Printer Friendly

Therapeutic potential of mesenchymal stem cells in the treatment of gastric ulcer.

INTRODUCTION

Peptic ulcer is the most common gastrointestinal disorder in clinical practice. Peptic ulcer is affecting 5 10% of the world population living in different geographic regions [1]. Peptic ulcer results from imbalance between aggressive factors such as hydrochloric acid, pepsin, reactive oxygen species (ROS),non-steroidal anti-inflammatory drugs (NSAIDs), corticosteroids, helicobacter pylori and defense factors such as mucin, prostaglandins, normal mucosal blood flow, anti-oxidants, leading to an interruption of mucosal integrity [2]. The mechanism of non-steroidal anti-inflammatory drugs (NSAIDs) as aspirin- induced peptic ulcers is multifactorial, including prostaglandin reduction through COX inhibition [3]. Mucosal pro-inflammatory mediators such as interleukin-1 beta (IL1[beta]) and tumor necrosis factor alpha (TNF-[alpha]) are up-regulated following NSAIDs and are key mediators of the ensuing gastric injury as they strongly promote inflammation and subsequent tissue destruction [4]. Several growth factors are involved in the healing of gastric ulcer among which epidermal growth factor (EGF) and vascular endothelial growth factor (VEGF) play an important role [5]. Mesenchymalstem cells (MSCs) nowadays provide a promising alternative for the treatment of injured tissue. Several reports have indicated that stem cells play an important role in the healing of gut injuries [6,7]. Omeprazole is a proton pump inhibitors (PPIs) widely used in treatment of peptic ulcer. Recent studies have shown that PPIs also exert anti-inflammatory and anti-oxidant effects [8,9].

MATERIALS AND METHODS

Preparation of bone marrow (BM)-derived mesenchymal stem cells from rats:

Bone marrow was harvested by flushing the tibiae and femurs of 6-week-old male white albino rats with Dulbecco's modified Eagle's medium (DMEM, GIBCO/BRL) supplemented with 10% fetal bovine serum (GIBCO/BRL). Nucleated cells were isolated with a density gradient [Ficoll/Paque (Pharmacia)] and resuspended in complete culture medium supplemented with 1% penicillin-streptomy (GIBCO/BRL). Cells were incubated at 37[degrees]C in 5% humidified CO2 for 12-14 days as primary culture or upon formation of large colonies. When large colonies developed (80-90% confluence), cultures Were Washed twice with phosphate buffer saline (PBS) and the cells were trypsinized with 0.25% trypsin in 1mM EDTA (GIBCO/BRL) for 5 min at 37[degrees]C. After centrifugation, cells were resuspended in serum supplemented medium and incubated in 50 cm2 culture flasks (Falcon). The resulting cultures were referred to as first- passage cultures (10). Cells was identified as being MSCs by their morphology, adherence, and their power to differentiate into osteocytes and chondrocytes. Differentiation into osteocytes was achieved by adding 1-1000nM dexamethasone, 0.25 mM ascorbic acid, and 1-10 mM betaglycerophosphate to the medium. Differentiation of MSCs into osteoblasts was confirmed by morphological changes, Alzarin red staining of differentiated osteoblasts. Differentiation into chondrocyte was achieved by adding 500 ng/mL bone morphogenetic protein-2 (BMP- 2;R&D Systems, USA) and 10 ng/ml transforming growth factor b3 (TGFb3) (Peprotech, London) for 3 weeks. In vitro differentiation into chondrocytes was confirmed by morphological changes, Alcian blue staining of differentiated chondrocytes. Surface marker for MSCs characterization like CD45, CD29&CD90 was detected by RT by flow cytometry analysis.

Labeling of MSCs with PKH26:

MSCs were harvested during the 4th passage and were labeled with PKH26, which is a red fluorochrome. It has excitation (551nm) and emission (567 nm) characteristics compatible with rhodamine or phycoerythrin detection systems. The linkers are physiologically stable and show little to no toxic side-effects on cell systems. Labeled cells retain both biological and proliferating activity, and are ideal for in vitro cell labeling, in vitro proliferation studies and long, in vivo cell tracking. In the current work, MSCs were labeled with PKH26from Sigma Company (Saint Louis, Missouri USA). Cells were centrifuged and washed twice in serum free medium. Cells were pelleted and suspended in dye solution. Cells were injected intravenously into rat tail vein. Tissue was examined with a fluorescence microscope to detect and trace the cells.

Experimental Animals:

The study was carried on 40 female white albino rats, of an average weight 150- 200 gm. Rats were housed in a wire-bottom cages maintained at 25C[degrees], 35% to 75% humidity and in a 12/12-hour light/dark cycle under pathogen free condition and allowed unlimited access to chow and water. All the ethical protocols for animal treatment were followed and supervised by the animal unit, Faculty of Medicine, Cairo University.

Experimental design:

Animals were divided into 4 groups as follows:

* Group I: consisted of 10 rats, used as healthy control group.

* Group II A: consisted of 10 rats which received aspirin (from Bayer Co.) 100 mg/kg orally through a metal tube attached to a syringe.

* Group II B: consisted of 10 rats with aspirin-induced ulcer which received MSCs in a single dose of [10.sup.6] cells per rat, given by intravenous infusion at the rat tail vein following ulcer induction.

* Group II C: consisted of 10 rats with aspirin-induced ulcer which received omeprazole (from AstraZeneca Co.) 20 mg/kg administrated by oral route once daily for one week, following ulcer induction.

After 7 days animals were scarified, the isolated stomachs were cut along the greater curvature and washed with saline and the gastric mucosa was examined for:

* Homing of MSCs labeled with PKH26 dye in gastric mucosa by fluorescent microscope to detect red fluorescence.

* Quantitative analysis of EGF & VEGF expression in the gastric mucosa was done by real time PCR.

* Blood samples were withdrawn before animal scarification and serum values IL1[beta] and TNF-[alpha] were evaluated quantitatively by enzyme-linked

immunosorbent assay (ELISA).

Detection of EGF & VEGF gene expression using real time PCR (RT-PCR):

RNA extraction: Total RNA was isolated from stomach tissue homogenates using RNeasy Purification Reagent (Qiagen, Valencia, CA) according to manufacturers instruction. The purity (A260/A280 ratio) and the concentration of RNA were obtained using spectrophotometry (GeneQuant 1300, Uppsala, Sweden). RNA quality was confirmed by gel electrophoresis.

cDNA synthesis: First-strand cDNA was synthesized from 4 [micro]g of total RNA using an Oligo(dT)12-18 primer and Superscript[TM] II RNase Reverse Transcriptase. This mixture was incubated at 42[degrees]C for 1 h, the kit was supplied by SuperScript Choice System (Life Technologies, Breda, the Netherlands).

Real-time quantitative polymerase chain reaction (qCR):

Quantitative RT-PCR was performed in duplicate in a 25-[micro]l reaction volume consisting of 2X SYBR Green PCR Master Mix (Applied Biosystems), 900 nM of each primer and 2-3 pl of cDNA. Amplification conditions were 2 min at 50[degrees], 10 min at 95[degrees] and 40 cycles of denaturation for 15 s and annealing/extension at 60[degrees] for 10 min. Data from real-time assays were calculated using the v1*7 Sequence Detection Software from PE Biosystems (Foster City, CA). Relative expression of VEGF and EGF mRNA was calculated using the comparative Ct method. All values were normalized to the beta actin gene [11]. Table 1 show the primer sequences used for RT-PCR.

Estimation of IL-1[beta] beta and TNF[alpha]:

IL-1[beta] beta and TNF[alpha] were measured using ELISA kit supplied by RayBiotech, Inc. according to manufacturer's directions.

Statistical methods:

Data was analyzed using IBM SPSS advanced statistics version 22 (SPSS Inc., Chicago, IL). Numerical data were expressed as mean and standard deviation and range. Data were tested for normality using Kolmogorov-Smirnov test and Shapiro-Wilk test. Data were found to be normally distributed so we used the parametric tests for comparison between groups. Comparison between more than two groups was done using Analysis Of Variance (one-way ANOVA) then post-Hoc "Schefe test" was used for pair-wise comparison. All tests were two-tailed. A p-value < 0.05 was considered significant.

Results:

MSCs culture, identification & homing:

Isolated and cultured undifferentiated MSCs reached 70-80% confluence at 14 days (Figure 1 A&B). In vitro osteogenic andchondrogenic differentiation of MSCs were confirmed by morphological changes and special stains (Figure 2 C&D) and (Figure 3 E&F) respectively). In addition, MSCs were identified by surface marker CD45 (-ve), CD90 (+ve) and CD29 (+ve) detected by flow cytometry (Figure 4A,B and C) respectively. MSCs labeled with PKH26 fluorescent dye were detected in the gastric tissues confirming that these cells homed into the gastric tissue (Figure 5).

* EGF and VEGF gene expression:

EGF genes expression measured by real time PCR was found significantly lower in Group IIA compared to Group 1(p <0.001),but significantly increased in Group II B and Group II C compared to Group II A(p <0.001) and p=0.007, respectively) (Figure 6).

VEGF genes expression decreased significantly in Group IIA compared to Group I(p <0.001). The expression increased significantly in Group II Band Group II C compared to Group II A(p =0.015 and p=0.042, respectively) (Figure 7). The difference of expression of both genes is insignificant between group II B and II C (p = 0.53 for EGF and 0.90 for VEGF).

* IL1[beta] and TNF-[alpha] level:

IL1[beta] level measured by ELISA was found to be significantly higher in Group II A compared to Group I,(p <0.001), however it was significantly lower in Group II Band Group II C compared to Group II A,(p <0.001 and p = 0.001, respectively) (Figure 8, table 2).

Also, TNF-[alpha]serum level was significantly higher Group II A compared to Group I,(p <0.001). But it decreased significantly in group II B and Group II C compared to Group II A,(p <0.001and p = 0.001, respectively) (Figure 9, table 2). The difference in these inflammatory cytokines was insignificant between group II B and II C (for IL1[beta]p = 0.16 and 0.15 for TNF-[alpha]).

Discussion:

Mesenchymal stem cells are undifferentiated cells capable of developing into many cell types. They have been investigated as clinical therapy to promote tissue repair, where they provide a promising alternative for the treatment of injured tissue [12].

This study showed that stem cells could migrate and locate in injured gastric mucosa and accelerate the repair of gastric ulcer in rats. This was noticed by several authors, who noticed that stem cells play an important role in gastric ulcer healing in rats [13,14,15].

In this study treatment with stem cells was accompanied by a significant increase in growth factors, EGF was found to be significantly higher in Group II B when compared to Group II A.

Epidermal growth factor is a low-molecular-weight polypeptide found in many human tissues. EGF is a growth factor that stimulates cell growth, proliferation, and differentiation by binding to its receptor EGFR. EGF was found able to promote mucosal healing of the rats with gastric and duodenal ulcer by stimulating mucosal proliferation, inhibition of gastric acid secretion, as well as mucosal protection from intraluminal injurious factors suchas gastric acid, pepsin, and bile acids [16,17,18].

Also VEGF was found to be significantly higher in Group II B when compared to Group II A. Vascular endothelial growth factor (VEGF), is a signal protein produced by cells. It is part of the system that restores the oxygen supply to tissues when blood circulationis inadequate. VEGF is known to be the most potent promoter of angiogenesis. Angiogenesis is a critical component of the ulcer healing process because it enables delivery of oxygen and nutrients to the healing sites. Hence, VEGF dramatically accelerates healing of experimental gastric and duodenal ulcers in rats [19,20,21].

In accordance with our results, the increase in growth factors at the site of injury following stem cell administration has been noticed by many authors [22]. Other authors reported that the administration of recombinant or natural analogues of growth factors may improve ulcer repair while the inhibition of their effects by neutralizing antibodies may result in delayed ulcer healing [23].

Furthermore, in the present study, mesenchymalstem cells have shown one more advantage which is their ability to significantly reduce the inflammatory cytokines IL1[beta] and TNF[alpha] as demonstrated by the significant decrease of IL1[beta] and TNF[alpha] in Group II B when compared to Group II A.

IL1[beta] and TNF[alpha] are key cytokines in many inflammatory processes. The expression of IL1[beta] mRNA and of TNF[alpha] mRNA is increased in gastric ulceration, they are also highly expressed in gastric mucosa in helicobacter pylori-positive patients with gastritis and ulcers [4].

Hence by their ability to differentiate into gastric cells and their ability to increase growth factors EGF & VEGF as well as reducing inflammatory mediators, stem cells have shown potential efficacy in treating gastric ulcer, where their effect was as good as that of omeprazole.

ARTICLE INFO

Article history:

Received 5 August 2015

Accepted 28 August 2015

Available online 15 September 2015

Conclusion:

These findings suggested that mesenchymalstem cells have therapeutic potential in the treatment of gastric ulcers. We encourage further studies to confirm the usefulnessof stem cells in the treatment of gastric ulcers.

REFERENCES

[1] Viswanatha Swamy, H.M., M. Sajjan, A.H.M. Thippeswamy, B.C. Koti and A.J. Sadiq, 2011. Influence of Proton Pump Inhibitors on Dexamethasone-Induced Gastric Mucosal Damage in Rats. Indian J Pharm Sci, 73(2): 193-198.

[2] KaurAmandeep, Singh Robin, Sharma Ramica, Kumar Sunil, 2012. Peptic ulcer: a review on etiology and pathogenesis. IRJP, 3(6): 34-38.

[3] Musumba, D.M., M. Pritchard, 2009. Pirmohamed: Review article: cellular and molecular mechanisms of NSAID-induced peptic ulcers. Aliment Pharmacol Ther., 30: 517-531.

[4] Watanabe, T., K. Higuchi, M. Hamaguchi, 2004. Monocyte chemotactic protein-1 regulates leukocyte recruitment during gastric ulcer recurrence induced by tumor necrosis factor- alpha. Am J Physiol Gastrointest Liver Physiol., 287: G919-28.

[5] Jones, M.K., M. Tomikawa, B. Mohajer, A.S. Tarnawski, 1999. Gastrointestinal mucosal regeneration: role of growth factors. Front Biosci., 15(4): D303-9.

[6] Andoh, A., S. Bamba, Y. Fujiyama, M. Brittan, N.A. Wright, 2005. Colonic subepithelial myofibroblasts in mucosal inflammation and repair: contribution of bone marrow-derived stem cells to the gut regenerative response. J Gastroenterol., 40: 1089-1099.

[7] Komori, M., S. Tsuji, M. Tsujii, H. Murata, H. Iljima, M. Yasumaru, et al., 2005. Efficiency of bone marrow-derived cells in regeneration of stomach after induction of ethanol- induced ulcers in rats. J Gastroenterol., 40: 591-599.

[8] Ramalinga, R., Kedika, Rhonda F. Souza, Stuart Jon Spechler, 2009. Potential anti-inflammatory effects of proton pump inhibitors: A review and discussion of the clinical implications. Dig Dis Sci., 54(11): 2312-2317.

[9] Suzuki, M., M. Mori, S. Miura, M. Suematsu, D. Fukumura, H. Kimura, et al., 1996. Omeprazole attenuates oxygen derived free radical production from human neutrophils. Free Rad Biol Med., 21: 727-31.

[10] Abdel Aziz, M.T., H. Atta, S. Mahfouz, H.H. Fouad, N.K. Roshdy, et al., 2007. Therapeutic potential of bone marrow-derived mesenchymal stem cells on experimental liver cirrhosis. ClinBiochem, 40: 893-899.

[11] Kenneth, J., Livak and Thomas D. Schmittgen, 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 22DDCT. METHODS; 25: 402-408.

[12] Chang, Q., L. Yan, C.Z. Wang, W.H. Zhang, Y.Z. Hu, B.Y. Wu, 2012. In vivo transplantation of bone marrow mesenchymal stem cells accelerates repair of injured gastric mucosa in rats. Chin Med J (Engl). 125(6): 1169-74.

[13] Askarov, M.B., 2008. Multipotentmesenchymal stromal cells from autologous bone marrow accelerate regeneration of refractory gastric ulcers. Eksp Klin Gastroenterol., (4): 52-4.

[14] Askarov, M.B., N.A. Onischenko, 2008. Multipotentmesenchymal stromal cells of autologous bone marrow stimulate neoangiogenesis, restore microcirculation, and promote healing of indolent ulcers of the stomach. Bull ExpBiol Med., 146(4): 512-6.

[15] Nishida, T., S. Tsuji, M. Tsujii, S. Ishii, T. Yoshio, S. Shinzaki, S. Egawa, T. Irie, Y. Kakiuchi, M. Yasumaru, H. Iijima, S. Tsutsui, S. Kawano, N. Hayashi, 2008. Cultured bone marrow cell local implantation accelerates healing of ulcers in mice. J Gastroenterol., 43(2): 124-35

[16] Calabro, M.D., S. Milani MD, I. Paladini MD, B. Orsini BSc, G. Salvadori MD, C. Surrenti MD, 1995.: Role of epidermal growth factor in peptic ulcer healing. Digestive Diseases and Sciences, 40(11): 24972504.

[17] Carpenter, G., S. Cohen, 1990. Epidermal growth factor. The Journal of Biological Chemistry, 265(14): 7709-12.

[18] Herbst, R.S., 2004. Review of epidermal growth factor receptor biology. International Journal of Radiation Oncology, Biology, Physics., 59(2 Suppl): 21-6.

[19] Ferrara, N., 2004. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev., 25: 581-611.

[20] Genevieve, K., Dudar, Luca D. D'Andrea, Rossella Di Stasi, Carlo Pedone, John L. Wallace, 2008. A vascular endothelial growth factor mimetic accelerates gastric ulcer healing in an iNOS-dependent manner. Am J Physiol Gastrointest Liver Physiol., 295: 374-381.

[21] Tarnawski, A.S. and A. Ahluwalia, 2012. Molecular mechanisms of epithelial regeneration and neovascularization during healing of gastric and esophageal ulcers. Current Medicinal Chemistry, 19: 1627.

[22] Yujiro Hayashi, Shingo Tsuji, Masahiko Tsujii, Tsutomu Nishida, Shuji Ishii, Hideki Iijima, Toru Nakamura, Hiroshi Eguchi, Eiji Miyoshi, Norio Hayashi, Sunao Kawano, 2008. Topical transplantation of mesenchymal stem cells accelerates gastric ulcer healing in rats. Am J Physiol Gastrointest Liver Physiol., 294: G778-G786.

[23] Milani, S., A. Calabro, 2001. Role of growth factors and their receptors in gastric ulcer healing. Microsc Res Tech., 53(5): 360-71.

Laila Rashed and Salwa Fayez

Medical Biochemistry Department, Faculty of Medicine, Cairo University,

P.0.11559, Cairo, Egypt.

Corresponding Author: Salwa Fayez, Medical Biochemistry Department, Faculty of Medicine, Cairo University, P. O. 11559, Cairo, Egypt.

E-mail: Salwafayez@yahoo.com

Table 1: Primer sequences used for RT-PCR

             primer sequence

VEGF         Forward:5'GCCTGAAATCTACCAGATCATGTTG 3'
             Reverse:3'TTCCACAAGCTCCACGAATCTT 5'

EGF          Forward:5'-TGTGTTATI'GGCTATrCrGG-3'
             Reverse:5'-TCTFGGGGTCITGGTGT1TCT-3',

Beta actin   Forward 5'-TGTTGTCCCTGTATGCCTCT-3'
             Reverse 3'-TAATGTCACGCACGATTT CC-5'

Table 2: Comparison of mean [+ or -] SD values of the estimated serum
parameters in the studied groups:

                     Group I             Group IIA

IL-1[beta] (pg/ml)   46.7 [+ or -] 9.4   143.5 [+ or -] 19.1
TNF[alpha] (pg/ml)   31.2 [+ or -] 4.0   109.5 [+ or -] 17.3

                     Group IIB            Group IIC            P value

IL-1[beta] (pg/ml)   73.2 [+ or -] 15.3   95.2 [+ or -] 11.5   <0.001
TNF[alpha] (pg/ml)   53.2 [+ or -] 8.7    71.8 [+ or -] 13.3   <0.001

* Significant difference in comparison to control group (group I) (p
[less than or equal to] 0.05)

** Significant difference in comparison to ulcer group (Group II A) (p
[less than or equal to] 0.05)

*** Significant difference in comparison to ulcer group (Group II A)
(p [less than or equal to] 0.05)
COPYRIGHT 2015 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rashed, Laila; Fayez, Salwa
Publication:Advances in Environmental Biology
Article Type:Report
Date:Aug 1, 2015
Words:3036
Previous Article:The best scenario of carbon capturing storage and utilization (CCSU) in Malaysia.
Next Article:Growth performance and conjugated linoleic acid (CLA) content on meat of growing lambs fed diets containing vegetable oils.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters