 phase arrest.

[c] 2012 Elsevier GmbH. All rights reserved.

Introduction

Triptolide is a diterpene triepoxide compound (Fig. 1) extracted from the traditional Chinese medical herb Tripterygium wilfordii Hook F. As a traditional medicine, this herb has been used in the effective treatment of rheumatoid arthritis and lupus erythema-todes for centuries (Ding 1987). Recent reports show that triptolide has multiple bioactivities, including immunosuppression and anti-inflammation (Chen 2001). It also has antineoplastic activity (Pan 2010). Triptolide inhibits the in vitro proliferation of the multiple myeloma cell line U266 (Zhao et al. 2010), and suppresses angiogenesis in anaplastic thyroid carcinoma by targeting vascular endothelial cells (Zhu et al. 2010). Triptolide induces apoptosis in pancreatic tumor cell lines by suppressing 5-lipoxygenase (Zhou et al. 2007).

Our previous study demonstrated that triptolide inhibits colitis-related colon cancer progression by downregulating Racl and the JAK/STAT3 pathway (Wang et al. 2009). However, the mechanism by which triptolide inhibits proliferation in colon cancer cells is not entirely clear, so we explored the effect of triptolide on factors associated with different pathways in cell division regulation.

Cell cycle regulation is closely linked to cell proliferation, and one of the notable features of a tumor is abnormal cell cycle management. Proteins important in the cell cycle signaling network include CDK4 and CDK6. which are the primary heterodimeric partners of cyclin D1. Activation of cyclin D-CDK4/CDK6 is required for cell cycle progression through the G1/S checkpoint. p21 is a cyclin-dependent kinase (CDK) inhibitor that is crucial for cell cycle regulation. It binds to cyclin-CDK complexes to inhibit their catalytic activity and induce cell-cycle arrest (Coqueret 2003: Fukuchi et al. 2003). CDK2 is activated by cyclin A subunits, and cyclin A is critical for cell cycle control, primarily in the Gl and S phases (Furuno et al. 1999; Resnitzky et al. 1995).

The mitogen-activated protein kinases (MAPKs) regulate cell growth, division and death. The MAPK pathway is a cascade of phosphorylation events including RAF, MAP kinase kinase (MEK), and ERK (MAP kinase). RAF phosphorylates and activates both MEK1 and MEK2 on two distinct serine residues (Crews et al. 1992): activated MEK then phosphorylates ERK1 and ERK2 on tyrosine and threonine residues (Anderson et al. 1990).

Furthermore, MEK-ERK cascade has been well known to play a key role in cancer cell proliferation, and become a target for cancer treatment (Roberts and Der 2007). Whereas, AKT, after

In this study, we found that triptolide markedly inhibited the proliferation of colon cancer cells, and triptolide induced cell cycle Gl arrest, possibly by repressing the expression of cyclin Al and stimulating the expression of p21.

Materials and methods

Cell culture

Human colorectal cell lines FIT29 and SW480 were from American Type Culture Collection (ATCC, USA). Cells were cultured in RPMI-1640 (Hyclone, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Hyclone, USA), 1000/m1 penicillin and 100 U/ml streptomycin. Cells were kept in a humidified atmosphere with 5% [CO.sub.2] at 37 [degrees]C.

MIT assay

HT-29 and SW480 cells were plated in quintuplicate in 96-well plates (5 x [10.sup.3]/well). At 24 h after incubation, triptolide (pay-paytech, China) was added to a final concentration of 0, 1.5, 5, 15, 50, or 150 nM for 24, 48, or 72 h. 5-FU (dingguo, China) and Doxorobicin (Sigma, USA) were used as positive control at the concentration of 150 nM for 24, 48, or 7211. And 20 [micro]l of 5 mg/ml MTT (Sigma, USA) was added to each well for 4 h at 37 [degrees]C. Medium with MTT was removed and 150 [micro]l of dimethylsulfoxide added.The plate was shaken for 10 min until crystals were dissolved and measured on an enzyme-linked immunosorbent assay reader (Bio-RAD, USA), using a measurement wavelength of 490 nm.

BrdU incorporation assay

Cell proliferation was measured by the BrdU incorporation assay. SW480 and HT29 cells were seeded in 24-well plates, after incubation with or without triptolide at 0, 50, 150 nM for 24 h; 3 [micro]g/ml BrdU (Sigma, USA) was added and incubation continued for 4 h at 37 [degrees]C. Cells were fixed with 4% polyformaldehyde for 15 min at 37 [degrees]C and rinsed three times with TBS containing 0.1% Triton X-100, and blocked with 5% nonfat milk for 1 h at room temperature. Slides were incubated in 2 N HO for 30 min to denature DNA and rinsed for 5 min with 0.1 M [Na.sub.2][B.sub.4][O.sub.7] (pH 8.5) to neutralize the acid. Slides were covered with a 1:200 dilution of anti-BrdU MAb (Cell Signal, USA) in PBS containing 1% bovine serum albumin and 0.5% Tween 20 and left at 4 C overnight. Cells were incubated with a rhodamine (TRITC)-conjugated goat anti-mouse IgG (1:50 dilution, Jackson ImmunoResearch Laboratories, USA) secondary antibodies for 1 h at room temperature. Nuclei were stained with DAPI and evaluated by fluorescence microscopy (Olympus, Japan). Results were expressed as the percentage of BrdU-positive cells.

Cell cycle analysis

HT29 and SW480 cells were seeded in 6-well plates at 3 x [10.sup.5] cells per well, and incubated with triptolide at 0, 0.5, 5, or 50 nM for 2411 Cells were harvested by centrifugation and fixed with 75% ethanol. Fixed cells were incubated with propidium iodide at least 30 min. The DNA content of the cells was measured on a FACScan Cytometer (Becton Dickinson).

Western blot

HT29 and SW480 cells were incubated with triptolide at 0, 1.5, 5, 15, or 50 nM for 24h, then lysed with RIPA buffer (Beyotime, China) with protease inhibitor cocktail tablets (Complete Mini, EDTA free; Roche, Basel, Switzerland). Supernatants were collected and protein concentration determined with a BCA protein assay kit (Thermo Scientific, USA). Western blotting used standard protocols. Proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes that were blocked with 5% nonfat milk in TBS containing 0.1% Tween 20, and incubated with primary antibodies: p-MEK1(Ser298), p-MEK1/2(Ser217/221), p-ERK1/2(Thr202/Tyr204), p-AKT(Thr308), p-AKT(Ser473), beta-catenin, cyclin D1 (Cell Signaling Technology), p21, CDK2, p-CDK2 (Bioword, USA), CDK4, CDK6 (Epitomics, USA), cyclin Al, p53 (Millipore, USA), beta-actin (Beijing Biosynthesis Biotechnology, China). Secondary antibodies were coupled to horseradish peroxidase, and were goat antirabbit or goat anti-mouse. Development was with enhanced chemiluminescence reagents (Millipore, USA), and signals detected by a chemiluminescence detection system (Clinx Science Instrument, China).

Co-immunoprecipitation and immunoblotting

SW480 cells were incubated without or with 50 nM triptolide for 24h and harvested by scraping and lysing in lysis buffer containing protease inhibitor cocktail tablets (Complete Mini, EDTA free; Roche, Basel, Switzerland). Lysates were incubated with control antibody, anti-p21, or anti-CDK4 antibody overnight at 4 C with gentle vortexing. A protein-G agarose resin was added for 3h at 4 [degrees]C. After centrifugation, the protein-G agarose was washed five times with washing buffer. Loading buffer was added and the samples were boiled for 5 min, and analyzed by western blotting with anti-p21, anti-CDK4, or anti-CDK6 antibody.

qPCR

Cells were seeded and cultured for 24h, and treated with triptolide. After 24 h, cells were harvested and total RNA was isolated using Trizol (lnvitrogen Company, USA). RNA was reverse transcribed using a first-strand cDNA synthesis kit from Tiangen Corp (Beijing, China). RT-PCR was performed on an Applied Biosystems 7300 Real Time PER system using SYBR Green incorporation following standard protocols. [C.sub.t] values were calculated based on duplicates and normalized to the housekeeping gene cycA. Primers were Gabpa-F: CAGAA-CAAGTGACAAGATGG, Gabpa-R: GTTGAGTGTGGTGAGGTC; LEF1-F: phosphorylated at Ser473 and/or Thr 473, is activated and controlls cells survival and apoptosis (Alessi et al. 1996; Franke et al. 1995). The Wnt signaling pathway is one of the fundamental mechanisms that directs cell proliferation, cell polarity, and mutation. It has been linked to human birth defects, cancer, and other diseases (Bienz and Clevers 2000). The Wnt pathway functions by regulating the transcriptional coactivator [beta]-catenin, which controls key developmental gene expression programs (MacDonald et at. 2009).

ACCCTTCCAACTCTCCTTTC, LEF1-R: CGGCGGCTCTGTAATCTC; TCF7-F: ACCTTGTGGCTGTTCTGG, TCF7-R: TGGCTGATTCCTTGTCCTC.

Microarrays

RNA was analyzed by the Shanghai Biotechnology Corporation by hybridization to Agilent human 4 x 44k arrays (Affymetrix) using standard protocols.

Statistical analysis

All data are presented as meant [+ or -] standard deviation (SD). Statistical significance was determined by Student's t-test. P-values < 0.01 were considered significant. Analyses were performed using SPSS 11.0.

Results

Triptolide inhibits proliferation of colon cancer cells by ERK1/2 regulation

The anti-proliferative effect of triptolide (Fig. 1) was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazoliumbromide (MTT) assay and bromodeoxyuridine (BrdU) incorporation. Human colorectal cell lines HT29 and SW480 were treated with different triptolide concentrations for 24, 48, or 72h. The MTT assay (Fig. 2A), which assays cell viability, demonstrated that triptolide had a time- and dose-dependent effect on viability. Triptolide concentrations from 15 nM to 150 nM for 24h markedly inhibited tumor cell survival (p<0.01 vs. control). After treatment for 48 or 72, 1.5 nin triptolide also significantly inhibited tumor cell survival (p < 0,01 vs. control). Using the chemotherapy agents 5-fluorouracil (5-FU) and doxorubicin as positive controls for the anticancer efficiency of triptolide, we found that colon cancer cell survival was significantly lower after treatment with 150 nM triptolide for 24-72 h than after treatment with 150 nM 5-FU or doxorubicin (Fig. 2B). BrdU incorporation, an assay for active cell proliferation, showed that incubation with 150 nm triptolide for 24h resulted in significantly fewer BrdU-positive cells than incubation without triptolide (Fig. 2C).

To study the mechanism of cell proliferation inhibition, HT29 and SW480 cells were treated with 0, 1.5, 5, 15, or 50 nM triptolide for 24h and proliferation-regulating proteins were analyzed by western blotting. The results showed that phosphorylated ERK1/2 (p-ERK1/2) was decreased in both HT29 and SW480 cells compared to control, untreated cells. However, p-MEK1 and p-MEK1/2 levels were not changed, suggesting that triptolide regulated ERK1/2 but not p-MEK1 and p-MEK1/2. Phosphorylation of AKT on threonine (p-AKT[Thr308]) decreased in HT29 cells, and phosphorylation on serine (p-AKT[Ser473]) decreased in SW480 cells (Fig. 3A). The downstream target of ERK1/2 is the GA-binding protein encoded by the GABP[alpha] gene. Expression of this gene was measured by qPCR, which showed that triptolide suppressed GABP[alpha] expression (Fig. 3B).

Triptolide induced G1 arrest in H129 and SW480 colon cancer cells

To evaluate the effect of triptolide on the cell cycle. HT29 and SW480 cells were incubated with triptolide at 0, 0.5, 5, or 50 nm for 2411. Cell cycle determination by flow cytometry showed that triptolide treatment caused dose-dependent accumulation of HT29 and SW480 cells in the G1 phase relative to the control group (Fig. 4).

Triptolide regulated cell cycle and proliferation proteins

To investigate the mechanism of cell cycle arrest, western blotting was used to analyze cell cycle-related proteins. The results showed that triptolide upregulated p21 and downregulated cyclin Al in a dose-dependent manner. However, no significant change in the levels of CDK2 or p53 was noted after treatment with triptolide (Fig. 5). Using co-immunoprecipitation analysis, we assessed the effect of triptolide treatment on interaction between p21 and CDK4/CDK6, and found that 50 nM triptolide increased p21 association with CDK4 and CDK6 (Fig. 6).

In the Wnt pathway, [beta]-catenin regulates cell proliferation and differentiation by controlling downstream transcription factors such as LEF and TCF. HT29 and SW480 cells were incubated for 24h with a series of triptolide concentrations, then [beta]-catenin was detected by western blot. The results showed that triptolide had no effect on [beta]-catenin expression (Fig. 7A). However, qPCR showed that expression of the transcription factors LEF and TCF were repressed by triptolide (Fig. 7B).

Triptolide regulation of gene expression

To investigate other genes regulated by triptolide, microarrays were used to analyze gene expression. After incubating SW480 cells with 50 nM triptolide, genes expression was determined relative to untreated cells (Supplementary Tables 1 and 2). Genes whose expression changed more than twofold were analyzed. Triptolide downregulated the cell cycle-related genes E2F2 E2F3, E2F5, CDKN2C, CDK7, CDC23, and SMAD3; the MAPK signaling pathway genes FOS, CASP3, JUND, KRAS, MAP2K2; and the Wnt signaling pathway genes WNT4, MYC, and AXIN2. Genes in oxidative phosphorylation were upregulated, specifically ND1, ND6, ATP5E, ATP5F1, ATP6V1G2, ATP6V1G1, ATP6VOE2, ATP5L, COX11, COX15, COX7B, COX6C.

Discussion

Abnormal proliferation is a critical process underlying the formation of cancer. Triptolide has been identified as a major active compound in Tripterygium wilfordii Hook F. extracts, with potent anti-inflammatory and anticancer activity (Chan et al. 2001; Qiu et al. 1999; Yinjun et al. 2005). Triptolide inhibits the proliferation of HeLa and Caski cells (Kim et al. 2010). and in this study, we demonstrated that triptolide inhibited proliferation of colorectal cancer HT29 and SW480 cells in a dose- and time-dependent manner. We also investigated the mechanism underlying the anti-proliferation effect.

We found that triptolide inhibited the phosphorylation of ERK1/2 in HT29 and SW480 cells. However, the level of phosphorylation of MEK1 and MEK1/2 did not change, so triptolide might affect ERK1/2 activation directly. We detected a downstream ERK1/2 target, the GA-binding protein encoded by the GABP[alpha] gene. By qPCR, triptolide appeared to suppress GABP[alpha] expression. GABP[alpha] is an Ets transcription factor that controls gene expression in several important biological settings (Rosmarin et al. 2004). ERK1 and 2 phosphorylate and activate a variety of EN transcription factors (Coffer et al. 1994). Therefore, triptolide appeared to inhibit cell proliferation by suppression of GABP[alpha] through inhibition of ERK1/2 phosphorylation.

We also found that triptolide inhibited the activity of AKT by suppressing its phosphorylation on different sites. In HT29 cells, p-AKT(Thr308) decreased, but in SW480 cells, p-AKT(Ser473) decreased. Nevertheless, these phenomenon show that triptolide might act to inhibit proliferation of colon cancer cells through reduction of AKT phosphorylation.

We found that triptolide increased p21 expression and decreased cyclin Al expression. p21 is a well-characterized CDK inhibitor and a high level of p21 inhibits cyclin Dl expression, resulting in decline of pRb phosphorylation. p21 binds to G1 cyclin/CDK complexes, inhibiting DNA replication, and blocking transition from G1 to S phase (Coqueret 2003). However, we saw no significant changes in the expression of cyclin D1, CDK2, CDK4 or CDK6 after incubating colon cancer cells with triptolide for 24h. We analyzed the association of p21 and CDK4/CDK6. In SW480 cells, p21 did not bind to CDK4/CDK6; however, after incubation with 50 nM triptolide for 24 h, p21 association with CDK4/CDK6 was observed. Therefore, we propose that triptolide induced overexpression of p21 and promoted p21 competition with cyclin Dl binding to CDK4/CDK6, resulting in induction of G1 arrest.

Our study showed that triptolide did not effect the expression of [beta]-catenin. However, qPCR showed that expression of the transcription factor LEF/TCF was repressed after cells were incubated with 50 nM triptolide for 24h. How triptolide affects LEF/TCF requires further investigation.

In summary, triptolide markedly inhibited colon cancer cell proliferation. The proposed mechanism is inhibition of ERK1/2 activation, and induction of cell cycle arrest in G1 phase. This might be the result of the observed upregulation of p21 and downregulation of cyclin Al These results show that triptolide is a potential chemotherapeutic for colon cancer.

Conflict of interests

None.

Acknowledgements

This study is sponsored by National Natural Science Foundation of China (no. 81071689), pre-973 national basic research program (2010CB535002). Special Key New Drug Development Technology Project (2009ZX09103-113), Shaanxi Foundation of Technology (2010K14-02-07), Research Foundation for the Returned Overseas Scholars in Fourth Military Medical University.

Juanjuan Liu designed the study, collected the data and conducted some of the experiments. Min Shen and Zhenggang Yue planned and coordinated the experiments. Zhifu Yang and Meng Wang carried out the molecular biology experiments. Chen Li and Chunyan Xin carried out the cell biology and animal experiments. Yukun Wang analyzed the data. Qibing Mei and Zhipeng Wang planned and oversaw the research project and drafted the paper.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2012.02.014.

References

Alessi, DR, Andjelkovic, M., Caudwell, B., Cron. P., Morrice, N., Cohen. P., Hemmings, B.A., 1996. Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15. 6541-6551.

Anderson. N.G., Mailer. J.L., Tonks, N.K., Sturgill, T.W., 1990. Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase. Nature 343. 651-653.

Bienz, M., Clevers, H., 2000. Linking colorectal cancer to Wnt signaling. Cell 103, 311-320.

Chan, E.W., Cheng, S.C., Sin, F.W., Xie, Y., 2001. Triptolide induced cytotoxic effects on human promyelocytic leukemia, T cell lymphoma and human hepatocellular carcinoma cell lines. Toxicol. Lett. 122, 81-87.

Chen. BJ., 2001. Triptolide. a novel immunosuppressive and anti-inflammatory agent purified from a Chinese herb Tripterygium wilfordii Hook F. Leuk. Lymphoma 42, 253-265.

Coffer. P., de Jonge. M.. Mettouchi. A., Binetruy, B., Ghysdael, J., Kruijer, W., 1994. junB promoter regulation: Ras mediated transactivation by c-Ets-1 and c-Ets-2. Oncogene 9.911-921.

Coqueret. O., 2003. New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol. 13, 65-70.

Crews, CM., Alessandrini, A.. Erikson, R.L., 1992. The primary structure of MEK, a protein kinase that phosphorylates the ERK gene product. Science 258, 478-480.

Ding, G.S., 1987. Important Chinese herbal remedies. Clin. Ther. 9, 345-357.

Franke, T.F., Yang, S.I., Chan, T.O., Datta, K., Kazlauskas, A., Morrison, D.K., Kaplan, D.R., Tsichlis, P.N., 1995. The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell 81. 727-736.

Fukuchi, K., Nakamura, K., Ichimura, S., Tatsumi. K., Gomi, K.. 2003. The association of cyclin A and cyclin kinase inhibitor p21 in response to gamma-irradiation requires the CDK2 binding region, but not the Cy motif. Biochim. Biophys. Acta 1642, 163-171.

Furuno. N., den Elzen. N.. Pines, J., 1999. Human cyclin A is required for mitosis until mid prophase. J. Cell Biol. 147, 295-306.

Kim, M.J., Lee, T.H., Kim, S.H., Choi, Y.J., Heo. J., Kim, Y.H., 2010. Triptolide inactivates Akt and induces caspase-dependent death in cervical cancer cells via the mitochondria' pathway. Int. J. Oncol. 37. 1177-1185.

MacDonald, B.T., Tamai. K., He. X., 2009. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev. Cell 17, 9-26.

Pan. J., 2010. RNA polymerase -an important molecular target of triptolide in cancer cells. Cancer Lett. 292, 149-152.

Qiu, D., Zhao, G., Aoki, Y., Shi, L., Uyei, A., Nazarian, S., Ng. J.C., Kao, P.N., 1999. Immunosuppressant PG490 (triptolide) inhibits T-cell interleukin-2 expression at the level of purine-box/nuclear factor of activated T-cells and NF-kappaB transcriptional activation. J. Biol. Chem. 274. 13443-13450.

Resnitzky. D., Hengst, I., Reed, S.I., 1995. Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol. Cell. Biol. 15, 4347-4352.

Roberts, P.J., Der, C.J., 2007. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 26, 3291-3310.

Rosmarin, A.G., Resendes, K.K., Yang, Z., McMillan, J.N., Fleming. S.L., 2004. GA-binding protein transcription factor: a review of GASP as an integrator of intracellular signaling and protein-protein interactions. Blood Cells Mol. Dis. 32, 143-154.

Wang. Z., Jin, H., Xu, R., Mei, Q., Fan, D., 2009. Triptolide downregulates Racl and the JAK/STAT3 pathway and inhibits colitis-related colon cancer progression. Exp. Mol. Med. 41, 717-727.

Yinjun, L., Jie, J., Yungui, W., 2005. Triptolide inhibits transcription factor NF-kappaB and induces apoptosis of multiple myeloma cells. Leuk. Res. 29. 99-105.

Zhao, F., Chen, Y., Zeng, L.L., Li, R., Zeng, R., Wen. L., Liu, Y., Zhang, C., 2010. Effects of triptolide on RIZ1 expression, proliferation, and apoptosis in multiple myeloma U266 cells. Acta Pharmacol. Sin. 31. 733-740.

Zhou, C.X., Ding. X.L., Huang. J.F., Zhang. H., Wu. S.B., 2007. Suppression of 5-lipoxygenase gene is involved in triptolide-induced apoptosis in pancreatic tumor cell lines. Biochim. Biophys. Acta 1770, 1021-1027.

Zhu, W., He. S., Li. Y., Qin, P., Shu, M., Ou, Y., Zhou, Y., Leng. T., Xie, J., Zheng, X., et al., 2010. Anti-angiogenic activity of triptolide in anaplastic thyroid carcinoma is mediated by targeting vascular endothelial and tumor cells. Vascul. Pharmacol. 52, 46-54.

Juanjuan Liu (a), (1), Min Shen (b), (1) Zhenggang Yue, (a) Zhifu Yang (c), Meng Wang (a), Chen Li (a), Chunyan Xin (a), Yukun Wang (a), Qibing Mei (a), Zhipeng Wang (a), *

(a) Key Laboratory of Gastrointestinal Pharmacology of Chinese Materia Medico of the State Administration of Traditional Chinese Medicine, Department of Pharmacology, School of Pharmacy. Fourth Military Medical University. Xi'an. China

(b) Department of Cardiovascular Diseases, Xijing Hospital. Fourth Military Medical University. Xi'an, China

(c) Department of Pharmaceutics, Tangdu Hospital. Fourth Military Medical University. Xi'an. China

* Corresponding author. Tel.: +86 29 84774555: fax: +86 29 84779212. E-mail address: zhipengw@fmmu.edu.cn (Z. Wang).

(1.) These authors contributed equally to this work.

0944-7113/$--see front matter [c] 2012 Elsevier GmbH. All rights reserved.

doi: 10.1016/j.phymed.2012.02.014
COPYRIGHT 2012 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Liu, Juanjuan; Shen, Min; Yue, Zhenggang; Yang, Zhifu; Wang, Meng; Li, Chen; Xin, Chunyan; Wang, Yuk
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Jun 15, 2012
Words:3699
Previous Article:In vitro and in vivo inhibition of streptococcus mutans biofilm by Trachyspermum ammi seeds: an approach of alternative medicine.
Next Article:Anethole suppressed cell survival and induced apoptosis in human breast cancer cells independent of estrogen receptor status.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters