Printer Friendly

Transgenic cell lines inducing the RNA interference pathway are resistant to EIAV infection.

Abstract.--Equine Infectious Anemia Virus (EIAV) is a simple, macrophage-tropic lentivirus that infects members of the family Equidae. Although this virus has been studied extensively, there is still no method for prevention or treatment of this disease. Thus, RNA interference was utilized as an alternative approach to controlling the spread of this disease and to further investigate the mechanism of viral replication in vitro. Multiple short hairpin RNAs (shRNAs) were designed to target various critical regions of the EIAV genome. Each shRNA was inserted into a HIV-based lentiviral transfer vector pseudotyped with the Vesicular Stomatitis Virus Glycoprotein. These vectors were used to establish transgenic shRNA-expressing cell lines which were subsequently exposed to EIAV. Control cell lines included a non-transgenic control and a transgenic control expressing a shRNA targeting luciferase. Viral infection and replication was then determined by reverse transcriptase (RT) assays. Unexpectedly, all transgenic cell lines (including the non-targeting control) were resistant to viral infection, with RT levels up to 197 times lower in transgenic cells than that observed in non-transgenic cells. Therefore, expression of the primary receptor for EIAV entry, Equine Lentiviral Receptor 1 (ELR1), was evaluated using Real Time PCR. The results showed that ELR1 mRNA was present in both transgenic and non-transgenic cells with mean critical threshold (Or) values of 32.87 and 38.50, respectively. Many lentiviruses, including EIAV and HIV, have mechanisms to prevent superinfection which is often cytotoxic. These cell lines represent a unique tool for future studies of novel mechanisms for preventing superinfection by lentiviruses.

Equine Infectious Anemia (EIA) has been a worldwide plague on the horse industry for well over a century (Leroux et al. 2004). Members of the family Equidae are the only known natural reservoir of Equine Infectious Anemia Virus (EIAV) (Issel et al. 1990). In a classic horse infection, initial exposure results in acute disease which is characterized by fever, anemia, oedema, thrombocytopenia and various wasting symptoms which can be lethal but in many cases subside within a few days (Leroux et al. 2004). In some animals these clinical signs may be so mild that they are overlooked completely while in others they may be fatal (Leroux et al. 2004). Surviving animals may progress into the chronic phase which is characterized by recurring cycles of clinical symptoms (Leroux et al. 2004). Infected animals may eventually become asymptomatic carriers which still pose a threat to naive equines (Leroux et al. 2004). These horses appear healthy, but continue to produce the virus, which undergoes constant mutation of the envelope proteins to avoid the host immune response (Craigo et al. 2006).

The fate of horses that survive the infection and test positive for EIA is quite grim, as their owners have two options: 1) Quarantine the horse and keep it a minimum distance of 200 yards from any other equine species; 2) Euthanasia of the horse (United States Department of Agriculture Animal and Plant Health Inspection Service (USDA APHIS) 2007a). Developed in 1970, the Coggins test remains the primary method of testing horses for EIA. Since 1972, the USDA has reported that over 100,000 horses have produced a positive Coggins test. The majority of these horses originate in states with warm, humid climates, where the transmission vector thrives (USDA APHIS 2006). In a typical calendar year, Texas will identify more EIAV positive horses than any other state, usually making up 20% of the positive cases for the entire United States (USDA APHIS 2011).

Although the percentage of positive cases has steadily declined in the US, an outbreak of EIA in Ireland in 2006, an outbreak in Arkansas in 2011, and continued EIA positive horses in the US underscores the fact that the current method of testing and elimination of positive horses has been ineffective at eradicating this disease from the equine population both here and abroad (More et al. 2008, USDA APHIS 2011). One reason that EIAV persists in the equine population is because many horse owners elect not to test the horses in their herd. In fact, usually less than 40% of horses in the US are tested in a given year (USDA APHIS 2007b).

EIAV follows the typical lentiviral life cycle and has striking structural similarities to other retroviruses such as HIV (Saenz et al. 2005). However, EIAV differs from other retroviruses in its early cyclic nature and in that it lapses into a long term asymptomatic phase while continuing to replicate and evolve within the host rather than culminate in the death of its host (Stump & VandeWoude 2007). Therefore, research into how to prevent or reduce replication of EIAV could have far-reaching implications, not only for equine health, but for understanding retroviruses, such as HIV-1, that affect human health as well.

RNA interference (RNAi) is one technique being explored by many to prevent or reduce viral replication and translation in host animal cells. The effects of RNAi are being studied in viruses such as EIAV, HIV-1, Hepatitis-C virus, Influenza-A virus, poliovirus, rotavirus, papillomavirus and respiratory syncytial virus with varying degrees of success reported (Saksela 2003). In 1998, it was discovered that RNAi could be induced in Caenorhabditis elegans to decrease the expression of specific genes (Fire et al. 1998). Since then, RNAi has been used extensively in the elucidation of functional analysis of genes and in therapeutic applications, including antiviral therapies.

RNAi is a process that ultimately reduces the expression of a given gene by preventing messenger RNA (mRNA) from being translated into a protein. The pathway is initiated when double stranded RNA (dsRNA) is recognized by the nuclease Dicer and is cleaved into small interfering RNAs (siRNAs) of approximately 20 nucleotides. These siRNAs then activate the RNA-induced silencing complex (RISC), which targets specific mRNAs for silencing based on their homology to the si RNA (Brummelkamp et al. 2002, Paddison & Hannon 2003). Other research has demonstrated that expression constructs harboring 19-29 nt inverted repeats which form short dsRNA hairpins (shRNAs) elicit an effect similar to siRNAs (Brummelkamp et al. 2002; Paddison & Hannon 2003). Therefore, 'classical' DNA expression vectors can now be utilized to deliver and express genes encoding shRNAs, in both cell lines and whole animals, to inhibit the production of specific proteins.

This study utilized self-inactivating lentiviral vectors to establish transgenic fetal equine kidney (FEK) cell lines expressing shRNAs that target essential EIAV genes. The genes selected for this study are gag, pol, rev, S2, and env (Table 1). The gag gene was selected as it is essential for viral DNA integration into the host genome and viral assembly (Chen et al. 2001, Leroux et al. 2004, Jin et al. 2005). Successful viral replication and integration into the host is also dependent on the expression of the pol gene products (Shao et al. 1997, Leroux et al. 2004). These genes were also of interest to this study, as they are transcribed as a single message; shRNAs were designed to target this overlapping region (GP1 and GP2) (Fig. 1). EIAV contains few accessory proteins including rev and S2. The product of the rev gene is essential for mRNA transport and thus expression of structural proteins (Leroux et al. 2004, Carpenter & Dobbs 2010). Although S2 is not required for viral infection, mutated S2 prevents clinical disease in vivo (Fagerness et al. 2006). Interestingly, S2 is transcribed as a single message with tat and env (tricistronic message) or alternatively in a bicistronic message with env alone (Fig. 1). If shRNAs are incorporated to the S2 aspect of the message, the entire message will be destroyed. shRNAs were also designed to target the overlapping region of S2, env, and rev (SER1 and SER2) (Fig. 1).

The initial goal of this research was to identify shRNA-expressing constructs that would render transgenic FEK cell lines resistant to EIAV infection. To that end, seven transgenic FEK cell lines were established and subsequently exposed to a laboratory strain of the virus ([EIAV.sub.19]). Interestingly, all transgenic cell lines (including the non-targeting control cell line) were equally and considerably resistant to infection by [EIAV.sub.19]. These results did not allow for the identification of individual shRNAs which might be decreasing expression of essential viral genes, but indicated that another mechanism was activated that effectively prevented viral infection in these transgenic cell lines. Thus, the primary receptor for EIAV, Equine Lentivirus Receptor 1 (ELR1) was evaluated using Real Time PCR.

[FIGURE 1 OMITTED]

MATERIALS & METHODS

Establishment of Primary Fetal Equine Kidney Cell Lines.--A naive FEK cell line was established from kidney tissue harvested from a male horse fetus. Sections of kidney measuring approximately 1 [cm.sup.3] were minced with a sterile razorblade and transferred to a conical tube containing 8 ml of a 1 x trypsin solution in phosphate buffered saline without calcium and magnesium. The tissue was subsequently incubated in this solution at room temperature for 10 min. The samples were then centrifuged at 300 x g for 3 min at room temperature and re-suspended in 10 ml of Complete Medium consisting of sodium bicarbonate-supplemented Dulbecco's Modified Eagle Medium (DMEM) with 10% Fetal Bovine Serum (FBS) and 0.05 mg/ml gentamicin, then transferred to 75 [cm.sup.2] cell culture flasks. The cells were incubated at 37 [degrees]C, 5% C[O.sub.2]. Culture media was refreshed every two days and cells were collected and cryogenically preserved for future use.

Cloning shRNA expression constructs into lentiviral transfer plasmids.--The EIAV genes targeted in this study included gag, pol, S2, env and rev. Seven shRNA-expressing constructs were designed using RNAi Central shRNA retriever (http://cancan.cshl.edu/RNAi_central/RNAi.cgi?type=shRNA) to target these essential viral genes and oligonucleotides were constructed by Integrated DNA Technologies (IDT Coralville, IA) (Table 1).

These shRNA oligonucleotides were directionally cloned into the transfer plasmid as described by (Golding et al. 2006). Specifically, each oligonucleotide was amplified via PCR utilizing the Pfx50 kit (Invitrogen Carlsbad, CA) to add XhoI and EcoRI restriction enzyme recognition sites to the 5' and 3' ends, respectively. Cycling conditions were 30 sec at 95 [degrees]C, 30 sec at 55 [degrees]C, 30 sec at 68 [degrees]C, with the cycle repeated 30 times. The PCR products were visualized by 1.2 % agarose gel electrophoresis and purified with a Qiagen PCR clean-up kit (Qiagen Valencia, CA). The products were then ligated into the XhoI and EcoRI sites of a previously linearized transfer vector using a Quick Ligation Kit (New England Biolabs Ipswich, MA). The resulting plasmids were used to transform One Shot[R] Stbl3[TM] Chemically Competent E. coli (Invitrogen Carlsbad, CA) and sequence analysis was used to verify the insert.

Production of the lentivir[alpha]l vector.--Once the shRNA-expressing lentiviral transfer plasmids were constructed and verified by sequence analysis, they were used to produce a self-inactivating, infectious lentiviral vector to deliver the shRNA-expressing construct to FEK cell lines. In addition to the EIAV targeting shRNAs, a transfer plasmid carrying a shRNA targeting the luciferase gene was also used to construct a lentiviral vector to generate a cell line to serve as the transgenic non-targeting control. Production of lentiviral vectors was accomplished by co-transfecting three plasmids: the shRNA-expressing transfer plasmid, the pMDG plasmid (expressing the Vesicular Stomatitis Virus Glycoprotein) and the pCMVA 8.2 plasmid (an HIV-1 derived packaging construct), into Human Embryonic Kidney (HEK) 293T cells (ATCC # CRL-11268) (Naldini et al. 1996). Transfection of the three plasmids into the HEK 293T cells was facilitated using a calcium phosphate transfection procedure as described previously (Golding etal. 2010). Importantly, the transfer plasmid (Fig. 2) also harbors a neomycin resistance gene and a red fluorescent protein (dsRed) gene which allows for the identification and selection of transgenic cells.

[FIGURE 2 OMITTED]

The supernatant, containing lentiviral particles, was collected 72 hr post-transfection via aspiration and was centrifuged at 300 x g for 3 min at room temperature, then filtered through a 0.45 [micro]m cellulose acetate membrane to remove cellular debris.

Establishment of Transgenic Fetal Equine Kidney cell lines.--FEK cells were thawed and cultured to achieve 80% confluency at the time of exposure to the lentiviral vector. Prior to infection, 8 [micro]g/ml polybrene was added to the viral-containing media to enhance transduction efficiency (Davis et al. 2002). FEK cells were lifted and centrifuged at 300 x g for 3 min at room temperature, the supernatant discarded, and resuspended in 2 ml of viral media containing polybrene. These cells were then plated in 25 [cm.sup.2] cell culture flasks and incubated for 24 hr at 37 [degrees]C, 5% C[O.sub.2], thus exposing the FEK cells to the lentiviral vector. After 24 hr of exposure, the viral media was replaced with complete media and allowed to incubate undisturbed for approximately 72 hr at 37 [degrees]C, 5% C[O.sub.2]. Transgenic cells expressed dsRed fluorescent protein and thus were identified via fluorescence microscopy 72 hr post-transduction. The transgenic cells also express neomycin-resistance; therefore, cultures showing more than ~40% transgenic cells were exposed to G418 (0.5 [micro]g/ml), a neomycin analog, as a means to establish cell lines which were 100% transgenic.

Exposure to [EIAV.sub.19] and RT Analysis.--Once these transgenic cell lines were established, they were exposed to the laboratory strain of the virus ([EIAV.sub.19]), as was a non-transgenic FEK control cell line. The viral strain used in these studies was derived from a molecular clone (pSPeiavl9) and is a culture adapted virus which replicates efficiently in several cell lines, including primary FEKs (Payne et al. 1998). While this virus replicates in vitro, it does not cause disease in vivo, even when administered in high doses (Payne et al. 1998); thus, all work was conducted at BSL2. Following exposure to [EIAV.sub.19], cultures were examined for the presence of viral particles. Supernatants were collected at 11 and 21 days post-infection and were tested for the presence of reverse transcriptase (RT) as described previously (Gregersen et al. 1988), using [[.sup.3]H]TTP in place of [[.sup.32][beta]P]TTP.

Real Time PCR of ELR1.--Transgenic (Pol2-targeting shRNA) and non-transgenic FEK cells were grown in tissue culture conditions as described above. Approximately 1 x [10.sup.6] cells were harvested from each culture for total RNA extraction using a Qiagen RNeasy kit (Qiagen, Valencia, CA) as recommended by the manufacturer. Within 24 hr, the RNA was quantified and Real Time PCR was completed. Quantification of the RNA was performed using a Nanovue Plus spectrometer (GE, Pittsburgh, PA). Final concentrations were adjusted to 20 ng/ul for use in Real Time PCR to determine the presence of ELR1 mRNA.

Real Time PCR reactions were completed using iScript[TM] One-Step RT-PCR Kit with SYBR[R] Green (Bio-Rad, Hercules, CA). Each reaction contained 20 ng of total RNA and reaction components according to the manufacturer's instructions. ELR1-specific primers were as follows: ELR1-Forward [5' - GGA CCG AGT GCA GCG GCC TCT TTG AG - 3'] and ELR1-Reverse [5' - CGG ACG CAG CCA GGG ATT TCT CAG ATG - 3'] as described by Zhang and colleagues (2005). Cycling conditions were carried out in a BioRad CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) as follows: 50 [degrees]C for 10 min for reverse transcription, 95 [degrees]C for 5 min to inactivate reverse transcription, followed by 40 cycles of 95 [degrees]C for 10 sec and 58 [degrees]C for 30 sec.

RESULTS & DISCUSSION

Cloning shRNA expression constructs into lentiviral transfer plasmids.--A total of eight shRNA expression constructs were amplified and EcoRI and XhoI restriction sites were added to the 3' and 5' ends, respectively. The resulting 110 bp fragment was then directionally cloned into the lentiviral transfer plasmid and could be recovered by digesting plasmid DNA with EcoRI and XhoI (Fig. 3). Samples positive for the insert were sequenced to verify the directionality and identity of the shRNA-expressing construct.

Production of lentiviral vectors.--Each of the eight shRNA-expressing transfer plasmids was used to generate self-inactivating lentiviral vectors. This required the co-transfection of HEK293T cells with each transfer plasmid and the packaging and envelope plasmids described above. Following the transfection procedure, cells were monitored and observed with fluorescent microscopy on a daily basis. Cultures in which at least 80% of cells expressed the dsRed fluorescent protein were considered successful. From these successful cultures, lentiviral particles were harvested and used to generate transgenic FEK cell lines.

Establishment of Transgenic Fetal Equine Kidney cell lines.--Prior to constructing transgenic cells, a primary FEK cell line was established from a male horse fetus. The cells were cultured from kidney tissue and exhibited the morphology characteristic of fibroblast cells. These cells served as the naive FEK cells for this and other studies of EIAV. The cells were exposed to the lentiviral vectors prior to the 5th passage in culture to ensure that the cell lines could be maintained for the duration of the study. Transgenic cells expressed the dsRed fluorescent protein, and cultures with at least 40% transgenic cells were exposed to G418, a neomycin analog, in order to eliminate non-transgenic cells.

[FIGURE 3 OMITTED]

Exposure of transgenic cells to [EIAV.sub.19].--Eight transgenic FEK cell lines were exposed to [EIAV.sub.19], seven of which contained shRNA-expressing constructs designed to target essential EIAV genes and one shRNA-expressing construct targeted luciferase to serve as a transgenic control. In addition, a non-transgenic FEK cell line was also exposed. Following exposure, media supernatant was collected 11 and 21 days post infection and RT assays were completed to evaluate which, if any, cell lines were resistant to EIAV infection (Fig. 4). RT Assays quantify the active reverse transcriptase molecules present in the supernatant as a measure of viral propagation within the cells, thus cells that are resistant to infection will have lower RT values. Radioactive nucleotides are incorporated into the cDNA and measurements are made with a scintillation counter. On day 11 it was obvious that the non-transgenic cells had been successfully infected by [EIAV.sub.19] with an RT value of 42,339 CPM/ml compared to the 297 CPM/ml of uninfected FEKs. However, when the RT values of the transgenic cells were compared to these values, it was evident that they had not been successfully infected with values ranging from 165 CPM/ml (below the value of uninfected cells) to only 1,716 CPM/ml (nearly 25 times lower than the non-transgenic cells). These considerably lower values also included the non-targeting transgenic cell line with a measurement equivalent to background. The infected cells were evaluated again at day 21 and again all transgenic cells had values far lower than expected, ranging from 495 CPM/ml to 2,145 CPM/ml. These values are 197 to 46 times lower than the non-transgenic cells, which measured 97,713 CPM/ml. Interestingly, the Pol2 cell line exhibited higher RT values than all other cell lines; however, when compared to the non-transgenic cells, these values were greatly reduced and did not double in value on day 21.
Figure 4. RT Assay values (in counts per minute per milliliter) 11 and
21 days post infection (p.i.) for transgenic (labels indicate shRNA)
and non-transgenic (Non-Tg) FEK cell lines. Values shown are averages
based on triplicate repeats.

                    11 days p.i.  21 days p.i.

Non-Tg, Uninfected     297
Non-Tg              42,339        97713
Luciferase               0          627
Pol2                  1716         2145
GP1                    165          528
GP2                    165          792
SER1                   495          627
SER2                   429          726
Rev2                   264          759
S2.2                   297          495

Note: Table made from bar graph.


Real Time PCR of ELR1.--Real Time PCR was conducted on non-transgenic and transgenic (Pol2 shRNA expression construct) FEK cells. The results of these experiments showed that mRNA coding for ELR1 was present in both transgenic and non-transgenic cells with mean critical threshold ([C.sub.T]) values of 32.87 and 38.50, respectively.

The goal of this investigation was to render naive FEK cells resistant to infection by [EIAV.sub.19] in vitro. The expected outcomes were that some transgenic cell lines expressing shRNAs targeting essential viral genes would be resistant to infection and that the cell line expressing a shRNA targeting luciferase would show a similar susceptibility to infection as observed in non-transgenic FEK cell lines. However, all transgenic cell lines, including the transgenic control, exhibited resistance to [EIAV.sub.19] infection in vitro. Although the transgenic cells containing the Pol2 construct showed some reverse transcriptase activity, the RT values are 25 and 46 times lower when compared to the non-transgenic controls indicating that these cells were not successfully infected. One possible explanation for this observation could be that a small number of non-transgenic cells were present in this particular culture.

The primary means for EIAV entry into equine cells is via the ELR-1 receptor (Zhang et al. 2005). Upon infection by most strains of EIAV, host cells gain a resistance to superinfection, infection of a single cell by the same or similar virus (Maury et al. 2003). Studies have been conducted where RNAi has been utilized to inhibit expression of ELR-1 and showed a significant reduction in, but not elimination of, EIAV entry into naive cells (Brindley et al. 2008). This work also showed that receptor masking by the EIAV surface protein, SU, is responsible for superinfection resistance (Brindley et al. 2008). However, it was also shown that when psuedotyped with VSV-G, the virus did not rely on ELR-1 for cell entry (Brindley et al. 2008).

During the investigation, we attempted to elucidate the mechanisms responsible for resistance to infection in transgenic FEK cell lines. To that end, expression of the receptor ELR-1 was evaluated using Real Time PCR, and found that the mRNA coding for this receptor is present in both transgenic and non-transgenic cells. These results indicate that there are other, yet unknown factors responsible for the observed resistance to infection.

The naive FEK cells were not resistant to lentiviral infection in general, as evidenced by our ability to transduce them with an HIV-based lentiviral vector. These vectors were pseudotyped with VSV-G, therefore likely not utilizing ELR-1 as a primary means of entry (Brindley et al. 2008). They are derived from HIV and do not express the EIAV SU protein responsible for preventing EIAV superinfection. Superinfection is also prevented in HIV infections, as a result of the Nef and Vpu proteins (Lindwasser et al. 2007). The Nef protein is responsible for internalization and degradation of existing CD4 receptors in the early stages of infection while Vpu functions to prevent CD4 receptors from reaching the cell surface in the late stage of infection (Lindwasser et al. 2007). However, these proteins are absent from the HIV-based vector utilized in this study.

Future studies utilizing RNAi to inhibit EIAV infection of naive cells could employ the use of superinfecting strains with the ability to infect these transgenic cells that are resistant to [EIAV.sub.19]. While these studies could give insight to shRNA-expressing constructs that are effective at inhibiting the EIAV life cycle, they would still need to be further tested on the more common viral strains.

In order to further explore the effectiveness of specific shRNAs at inhibiting viral activity, the mechanisms behind the resistance to infection observed in this study must be further understood. Studies should be conducted to determine whether the receptor ELR-1 is present on the surface of the transgenic FEK cells, and if so, whether any receptors on the cell surface are bound by proteins that are functioning similarly to the EIAV SU protein.

In conclusion, all transgenic cell lines created using the lentiviral vector described here, including the non-targeting transgenic control, were found to be resistant to infection by [EIAV.sub.19]. These cells were evaluated for the presence of the ELR-1 mRNA and both transgenic and non-transgenic cells expressed this mRNA; thus a decrease in expression of the mRNA which codes for the cellular receptor is not responsible for the observed resistance to infection.

Further possibilities for this observed phenomenon might lie in the process of creating transgenic cell lines. For instance, there could be unknown effects of the exposure to G418 or polybrene which were only present in the transgenic cell lines. Neomycin and similar drugs have been shown to inhibit viral activity; however, these studies have not shown long-lasting effects (Langeland et al. 1987, Lobert et al. 1996). Polybrene has been discovered to have long-lasting effects on cell proliferation in some cell types when used during lentiviral transduction, thus the effects it may have in these cell lines will be evaluated (Lin et al. 2011).

These transgenic cells were created using a self-inactivating, recombinant lentivirus with components from HIV and VSV. These results were surprising but may result in an opportunity to further our knowledge of the mechanisms involved in resistance to viral superinfection.

ACKNOWLEDGMENTS

The authors would like to acknowledge the contributions of students who participated in this project including Alex Goodman, Meredith Maloney, Pamela Newton, Shelby Pearman and Kim Tessanne. The authors especially thank Dr. Susan Payne for providing materials and invaluable assistance in working with [EIAV.sub.19].

LITERATURE CITED

Brindley M. A., B. Zhang, R. C. Montelaro & W. Maury. 2008. An equine infectious anemia virus variant superinfects cells through novel receptor interactions. J. Virol. 82(19):9425-9432.

Brummelkamp T. R., R. Bernards & R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296(5567):550-3.

Carpenter S. & D. Dobbs. 2010. Molecular and biological characterization of equine infectious anemia virus Rev. Curr HIV Res. 8(1):97-93.

Chen C., F. Li, & R. C Montelaro. 2001. Functional roles of equine infectious anemia virus Gag p9 in viral budding and infection. J Virol. 75(20):9762-9770.

Craigo J. K., T. J. Sturgeon, S. J. Cook, C. J. Issel, C. Leroux & R. C. Montelaro. 2006. Apparent elimination of EIAV ancestral species in a long-term inapparent carrier. Virol. 344:340-353.

Davis H. E., J. R. Morgan & M. L. Yarmush. 2002. Polybrene increases retrovirus gene transfer efficiency by enhancing receptor-independent virus adsorption on target cell membranes. Biophys Chem. 97(2-3): 159-72.

Fagerness A.J., M. T. Flaherty, S. T. Perry, B. Jia, S. L. Payne and F. J. Fuller. 2006. The S2 accessory gene of equine infectious anemia virus is essential for expression of disease in ponies. Virol. 349:22-30.

Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, & C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.

Golding M. C., C. R. Long, M. A. Carmell, G. J. Hannon, & M. E. Westhusin. 2006. Suppression of prion protein in livestock by RNA interference. PNAS 103(14):5285-5290.

Golding M. C., L. Zhang & M. R. Mann. 2010. Multiple epigenetic modifiers induce aggressive viral extinction in extraembryonic endoderm stem cells. Cell Stem Cell 6(5):457-467.

Gregersen J. P., H. Wege, L. Preiss & K. D. Jentsch. 1988. Detection of human immunodeficiency virus and other retroviruses in cell culture supernatants by a reverse transcriptase microassay. J. Virol. Methods 19(2): 161-8.

Issel C. J., J. M. McManus, S. D. Hagius, L. D. Foil, W. V. Adams, Jr., & R. C. Montelaro. 1990. Equine infectious anemia: prospects for control. Dev. Biol. Stand. 72:49-57.

Jin S., C. Chen, & R. C. Montelaro. 2005. Equine infectious anemia virus gag p9 function in early steps of virus infection and provirus production. J Virol. 79(14):8793-8801.

Katzourakis A., M. Tristem, O. G. Pybus & R. J. Gifford. 2007. Discovery and analysis of the first endogenous lentivirus. PNAS 104(15):6261-6265.

Langeland N., H. Holmsen, J. R. Lillehaug, & L. Haarr. 1987. Evidence that Neomycin inhibits binding of Herpes Simplex Virus Type 1 to the Cellular Receptor. J. Virol. 61(11):3388-3393.

Leroux, C., J. Cadore & R. C. Montelaro. 2004. Equine infectious anemia virus (EIAV): what has HIV's country cousin got to tell us? Vet. Res. 35:485-512.

Lin P., D. Correa, Y. Lin & A. Caplan. 2011. Polybrene inhibits human mesenchymal stem cell proliferation during lentiviral transduction. PLoS One 6(8):e23891.

Lindwasser O. W., R. Chaudhuri & J. S. Bonifacino. 2007. Mechanisms of CD4 downregulation by the Nef and Vpu proteins of primate immunodeficiency viruses. Curr. Mol. Med. 7(2): 171-184.

Lobert P.E., D. Hober, A. S. Delannoy & P. Wattre. 1996. Evidence that neomycin inhibits human cytomegalovirus infection in fibroblasts. Arch. Virol. 141:1453-1462.

Maury W., P. J. Wright & S. Bradley. 2003. Characterization of a cytolytic strain of equine infectious anemia virus. J Virol. 77(4):2385-2399.

More S. J., I. Aznar, D. C. Bailey, J. F. Larkin, D. P. Leadon, P. Lenihan, B. Flaherty, U. Fogarty & P. Brangan. 2008. An outbreak of equine infectious anaemia in Ireland during 2006: investigation methodology, initial source of infection, diagnosis and clinical presentation, modes of transmission and spread in the Meath cluster. Equine Vet J. 40(7):706-708.

Naldini L., U. Bl[delta]mer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma & D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272(5259):263-267.

Paddison P. J. & G. J. Hannon. 2003. siRNAs and shRNAs: skeleton keys to the human genome. CurrOpin Mol Ther. 5(3):217-24.

Payne S. L., X. M. Qi, H. Shao, A. Dwyer & F. J. Fuller. 1998. Disease induction by virus derived from molecular clones of equine infectious anemia virus. J. Virol. 72:483-487.

Saenz D. T., W. Teo, J. C. Olsen & E. M. Poeschla. 2005. Restriction of feline immunodeficiency virus by Refl, Lv1, and primate TRlM5alpha proteins. J. Virol. 79(24):15175-15188.

Saksela K. 2003. Human viruses under attack by small inhibitory RNA. Trends Microbiol. 11(8):345-347.

Shao H., M. D. Robek, D. S. Threadgill, L.S. Mankowski, C. E. Camerson, F. J. Fuller & S. L. Payne. 1997. Characterization and mutational studies of equine infectious anemia virus dUTPase. Biochim Biophys Acta. 1339(2): 181-191.

Stump D. S. & S. VandeWoude. 2007. Animal Models for HIV AIDS: A Comparative Review. Comp Med. 57(1)33-43.

United States Department of Agriculture Animal and Plant Health Inspection Service (USDA APHIS). 2006. Equine Infectious Anemia. #N461.0806.

USDA APHIS. 2007a. Equine Infectious Anemia: Uniform Methods and Rules. 91-55-064.

USDA APHIS. 2007b. Trends in Equine Infectious Anemia (EIA) Testing, 1998-2005. #N472-0307.

USDA APHIS. 2011. Animal Health Monitoring and Surveillance: Equine Infectious Anemia Distribution Maps. http://www.aphis.usda.gov/vs/nahss/equine/eia/eia_distribution_maps.htm Accessed 12 Aug 2013.

Zhang, B., S. Jin, J. Jin, F. Li, and R. C. Montelaro. 2005. A tumor necrosis factor receptor family protein serves as a cellular receptor for the macrophage-tropic equine lentivirus. Microbiology, PNAS 102:9918-9923.

SCC at: canterbesc@sfasu.edu

Sarah Canterberry (1), Jason Fritzler (2) and Charles Long (3)

(1) Stephen F. Austin State University, Nacogdoches, TX 75962

(2) Weber State University, Ogden, UT 84408

(3) Texas A&M University, College Station, TX 77845
Table 1. Seven shRNA-targeting sequences and corresponding gene
target(s).

Target Gene   shRNA  Target Sequence (22-mer)
              ID

S2, env, rev  SER1   AAGGAAGCAAGAGACCAAGAAA




S2, env, rev  SER2   ATGGCAGAATCGAAGGAAGCAA




gag, pol      GP1    AGTAGAGGATCTCAACCTGGAC




gag, pol      GP2    CACAACAAATCTGTTGTACAAG




pol           pol2   GACAGACACCATGGGAAGTATT



S2            S2.2   GATATATGGGAGTATTTGGTAA


rev           Rev2   TACTGATACCTGGATACCTAAG



Target Gene   Function


S2, env, rev  Regulator of Expression of
              Viral Proteins; mediates
              mRNA transport;
              enhancement of host
              cytokine expression
S2, env, rev  Regulator of Expression of
              Viral Proteins; mediates
              mRNA transport;
              enhancement of host
              cytokine expression
gag, pol      Encodes internal structural
              proteins; reverse
              transcriptase-RNase H
              complex; dUTPase;
              integrase; protease
gag, pol      Encodes internal structural
              proteins; reverse
              transcriptase-RNase H
              complex; dUTPase;
              integrase; protease
pol           Encodes reverse
              transcriptase-RNase H
              complex; dUTPase;
              integrase; protease
S2            Enhances host cytokine
              expression; essential but
              poorly understood
rev           Regulator of Expression of
              Viral Proteins; mediates
              mRNA transport
COPYRIGHT 2017 Texas Academy of Science
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Equine Infectious Anemia Virus
Author:Canterberry, Sarah; Fritzler, Jason; Long, Charles
Publication:The Texas Journal of Science
Article Type:Report
Geographic Code:1USA
Date:Jun 1, 2017
Words:5259
Previous Article:Effect of oil type and pre-cooking soak time on acrylamide formation in french-fried potatoes.
Next Article:Utilizing ground penetrating radar to characterize gypsum karst features in Eddy County, New Mexico and Culberson County, Texas.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters