Printer Friendly

Transcriptomic differential IncRNA expression is involved in neuropathic pain in rat dorsal root ganglion after spared sciatic nerve injury.

Introduction

After traumatic damage, the peripheral nervous system can regenerate spontaneously by activating the inherent growth ability of neurons, while the central nervous system cannot do so (1, 2). The sciatic nerve is commonly used as a model to study peripheral nerve regeneration. It includes a complex bunch of motor and sensory axons, in which the sensory neurons are situated in the L4-L6 dorsal root ganglion (DRG) (3, 4). After sciatic nerve damage, the damaged neurons initiate a regeneration process but cease having the neurotransmitter status (3, 5). Axon regeneration and pathfinding after damage involves a complex mechanism involving axon cross-talk with neurogliocytes, nerve growth factors, neurotrophic factors, and receptors (6, 7).

Neuropathic pain after traumatic or surgical nerve injury challenges doctors and patients and regulatory noncoding RNAs (ncRNAs) are key molecules for understanding and treating this pain (8, 9). Regulatory ncRNAs are transcribed from protein noncoding genes to interfere in gene expression and they include, but are not limited to, miRNAs (21-24 nt), siRNAs (21-25 bp), piRNAs (26-31 nt), and long non-coding RNAs (IncRNAs, 200 bp to more than 100,000 bp) (8, 10, 11). The role of miRNAs, IncRNAs, and piRNAs in neuropathic pain after nerve injury has been reviewed by Bali and Kuner (8). The role and regulatory mechanisms of IncRNAs in vertebrate central nervous system and human nervous system diseases have been reported in the literature (8, 12-15).

In peripheral nerve injury, IncRNAs play an important role in stress responses, plasticity, and axonal outgrowth of DRG neurons (8, 16-21). Yu et al. (16) investigated the IncRNA transcriptome of DRG neurons after sciatic nerve injury in rat models and found that IncRNAs modulate DRG neurons responses to ligation stimuli. Zhao et al. (17) identified the modulating effect of the IncRNA (Kcna2 antisense RNA) on a voltage-dependent potassium channel mRNA Kcna2 in primary afferent neurons. Yao et al. (18) reported that the IncRNA uc.217 modulates neurite outgrowth of DRG neurons after sciatic nerve injury. IncRNA NONRATT 021972 and IncRNA uc.48 modulate neuropathic pain mediated by the P2X(3/7) purinergic receptors (the cation-permeable ATP-binding ligand-gated ion channels) in the DRG neurons in diabetic rat models, and siRNA therapy alleviate the pain significantly (19-23). However, all these studies are based on microarray analysis (24). A sequencing study to elucidate vital roles of IncRNAs in peripheral nerve pathology will help to understand neuropathic pain.

In this study, we described the IncRNAs expression and mRNA expression in DRGs during nerve regeneration by a transcriptome-level deep sequencing. The results reveal a novel layer of regulation of the inherent growth ability of neurons by IncRNAs.

Material and Methods

Animal surgery and sample preparation

Six male Sprague-Dawley rats (180-220 g) were housed in large cages with sawdust bedding at 25[degrees]C in 12 h/12 h dark/light cycle and allowed free access to food and water in the Animal Center of Beijing China-Japan Friendship Hospital. Rats were randomly divided into test group and sham-operation group, three in each group. Surgery was performed as described in the literature with modifications (16). Briefly, rats were anesthetized by intra-peritoneal injection of 10 wt.% chloral hydrate (3 mL/kg, Tianjin Fuchen Chemical Reagent Factory, China). The sciatic nerves were exposed and lifted through an incision on the right lateral thigh. Sciatic nerve segments were tied at the site proximal to the bifurcation of tibial and common peroneal nerves. Rats in the sham-operation group only had the sciatic nerves exposed without tying. L4-L6 DRGs were harvested from each animal a week later. All animal experiments were performed in accordance with institutional animal welfare and care guidelines and approved by the Animal Ethics Committee of Beijing China-Japan Friendship Hospital.

RNA isolation, cDNA library preparation, and sequencing

Total RNAs were extracted from the L4-L6 DRG tissues using Trizol reagent according to the instructions of the manufacturer (Invitrogen, USA). RNAs were cleaned, including a DNase I digestion step, using RNeasy spin columns (Qiagen, USA). RNA integrity was detected by agarose gel electrophoresis and RNA was quantified using Nanodrop2000 (Bio-Rad, USA). After rRNA was removed, RNA was interrupted into short fragments by adding fragmentation buffer. These short RNA fragments were used as templates to synthesize the first-strand cDNA using FastQuant RT Kit (with gDNAase) (Tiangen, China). Then, double-strand cDNA was obtained.

The cDNA products were purified with QiaQuick PCR extraction kit (Qiagen, Germany) and the purified cDNA were dissolved in EB buffer, followed by end reparation and poly(A) addition. The cDNA fragments were connected to sequencing adaptors. The cDNA fragments at 150-200 bp in size were separated on gel-electrophoresis and were used as the templates for PCR amplification. Two cDNA libraries for the test and sham-operation groups were sequenced using the Illumina HiSeq2500 at Beijing Ori-Gene Science and Technology Co., LTD (China).

Data processing

Raw images generated by sequencers were converted by Illumina software (USA) to nucleotide sequences, called raw reads. FastQC software package (USA) was used to generate clean reads by removing adaptor reads, low quality reads (QC30), sequences containing fuzzy N bases and sequences less than 60 bp. All the following analyses were based on clean reads. The clean reads were mapped to the genome using Tophat2 software package (USA). RSeQC software package with all default parameters (USA) was used to detect the splice junction sites for evaluating the saturation of sequencing.

Differential expression and enrichment

The RPKM method (reads per kilobase per million mapped reads) was used to calculate the differential expression level using the Cufflinks software package (USA). Cufflinks Cuffdiff was used to screen the differential expression genes (DEGs). The criterion to identify the DEGs between two groups was as follows: sum of mapping reads of two samples [greater than or equal to] 10; |log2RPKM fold change| > 1; P value was corrected by false discovery rate (FDR) to get a Q-value; both P [less than or equal to] 0.05 and Q [less than or equal to] 0.05 were required to determine the significance of differential expression. In order to get biological functions, DEGs were subjected to gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. R package was used for the analysis. GO terms of DEGs were compared with the genome background and the corrected P value (FDR correction) < 0.05 was set to judge the significantly enriched GO terms. For the KEGG pathway enrichment analysis, P value < 0.05 was the threshold.

Known and novel IncRNA

The RPKM method was used to calculate the known expression level using the Cufflinks software package. Because IncRNAs have no conservation between species, we used rat IncRNA database for annotating known IncRNA in the transcript obtained from sequencing. New transcripts with opening read frame features were aligned with known protein database with CPC scoring to predict either coding or non-coding RNA. The predicted non-coding RNA is a novel IncRNA.

Coexpression network and target gene enrichment analysis

By comparing the differential gene lists, we obtained gene pairs of novel IncRNA and differential mRNA. FPKM values for each pair were used to calculate the Pearson correlation, where we chose significantly correlated gene pairs (correlation coefficient >0.995 or < -0.995, P<0.05 as threshold) to build a coexpression network using Cytoscape software package (USA). GO and KEGG enrichment analyses were performed as described above but the corrected P value threshold was set to <0.1. The correlated mRNA genes that coexpressed with IncRNAs served as the candidate target genes for IncRNAs.

Real-time qPCR quantification

To quantify IncRNA and target mRNAs, real-time qPCR were performed on representative rno-Cntnap2-201 IncRNA gene, rno-Fam171b mRNA gene, rno-Hebp2 mRNA gene, rno-Gde1 mRNA gene, rno-AC111653.1 IncRNA gene, and rno-Hypm mRNA gene in the sham-operation and test DRG groups. Briefly, the first-strand cDNA was synthesized using FastQuant RT Kit (with gDNAase) (Tiangen). Then, double-strand cDNA was synthesized. Real time qPCR was performed on a Roche LightCycler[R] 96 fluorescence quantifying PCR machine. Primer sequences are listed in Table 1.

The reaction system included 1 [micro]L of cDNA, 10 [micro]L of RealStar Green Mixture (2 x), 0.6 [micro]L of primers, and filled up to 20 [micro]L with PCR-grade water. The PCR program included a pre-denaturation at 95[degrees]C for 5 min, 40 cycles (95[degrees]C for 15 s, 60[degrees]C for 20 s, 72[degrees]C for 15 s) for amplification, and a default condition for dissociation. The cycle threshold (Ct) values were obtained. Relative interest/ reference mRNA expression was calculated by the formula: 2-[DELTA]Ct (interest-reference). rno-GAPDH was used as inner reference.

Cell assays

Wistar rat DRG cells were isolated and cultured as reported in the literature (25). Cell assays were performed as reported in the literature with a minor modification (26). Briefly, one-day-old Wistar rat DRG cells were isolated and cultured in 95% Eagle's DMEM feeding medium with 600 mg/mL glucose, 10% fetal bovine serum, 5% horse serum, 20 ng/mL nerve growth factors, and 1 [micro]g/100 mL neurotrophins (25). For RNA silencing, siRNA sequences targeting lnc-AC111653.1 were designed and synthetized (GenePharma, China), and a final concentration of 50 nM was used for transient transfection. For overexpression of lnc-AC111653.1, full-length rat lnc-AC111653.1 cDNA was cloned into the pcDNA3.1 expression vector (Gene-Pharma). Lipofectamine 3000 (Invitrogen) was used for transfection according to manufacturer's instructions (26).

Western blotting

Total proteins were extracted from cell lysates and separated by 10% SDS-polyacrylamide gel. Then, they were electroblotted to PVDF membranes (Beyotime, China). Membranes were incubated in rabbit polyclonal HYPM antibody (Novus Biologicals, China), followed by horse-radish peroxidase-labeled goat anti-rabbit secondary anti-body (Boster, China). Signals were revealed using ECL detection reagent (Beyotime). GAPDH served as control. Images were analyzed by Image-Pro Plus 6 software (Media Cybernetics, USA). The intensity of test protein bands was normalized to the GAPDH bands.

Results

Gene mapping and differential expression genes

The RNA quality and sequencing quality were guaranteed. Clean reads were obtained. The results of gene mapping to the rat genome is shown in Table 2. Known gene expression is shown in Tables 3 and 4.

On differential expression analysis, a total of 18,824 genes were included, of which there were 2643 differential genes between DRG test group and sham-operation group. By comparison of the DRG group with the sham-operation group, 1228 were up-regulated and 1415 down-regulated. On enrichment analysis of DEGs, up-regulated differential genes were attributed to 624 GO terms and 50 KEGG pathways; down-regulated differential genes were attributed to 424 GO terms and 30 KEGG pathways. DEGs were clustered into a heatmap (Figure 1).

Known IncRNA, co-expression network, and target gene enrichment

We found 69 neurite-associated known IncRNA genes linking to 866 target mRNA genes (Table 5). After the GO and KEGG enrichment information was presented at a P value threshold <0.1, the 866 targets were enriched to 737 GO terms and 40 KEGG pathways. They were involved either in the downregulation of neurotransmitter status of neurons or in the upregulation of peripheral neuronal regeneration. The GO terms and KEGG pathways involved in the downregulation effects included, but were not limited to, synaptic vesicle exocytosis, neurotransmitter secretion, voltage-gated potassium channel activity, regulation of synaptic transmission, GABAergic synapse, response to pain, endocytosis, neuronal action potential, detection of mechanical stimulus involved in sensory perception of pain, neurotransmitter transport, the GABAergic synapse pathway, the cholinergic synapse pathway, the neuroactive ligand-receptor interaction pathway, the dopaminergic synapse pathway, and the synaptic vesicle cycle pathway. The GO terms and KEGG pathways involved in the upregulation effects included, but were not limited to, response to mechanical stimulus, regulation of cell growth, positive regulation of cell migration, positive regulation of ERK1 and ERK2 cascade, positive regulation of PI3K signaling, activation of MAPKK activity, cell differentiation, regulation of neuron projection regeneration, regulation of nerve growth factor receptor activity, peripheral nervous system axon regeneration, glial cell differentiation, the AMPK signaling pathway, the calcium signaling pathway, the PI3K-Akt signaling pathway, the glucose metabolism pathway, the MAPK signaling pathway, and the cGMP-PKG signaling pathway.

The target gene from GO enrichment of known IncRNA apparently pointed to ENSRNOG00000006617 (P<0.05), thus we singled out the known IncRNA gene ENSRN0G00000006617 named rno-Cntnap2 (contactin associated protein-like 2). Through serial analyses of molecular network (Figure 2) and GO enrichment on gene rno-Cntnap2, we found 13 credible GO terms at P<0.05 (Table 6).

According to the 13 GO terms, rno-Cntnap2 had a putative gene function that is involved in the cell component of voltage-gated potassium channel complex on cell surface of brain neurites where it has an enzyme binding activity. Considering the condition of the current study, it was assumed that rno-Cntnap2 is involved in the cell component of voltage-gated potassium channel complex on cell surface of sciatic nerve neurites.

We reviewed the differential expression and co-expression network analysis of rno-Cntnap2 (ENSRNOG 00000006617) gene, which was down-regulated (20.34 and 3.94 for sham group vs DRG group, fold change -2.37, P< 0.001, Q=0.0003).

Novel IncRNA, co-expression network, and target gene features

We found 525 novel transcripts containing 26 novel IncRNAs referenced to rat IncRNA database (Table 7). We constructed the co-network of novel IncRNAs with mRNAs, and only 4 IncRNAs were related to 21 mRNAs under the conditions of thresholds of < 0.05 or 0.1 (Figure 3). The 4 IncRNAs were ENSRNOG00000055411, 000000 59555, 00000059564 and 00000057337 (Table 7).

We noticed that the transcript TCONS_00016823 included only one novel IncRNA gene, AC111653.1 (ENSRNOG00000057337), with a sense strand length of 828 nt. Gene AC111653.1 was null expressed in the sham-operation group and upregulated to 0.527889 in the DRG group. Gene AC111653.1 was correlated to the target gene ENSRNOG00000021452 named huntingtin interacting protein M (rno-Hypm). The rno-Hypm gene GO annotations included the molecular function of DNA binding and protein heterodimerization activity, the biological process of chromatin silencing, and the cellular component of nuclear chromatin and nucleosome. Huntingtin is essential for neuron survival, and the lack of huntingtin synthesis may lead to Huntington's disease (27). Up-regulation of both AC111653.1 and rno-Hypm genes after sciatic nerve injury implies a rescue course that triggers the regeneration of injured neurons. However, the function of Hypm gene is not completely understood.

Quantification of several genes

For known IncRNAs detection, we selected rno-Cntnap2 IncRNA gene and three down-regulated gene representatives, Fam171b (ENSRNOG00000004783), Hebp2 (ENSRNOG00000053735), and Gde1 (ENSRNOG00000 050445) from the rno-Cntnap2 gene coexpression network (Figure 2). Real time qPCR was performed to quantify expression levels of the four genes. The quantification results are shown in Table 8. Expression levels of the four genes were down-regulated. This result was consistent with the sequencing outcomes.

For novel IncRNAs identification, we selected AC111653.1 gene (ENSRNOG00000057337) and rno-Hypm gene (ENSRNOG00000021452) from the AC111653.1 gene coexpression network (Figure 3). They had a correlation coefficient of 1 (significance P=0). Up-regulation of both AC111653.1 and rno-Hypm genes after sciatic nerve injury may imply a rescue course that triggers the regeneration of injured neurons, thus the function of Hypm gene deserved to be studied. Real time qPCR was performed to quantify expression levels of the two genes (Table 8), which were up-regulated. This result was consistent with the sequencing outcomes.

Cell assays

To test the biological function of novel IncRNA AC111653.1 gene, we detected AC111653.1 and its target Hypm in primarily cultured Norway rat DRG cells in vitro. QPCR results are shown in Figure 4, and western blots in Figure 5. Novel IncRNA AC111653.1 was overexpressed after pcDNA3.1-lnc-AC111653.1 transfection. At the same time, its target hypm was also upregulated. Expression of AC111653.1 was reduced after siRNA transfection, and at the same time, its target hypm was downregulated. This suggested that novel IncRNA AC111653.1 was positively associated with hypm regulation in rats.

Discussion

In this study, we used a common sciatic nerve injury model to investigate gene expression conditions in rat DRGs using a high-throughput Illumina HiSeq2500 sequencing. In total, 86 known IncRNAs and 26 novel IncRNAs were altered during nerve regeneration. To understand the functions of the 86 known IncRNAs, we analyzed the molecular network including 866 co-expressed target genes. After sciatic nerve damage, the nerve systems switched from a neurotransmitter status to a neuronal regeneration status (1, 3, 5).

Based on the GO and KEGG enrichment results, we found that the neurotransmitter status of neurons are deregulated by the molecular mechanisms linking to the deregulation of the neuroactive neurotransmitter secretion, transmission, and ligand-receptor interaction pathway, while the neuronal regeneration was activated through the molecular mechanisms linking to the positive regulation of cell migration, cell differentiation, cell growth, PI3K signaling, MAPK cascade activity, nerve growth factor receptor activity, and peripheral nerve regeneration.

Glial cells migration, dedifferentiation, differentiation, proliferation, and growth play important roles in peripheral nerve regeneration (1-4). The results in this study showed the promotion of glial cell migration and growth by multiple signaling pathways. After sciatic nerve damage, local Schwann cells can shed off the myelin sheaths and transform to a neuroblast status, where their proliferation and migration capacities can help to sweep away myelin remnants and generate a conduit for the axonal pathfinding, and consequently form the beneficial conditions for neurite outgrowth (1-3). The same IncRNA-linked nerve regeneration mechanism is identified by Yu et al. (16) and Yao et al. (18).

We singled out the known rno-Cntnap2 IncRNA gene, thought to be involved in the cell component of voltage-gated potassium channel complex on cell surface for the neurites of the sciatic nerve system. We speculated that sciatic injury might trigger a switch from a neurotransmitter status to a regeneration status of neurons. The gene mo-Cntnap2 may be involved in a neurotransmitter delivery process linking to the function of voltage-gated potassium channel complex. Thus, rno-Cntnap2 gene expression was down-regulated because a neurotransmitter status was ceased. The modulation of voltage-gated potassium channels by a IncRNA has been identified in DRG first-order sensory neurons in a spinal nerve ligation rat model (17). In this previous study, peripheral nerve injury increased a conserved IncRNA (Kcna2 antisense RNA) expression in injured DRG through activation of the transcription factor myeloid zinc finger protein 1. This increase of IncRNA downregulates the voltage-dependent potassium channel Kcna2 mRNA, consequently reducing total potassium current. The decrease of potassium current increases the neural excitability, namely neuropathy-induced sensitivity to mechanical stimuli in DRG neurons, resulting in neuropathic pain symptoms. The modulation of rno-Cntnap2 mRNA may also follow this molecular mechanism, though identification is required.

We further selected the transcript TCONS_00016823 containing only one novel IncRNA gene AC111653.1 (ENSRNOG0000005733). This IncRNA's upregulation improved the rno-Hypm gene expression, which promoted huntingtin synthesis regenerating sciatic nerves. We tested the biological function of novel IncRNA AC111653.1 in rat dorsal root ganglion cells. The overexpression of IncRNA AC111653.1 upregulated rno-Hypm gene substantially, indicating that this novel IncRNA is accurately associated with the huntingtin protein regulation.

The time-course factor should be considered a limitation because transcript levels vary depending on the time between the mechanic stimuli of nerve tying until the detection starts (16). Thus, time-dependent gene expression change and more testing on IncRNA functions should be done in the future. In addition, more annotations on genes should be investigated.

In conclusion, a total of 26 novel IncRNAs were found. Both down-regulated rno-Cntnap2 gene and up-regulated rno-Hypm gene were involved in neuropathic pain of DRGs after spared sciatic nerve injury, thus contributing to peripheral nerve regeneration via putative mechanisms.

http://dx.doi.org/10.1590/1414-431X20187113

References

(1.) Reier PJ, Lane MA. Degeneration, regeneration, and plasticity in the nervous system. In: Conn PM (Editors), Neuroscience in Medicine, 3rd Edition. Totowa, NJ: Humana Press, 2008. p 691-727, doi: 10.1007/978-1-60327-455-5.

(2.) DeFrancesco-Lisowitz A, Lindborg JA, Niemi JP, Zigmond RE. The neuroimmunology of degeneration and regeneration in the peripheral nervous system. Neuroscience 2015; 302: 174-203, doi: 10.1016/j.neuroscience.2014.09.027.

(3.) Rodriguez FJ, Valero-Cabre A, Navarro X. Regeneration and functional recovery following peripheral nerve injury. Drug Discovery Today Disease Models 2004; 1: 177-185, doi: 10.1016/j.ddmod.2004.09.008.

(4.) Angius D, Wang H, Spinner RJ, Gutierrez-Cotto Y, Yaszemski MJ, Windebank AJ. A systematic review of animal models used to study nerve regeneration in tissue-engineered scaffolds. Biomaterials 2012; 33: 8034-8039, doi: 10.1016/ j.biomaterials.2012.07.056.

(5.) Vogelaar CF, Hoekman MF, Gispen WH, Burbach JP. Homeobox gene expression in adult dorsal root ganglia during sciatic nerve regeneration: is regeneration a recapitulation of development? EurJ Pharmacol 2003; 480: 233-250, doi: 10.1016/j.ejphar.2003.08.110.

(6.) Moore DL, Goldberg JL. Multiple transcription factor families regulate axon growth and regeneration. Dev Neurobiol 2011; 71: 1186-1211, doi: 10.1002/dneu.20934.

(7.) Allodi I, Udina E, Navarro X. Specificity of peripheral nerve regeneration: interactions at the axon level. Prog Neurobiol 2012; 98: 16-37, doi: 10.1016/j.pneurobio.2012.05.005.

(8.) Bali KK, Kuner R. Noncoding RNAs: key molecules in understanding and treating pain. Trends Mol Med 2014; 20: 437-448, doi: 10.1016/j.molmed.2014.05.006.

(9.) Jiang BC, Sun WX, He LN, Cao DL, Zhang ZJ, Gao YJ. Identification of IncRNA expression profile in the spinal cord of mice following spinal nerve ligation-induced neuropathic pain. Mol Pain 2015; 11: 43, doi: 10.1186/s12990-0150047-9.

(10.) Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell 2009; 136: 629-641, doi: 10.1016/ j.cell.2009.02.006.

(11.) Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, et al. The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome Res 2012; 22: 1775-1789, doi: 10.1101/gr.132159.111.

(12.) Qureshi IA, Mehler MF. Long non-coding RNAs: novel targets for nervous system disease diagnosis and therapy. Neurotherapeutics 2013; 10: 632-646, doi: 10.1007/s13311-013-0199-0.

(13.) Knauss JL, Sun T. Regulatory mechanisms of long noncoding RNAs in vertebrate central nervous system development and function. Neuroscience 2013; 235: 200-214, doi: 10.1016/ j.neuroscience.2013.01.022.

(14.) Wu P, Zuo X, Deng H, Liu X, Liu L, Ji A. Roles of long noncoding RNAs in brain development, functional diversification and neurodegenerative diseases. Brain Res Bull 2013; 97: 69-80, doi: 10.1016/j.brainresbull.2013.06.001.

(15.) Zuo L, Tan Y, Wang Z, Wang KS, Zhang X, Chen X, et al. Long noncoding RNAs in psychiatric disorders. Psychiatr Genet 2016; 26: 109-116, doi: 10.1097/YPG.0000000000000129.

(16.) Yu B, Zhou S, Hu W, Qian T, Gao R, Ding G, et al. Altered long noncoding RNA expressions in dorsal root ganglion after rat sciatic nerve injury. Neurosci Lett 2013; 534:117-122, doi: 10.1016/j.neulet.2012.12.014.

(17.) Zhao X, Tang Z, Zhang H, Atianjoh FE, Zhao JY, Liang L, et al. A long noncoding RNA contributes to neuropathic pain by silencing Kcna2 in primary afferent neurons. Nat Neurosci 2013; 16: 1024-1031, doi: 10.1038/nn.3438.

(18.) Yao C, Wang J, Zhang H, Zhou S, Qian T, Ding F, et al. Long non-coding RNA uc.217 regulates neurite outgrowth in dorsal root ganglion neurons following peripheral nerve injury. Eur J Neurosci 2015; 42: 1718-1725, doi: 10.1111/ ejn.12966.

(19.) Liu S, Zou L, Xie J, Xie W, Wen S, Xie Q, et al. LncRNA NONRATT021972 siRNA regulates neuropathic pain behaviors in type 2 diabetic rats through the P2X7receptor in dorsal root ganglia. Mol Brain 2016; 9: 44, doi: 10.1186/ s13041-016-0226-2.

(20.) Peng H, Zou L, Xie J, Wu H, Wu B, Zhu G, et al. LncRNA NONRATT021972 siRNA decreases diabetic neuropathic pain mediated by the P2X3 receptor

in dorsal root ganglia. Mol Neurobiol 2017; 54: 511-523, doi: 10.1007/s12035-0159632-1.

(21.) Wang S, Xu H, Zou L, Xie J, Wu H, Wu B, et al. LncRNA uc.48+ is involved in diabetic neuropathic pain mediated by the P2X3 receptor in the dorsal root ganglia. Purinergic Signal2016; 12: 139-148, doi: 10.1007/s11302-015-9488-x.

(22.) North RA. Molecular physiology of P2X receptors. Physiol Rev 2002; 82: 1013-1067, doi: 10.1152/physrev.00015.2002.

(23.) Burnstock G. P2X receptors in sensory neurones. Br J Anaesth 2000; 84: 476-488, doi: 10.1093/oxfordjournals. bja.a013473.

(24.) Smith SM, Murray DW. An overview of microRNA methods: expression profiling and target identification. In: Espina V (Editor). Molecular Profiling: Methods and Protocols, Methods in Molecular Biology. Germany, Berlin: Springer Press, 2012. p 119-138, doi: 10.1007/978-1-60327-216-2.

(25.) Haller I, Lirk P, Keller C, Wang GK, Gerner P, Klimaschewski L. Differential neurotoxicity of tricyclic antidepressants and novel derivatives in vitro in a dorsal root ganglion cell culture model. Eur J Anaesthesiol 2007; 24: 702-708, doi: 10.1017/ S0265021507000154.

(26.) Ye C, Shen Z, Wang B, Li Y, Li T, Yang Y, et al. A novel long non-coding RNA lnc-GNAT1-1 is low expressed in colorectal cancer and acts as a tumor suppressor through regulating RKIP-NF-KB-Snail circuit. J Exp Clin Cancer Res 2016; 35: 187, doi: 10.1186/s13046-016-0467-z.

(27.) Butland SL, Sanders SS, Schmidt ME, Riechers SP, Lin DT, Martin DD, et al. The palmitoyl acyltransferase HIP14 shares a high proportion of interactors with huntingtin: implications for a role in the pathogenesis of Huntington's disease. Hum Mol Genet 2014; 23:4142-4160, doi: 10.1093/hmg/ddu137.

P. Mao [1], C.R. Li [1], S.Z. Zhang [2], Y. Zhang [1], B.T. Liu [1] and B.F. Fan [1]

[1] Department of Pain Medicine, China-Japan Friendship Hospital, Beijing, China

[2] State Key Laboratory of Toxicology and Medical Countermeasures, Department of Biochemical Pharmacology, Beijing Institute of Pharmacology and Toxicology, Beijing, China

Correspondence: B.F. Fan: <doctormaopeng@163.com>

Received September 10, 2017 | Accepted June 11, 2018

Caption: Figure 1. Genetic clustering of differential expression genes (threshold: fold-change >2). Red color represents high fold-change, green color represents low fold-change. Names were omitted due to many lines overlapping. DRG: dorsal root ganglia.

Caption: Figure 2. Co-expression network of gene rno-Cntnap2 (ENSRNOG00000006617).

Caption: Figure 3. Co-expression network of novel long non-coding RNA (IncRNAs) with target mRNAs. The network comprises nodes and edges. Central round nodes are IncRNAs, green rectangle nodes are mRNAs. Purple edges indicate positive correlation and blue edges indicate negative correlation.

Caption: Figure 4. QPCR relative mRNA quantification. Upper panel shows rno-IncRNA AC111653.1 levels. Lower panel shows rno-Hypm mRNA levels in each group. Negative ctrl: pcDNA3.1 vector transfection; overexpress: pcDNA3.1-lnc-AC111653.1 transfection; siRNA interfere: siRNA-lnc-AC111653.1 transfection; normal ctrl: normal cells without treatment.

Caption: Figure 5. Western blot images. Cells were transfected with pcDNA3.1-lnc-AC111653.1 for overexpression and with siRNA-Inc-AC111653.1 for RNA interference. pcDNA3.1 vector and scrambled RNA served as negative controls. *P<0.05 compared to the other groups (ANOVA).
Table 1. Primer sequences.

Gene name             Sequence (5' [right arrow] 3')

mo-Cntnap2-201_F           gcacctaccacaccaacga
mo-Cntnap2-201_R         tttgctctcgtcaatggtctct
mo-Fam171b_5267F          aggagttctgctttgctctgg
mo-Fam 171b_5460R         tccacacacaaccaagggta
mo-Hebp2_415F             agatccgacactacggacca
mo-Hebp2_662R             cctgggtggatcatgttgct
mo-Gde1_20F               acgggtctggccgattatgt
mo-Gde1_586R              gcactctgtaactgcttccct
mo-GAPDH_1096F            gcccagcaaggatactgaga
mo-GAPDH_1252R            ggtattcgagagaagggaggg
mo-AC111653.1_201F       agctacagtcatggaaacaccc
mo-AC111653.1_201R       agatagcctcagctttgctcact
mo-Hypm_71F               cgacatgatg gtttgatggt
mo-Hypm_251R              ccatgcttga ttaccttacc

Table 2. Mapping results of transcriptome to
referenced genome.

Sample   Total Reads (M)   Total Mapped (M)

Sham 1       34,697        27,586 (79.50%)
Sham 2       31,648        25,293 (79.92%)
Sham 3       40,603        30,892 (76.08%)
DRG1         24,133        14,275 (59.15%)
DRG2         25,319        17,235 (68.07%)
DRG3         41,835        30,454 (72.80%)

Sample   Multiple Mapped (M)   Uniquely Mapped (M)

Sham 1     7,890 (22.74%)        19,696 (56.76%)
Sham 2     7,034 (22.23%)        18,258 (57.69%)
Sham 3     9,391 (23.13%)        21,501 (52.95%)
DRG1       6,434 (26.66%)        7,840 (32.49%)
DRG2       7,139 (28.20%)        10,096 (39.88%)
DRG3       10,614 (25.37%)       19,841 (47.43%)

DRG: dorsal root ganglia.

Table 3. Number and distribution of known gene expression.

Sample   Genes   Min.   1st Qu.   Median    Mean

Sham     17856    0      0.83      4.75    151.65
DRG      17296    0      1.15      5.15    400.95

Sample   Genes   3rd Qu.    Max.       Sd.       Sum.

Sham     17856    14.99    482618    5987.02    2707906
DRG      17296    14.28    1828940   19976.57   6934761

DRG: dorsal root ganglia.

Table 4. Number and percentage of known gene expression.

Sample       0-0.5          >0.5-1        > 1 -5

Sham     3634 (20.35%)   1184 (6.63%)   4322 (24%)
DRG      2859 (16.53%)   1175 (6.79%)   4504 (26%)

Sample       >5-10          >10-50           > 50

Sham     2764 (15.48%)   4488 (25.13%)   1464 (0.08%)
DRG      2996 (17.32%)   4416 (25.53%)   1346 (0.08%)

DRG: dorsal root ganglia.

Table 5. Known long non-coding RNA genes and their node
degrees in Cytoscape co-expression network.

nodes_label          nodes_degree

ENSRNOG00000002734        47
ENSRNOG00000003025        47
ENSRNOG00000005811         1
ENSRNOG00000006617        43
ENSRNOG00000009373         1
ENSRNOG00000011160        45
ENSRNOG00000017974         4
ENSRNOG00000019648       122
ENSRNOG00000024799        55
ENSRNOG00000031706         4
ENSRNOG00000033581        88
ENSRNOG00000043199        13
ENSRNOG00000043866         5
ENSRNOG00000046171        21
ENSRNOG00000046774         3
ENSRNOG00000047117         1
ENSRNOG00000048929        31
ENSRNOG00000049537        12
ENSRNOG00000051356         2
ENSRNOG00000051492        13
ENSRNOG00000051664        29
ENSRNOG00000051722         3
ENSRNOG00000051924         3
ENSRNOG00000052027         3
ENSRNOG00000052373         1
ENSRNOG00000052439         3
ENSRNOG00000052563        37
ENSRNOG00000052573         2
ENSRNOG00000053160         2
ENSRNOG00000053367         6
ENSRNOG00000053827         1
ENSRNOG00000054418         2
ENSRNOG00000054489         1
ENSRNOG00000054529         2
ENSRNOG00000054533         5
ENSRNOG00000054867         3
ENSRNOG00000054897         3
ENSRNOG00000054935         1
ENSRNOG00000054984         1
ENSRNOG00000055021         2
ENSRNOG00000055067         1
ENSRNOG00000055278         2
ENSRNOG00000055939        42
ENSRNOG00000056040         7
ENSRNOG00000056054         5
ENSRNOG00000056490         1
ENSRNOG00000056599         4
ENSRNOG00000056608         2
ENSRNOG00000056656         1
ENSRNOG00000056824         3
ENSRNOG00000057161        12
ENSRNOG00000057278        13
ENSRNOG00000057291         1
ENSRNOG00000057463         1
ENSRNOG00000057991         1
ENSRNOG00000058263         1
ENSRNOG00000058571        12
ENSRNOG00000058935         2
ENSRNOG00000058944         3
ENSRNOG00000059449         3
ENSRNOG00000059660         1
ENSRNOG00000060090         6
ENSRNOG00000060430         2
ENSRNOG00000060483         1
ENSRNOG00000060700         1
ENSRNOG00000060863        64
ENSRNOG00000061151         2
ENSRNOG00000061536         3
ENSRNOG00000061622         1

Table 6. Gene Ontology (GO) terms of rno-Cntnap2 long
non-coding RNA gene.

Category              Term                   Class

GO:0071205    protein localization     biological_process
                to juxtaparanode
                 region of axon
GO:0044224    juxtaparanode region     cellular_component
                     of axon
GO:0030673          axolemma           cellular_component
GO:0008076   voltage-gated potassium   cellular_component
                 channel complex
GO:0019899       enzyme binding        molecular_function
GO:0043204         perikaryon          cellular_component
GO:0031175      neuron projection      biological_process
                   development
GO:0005769       early endosome        cellular_component
GO:0007420      brain development      biological_process
GO:0030424            axon             cellular_component
GO:0030425          dendrite           cellular_component
GO:0043025     neuronal cell body      cellular_component
GO:0009986        cell surface         cellular_component

Category              Gene_id

GO:0071205    ENSRNOG00000006617
GO:0044224    ENSRNOG00000006617
GO:0030673    ENSRNOG00000006617
GO:0008076    ENSRNOG00000006617
GO:0019899    ENSRNOG00000006617
GO:0043204    ENSRNOG00000006617
GO:0031175    ENSRNOG00000006617
GO:0005769    ENSRNOG00000006617
GO:0007420    ENSRNOG00000006617
GO:0030424    ENSRNOG00000006617
GO:0030425    ENSRNOG00000006617
GO:0043025    ENSRNOG00000006617
GO:0009986    ENSRNOG00000006617

Table 7. Transcripts of 26 novel long non-coding RNA genes, of
which 4 (#-in bold) are involved in co-expression network with
target mRNA genes.

Transcript        Length bp        gene_id

TCONS_00000233       509      ENSRNOG00000058258
TCONS_00000914      1884      ENSRNOG00000058637
TCONS_00001056#      586#     ENSRNOG00000056324#
TCONS_00002131       879      ENSRNOG00000055411
TCONS_00002609       194      ENSRNOG00000060612
TCONS_00003909      1655      ENSRNOG00000054067
TCONS_00009651#      593#     ENSRNOG00000059555#
TCONS_00011039       350      ENSRNOG00000061204
TCONS_00012047       330      ENSRNOG00000035462
TCONS_00012411       134      ENSRNOG00000052738
TCONS_00014951#      153#     ENSRNOG00000059564#
TCONS_00015936       235      ENSRNOG00000035501
TCONS_00016823#      828#     ENSRNOG00000057337#
TCONS_00016834       220      ENSRNOG00000036434
TCONS_00017920       149      ENSRNOG00000058995
TCONS_00019224      1441      ENSRNOG00000000809
TCONS_00021430       262      ENSRNOG00000053319
TCONS_00021456       187      ENSRNOG00000047611
TCONS_00023970      2730      ENSRNOG00000056448
TCONS_00028110       255      ENSRNOG00000036492
TCONS_00028111       217      ENSRNOG00000040358
TCONS_00028926       281      ENSRNOG00000047126
TCONS_00033369      1000      ENSRNOG00000057258
TCONS_00034793       312      ENSRNOG00000032609
TCONS_00035961      1447      ENSRNOG00000051245
TCONS_00036296       341      ENSRNOG00000035579

Table 8. Real time qPCR quantification of interest/GAPDH (interest
DRG/Sham) gene expression levels.

                      Sham              DRG1              DRG2

rno-Cntnap2-20   0.0530 (1.0000)   0.0074 (0.1411)   0.0069 (0.1310)
  IncRNA
rno-Fam171b      0.0265 (1.0000)   0.0053 (0.1993)   0.0012 (0.0446)
rno-Hebp2        0.0417 (1.0000)   0.0112 (0.2673)   0.0145 (0.3475)
rno-Gde1         0.0128 (1.0000)   0.0097 (0.7526)   0.0042 (0.3231)
rno-AC111653.1          0              0.08652           0.04228
  IncRNA
rno-Hypm                0              0.29365           0.1263

                      DRG3           Sequencing
                                     (Sham/DRG)

rno-Cntnap2-20   0.0039 (0.0736)   20.3371/3.9422
  IncRNA
rno-Fam171b      0.0026 (0.0981)   19.7562/6.0137
rno-Hebp2        0.0082 (0.1966)   97.8422/22.9642
rno-Gde1         0.0065 (0.5078)   93.1178/36.7535
rno-AC111653.1       0.03684          0/0.52789
  IncRNA
rno-Hypm             0.1046           0/2.6653

DRG: dorsal root ganglia. The numbers outside parenthesis indicate
the gene expression ratio of interest to GAPDH and those inside
indicate the gene expression ratio of interest DRG groups to the
Sham group.
COPYRIGHT 2018 Associacao Brasileira de Divulgacao Cientifica (ABDC)
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Mao, P.; Li, C.R.; Zhang, S.Z.; Zhang, Y.; Liu, B.T.; Fan, B.F.
Publication:Brazilian Journal of Medical and Biological Research
Article Type:Report
Geographic Code:9CHIN
Date:Oct 1, 2018
Words:5354
Previous Article:Transplantation of rat-derived microglial cells promotes functional recovery in a rat model of spinal cord injury.
Next Article:Icariin reduces human colon carcinoma cell growth and metastasis by enhancing p53 activities.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters