Printer Friendly

Thin film biosensor for rapid detection of mecA from methicillin-resistant Staphylococcus aureus.

The reported incidence of methicillin-resistant Staphylococcus aureus (MRSA) isolates in hospitals has increased from 2% in 1974 to 50% in 1997 (1). In addition, MRSA is emerging as a community-acquired pathogen. Resistance is most often mediated by the mecA gene, which encodes an altered penicillin-binding protein (PBP-2A) with low affinity for [beta]-lactam antibiotics. Rapid identification of the mecA gene is important for implementation of appropriate antibiotic therapy.

MRSA is identified by either culture or molecular methods. Routine culture methods require two sequential steps, one to isolate S. aureus and the second to determine antibiotic susceptibility (2). Recently, molecular methods, including PCR, branched DNA, and cycling probe assays, have been described that identify mecA sequences from individual S. aureus colonies (3-7). These methods are sensitive and specific, but they all require instrumentation to interpret the results.

In this report, we describe a thin film biosensor for qualitative visual detection of mecA either directly from a single S. aureus colony or from a PCR amplification reaction. The technology allows direct visual detection of the interaction of target DNA sequences with complementary oligonucleotide probes immobilized to an optically coated silicon chip (8). The key assay steps for thin film formation are: (a) simultaneous hybridization of the target sequence to covalently attached surface capture probe and solution-phase biotinylated detector probes; (b) binding of anti-biotin antibody enzyme conjugate to the annealed detector probes; and (c) mass deposition through enzyme-catalyzed precipitation (Fig. 1A). The thin film alters the interference pattern of light on the surface, producing a perceived color change. Composition of the optical layers is designed such that small increases in thickness produce a color change from gold to purple, producing contrast in the range where the human eye is most sensitive. Thickness changes as small as l0A can be detected visually.

[FIGURE 1 OMITTED]

The thin film biosensor may be interpreted visually for a qualitative result. Alternatively, quantification may be obtained by either of two instrumented methods, charge-coupled device (CCD) imaging or ellipsometry (9,10). CCD imaging software measures color intensity, and ellipsometry measures thin film thickness. Each method provides a measurement that is proportional to the amount of target bound to the biosensor surface.

The nucleic acid detection surface described in these studies was a multilayer optical surface composed of a silicon wafer layered with 515A of silicon nitride applied by plasma vapor deposition and 13OA of a hydrophobic polymer (polydimethylsiloxane; United Chemical Technologies) applied by spin coating. A final layer of polyphenylalanine-polylysine (Sigma) was applied by passive adsorption to provide functional amines. Covalent attachment of the mecA capture probe (5'-GTCATTTCTACTTCACCATTACCAAC-3') was accomplished by reacting the homobifunctional cross-linker disuccidimidyl suberate (Pierce) with the 3' amine of the capture probe and amines on the biosensor surface, producing a stable amide linkage. Hybridization of the target sequence to the biosensor surface and to biotinylated detector probes is followed by reaction with an anti-biotin antibody conjugated to horseradish peroxidase (HRP) and precipitating substrate. This precipitation event deposits additional mass onto the surface, triggering a color change from gold to purple. This thin film deposition effectively transduces the hybridization reaction into a visible result.

The mecA biosensor determined the correct genotype of methicillin-sensitive S. aureus (MSSA) and MRSA strains from a single colony in a simple 3-h procedure (Fig. 1B). MRSA (ATCC strain 33592) and MSSA (ATCC strain 11632) were incubated at 37 [degrees]C for 24 h on a trypticase soy-blood agar plate (Remel). A single colony was suspended in lysis buffer (10 mg/L lysostaphin (Sigma), 75 mmol/L NaCl, 25 mmol/L EDTA, 20 mmol/L Tris, pH 7.5) and incubated at room temperature for 20 min. Samples were then denatured at 95 [degrees]C for 10 min in the presence of three biotinylated detector probes (1.33 [micro]mol/L each):

422d: 2aminoACACCATTTTATATTGAGCATCTACT;

581d: 2aminoACACCATTTTACCACGTTCTGATTTT;

603d: 2aminoACACCATTCCACATTGTTT000TCTAA.

The sample was diluted with an equal volume of hybridization buffer [10X standard saline citrate (SSC), 2 g/L sodium dodecyl sulfate, 10 g/L BlockAid [TM] (BioStar reagent)], incubated for 10 min at 95 [degrees]C, and then immediately added to the biosensor surface. Simultaneous hybridization of the S. aureus genomic DNA to the biosensor surface and the biotinylated detector probes was carried out for 2 h at 53 [degrees]C, followed by 10 min at 23 [degrees]C. The surfaces were washed with O.1 X SSC containing 1 g/L sodium dodecyl sulfate, followed by 0.1X SSC. Anti-biotin antibody conjugated to HRP (1 mg/L) was incubated on the surface for 10 min at room temperature; the surface was washed, and a precipitating 3,3',5,5'-tetramethylbenzidine (TMB) substrate (BioFX) was added for 15 min. The mecA gene was specifically detected from the MRSA strain, illustrating the utility of the mecA biosensor for direct detection of mecA sequences from a single S. aureus colony without purification or amplification of the genomic DNA (Fig. 1B).

A second rapid biosensor format was developed to analyze the products of mecA PCR amplification. In this 10-min assay, the mecA hybridization target was a 617-bp PCR amplicon rather than total genomic DNA. Because the PCR amplicon target was less complex and more abundant than chromosomal DNA, hybridization times were shortened from 2 h to 3 min. In addition, the increased copy number of the specific targeted sequences allowed for reduction in timing of all assay steps.

PCR amplification was performed with purified MRSA genomic DNA, (forward primer, 5'-TAATAGTTGTAGTTGTCGGGTTTG-3'; reverse primer, 5'-GGTTTTAAAGTGGAACGAAGGTAT-3'). PCR conditions were as follows: 95 [degrees]C for 4 min, followed by 25 cycles of 95 [degrees]C for 45 s, 53 [degrees]C for 45 s, 72 [degrees]C for 60 s, which amplified a 617-bp fragment from the mecA gene. The PCR reaction mixture was diluted in hybridization buffer, mixed with 1 [micro]mol/L each of the three biotinylated detector probes, and denatured at 95 [degrees]C for 3 min. The sample was incubated on the biosensor surface at 50 [degrees]C for 3 min, washed, and reacted with the anti-biotin antibody HRP conjugate for 2 min at room temperature. The precipitating TMB substrate was then added for 2 min at room temperature. The assay was complete in 10 min.

We compared the relative sensitivity of the rapid mecA biosensor PCR amplicon detection protocol with traditional agarose gel electrophoresis and ethidium bromide staining (Fig. 1C). The mecA biosensor was 10-fold more sensitive than the electrophoretic method with results available in 10 min. The lower limit of detection for the mecA biosensor corresponded to ~30-50 fmol of amplified target. Because a positive result with the biosensor requires specific nucleic acid hybridization, amplification of the correct sequence was confirmed.

The thin film biosensor provides rapid, noninstrumented detection of nucleic acid target sequences. Detection of mecA from a single S. aureus colony eliminates the need for confirmatory culture methods and reduces the time for MRSA determination from 24-48 h to <3 h. Sequence-specific detection of mecA PCR amplicons was complete in 10 min with sensitivity exceeding electrophoretic analysis. The thin film biosensor is a rapid, sensitive alternative to traditional methods for PCR amplicon detection such as gel electrophoresis or microwell hybridization assays. Because the biosensor sensitivity provides for detection of relatively few surface capture hybridization reactions, targets as complex as bacterial chromosomal DNA can be analyzed without purification. The assays may be configured for multitarget detection simply by attaching multiple capture probes to the silicon surface in discrete locations. The thin film biosensor can be formatted for single-gene or multigene detection to provide information for multiple antibiotic resistance mutations with one biosensor surface.

We thank Chris High for preparation of the figures.

References

(1.) CDC. Four pediatric deaths from community-acquired methicillin resistant Staphylococcus aureus-Minnesota and North Dakota, 1997-1999. Morbid Mortal Wkly Rep 1999;48:707-10.

(2.) Murray P, Baron E, Pfaller M, Tenover F, Yolken R, eds. Manual of clinical microbiology, 7th ed. Washington: ASM Press, 1999:1555-92.

(3.) Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol 1991;29:2240-4.

(4.) Geha D, Uhl J, Gustaferro C, Persing D. Multiplex PCR for identification of methicillin-resistant staphylococci in the clinical laboratory. J Clin Microbiol 1994;32:1768-72.

(5.) Salisbury S, Sabatini L, Spiegel C. Identification of methicillin-resistant staphylococci by multiplex polymerase chain reaction assay. Am J Clin Pathol 1995;107:368-73.

(6.) Kolbert C, Arruda J, Varga-Delmore P, Zheng X, Lewis M, Kolberg J, et al. Branched-DNA assay for detection of the mecA gene in oxacillin-resistant and oxacillin-sensitive staphylococci. J Clin Microbiol 1998;36:2640-4.

(7.) Bekkaoui F, McNevin J, Leung C, Peterson G, Patel A, Bhat R, et al. Rapid detection of the mecA gene in methicillin resistant staphylococci using a colorimetric cycling probe technology. Diagn Microbiol Infect Dis 1999;34: 83-90.

(8.) Ostroff R, Hopkins D, Haeberli A, Baouchi W, Polisky B. Thin film biosensor for rapid visual detection of nucleic acid targets. Clin Chem 1999;45:165964.

(9.) Ostroff R, Maul D, Bogart G, Yang S, Christian J, Hopkins D, et al. Fixed polarizer ellipsometry for simple and sensitive detection of thin films generated by specific molecular interactions: applications in immunoassays and DNA sequence detection. Clin Chem 1998;44:2031-5.

(10.) Trotter B, Moddel G, Ostroff R, Bogart G. Fixed-polarizer ellipsometry: a simple technique to measure the thickness of very thin films. Opt Eng 1999;38:902-7.

Robert Jenison, Ayla Haeberli, Shao Yang, Barry Polisky, and Rachel Ostroff

(BioStar, Inc., 6655 Lookout Rd., Boulder, CO 80301; * author for correspondence: fax 303-581-6405, email rmo@csn.net)
COPYRIGHT 2000 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2000 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Abstracts of Oak Ridge Posters
Author:Jenison, Robert; Haeberli, Ayla; Yang, Shao; Polisky, Barry; Ostroff, Rachel
Publication:Clinical Chemistry
Date:Sep 1, 2000
Words:1591
Previous Article:Rapid and sensitive closed-tube quantification of human interferon-[gamma] mRNA by reverse transcription-PCR utilizing energy-transfer labeled...
Next Article:Endotoxin activity in whole blood by neutrophil chemiluminescence--a novel analytical paradigm.
Topics:


Related Articles
Antimicrobial-Drug Use and Methicillin-Resistant Staphylococcus aureus.
Community-acquired methicillin-resistant Staphylococcus aureus, Finland. (Research).
MRSA transmission between cows and humans.
Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005.
Comparison of methicillin-resistant Staphylococcus aureus (MRSA) carriage rate in the general population with the health-worker population.
Sensitive assay for identification of methicillin-resistant staphylococcus aureus, based on direct detection of genomic DNA by use of gold...
Thin film biosensor for rapid visual detection of nucleic acid targets.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters