Printer Friendly

The study of transient co-over expression of Cor and TYDC genes on morphine accumulation in Papaver somniferum L.

Introduction

The modification of plants through transgenic method, create new possibilities to modify the content of some important plant secondary metabolites such as pharmaceuticals [22]. The study for production useful pharmaceuticals of defined structure from plants began with the isolation of morphine from dried latex, or opium, of the opium poppy Papaver somniferum in 1806 [2]. Chemical structure of specific pharmaceuticals or their amount in plant tissues can be modify through metabolic engineering such as changes in the activities of regulatory biosynthetic enzymes responsible for gene expression in the secondary metabolite pathways [5]. Metabolic engineering have been successfully modify the alkaloid pathways. One of the most important secondary metabolites which are produced in some plant species are morphinan alkaloids which are generated in the Opium poppy (Papaver somniferum L.). This important group of alkaloids include morphine, codeine, oripavin, thebaine, papaverin and other important pharmaceutical alkaloids. These morphinan alkaloids are used for semi-synthetic pharmaceutical analgesics production [19].

Opium poppy (P.somniferum L.) generally contains about 18 tetra hydrobenzylisoquinoline alkaloids [19]. Several enzymes from the biosynthetic pathways for some alkaloids have been identified and genes related to this enzymes have also been cloned [9]. Morphinan alkaloid biosynthesis is well understood at the enzymatic and gene expression level [10].

In present study, we transformed leaves of Papaver somniferum (Rence cultivar) for Co-Over expression of Cor and TYDC genes transiently which are responsible for the last step and first step of morphinan alkaloid pathway respectively. TYDC gene family involve 8 coding region which are categorize in two groups. The coding region responsible for converting the L-Tyrosine to dopamine is TYDC 5 which is 1867 bp. On the other hand, Cor gene family involve 6 coding region which Cor 1 is responsible for converting the Codeinone into morphine and coding region length is 1021 bp [7]. The enzymatic synthesis of morphine in opium poppy has been almost completely describe by M.H. Zenk and colleagues [2].

In this study, the morphine accumulation was analyzed by HPLC method. The goal of this study was to determine whether the co-overexpression of Cor and TYDC caused to accumulation of morphine in transformed leaves.

Since many experiments to investigate the effects of metabolic engineering of morphine biosynthesis pathway enzymes, either through increased expression or gene silencing techniques has been done [5]. Acetyl-CoA dependent on acetyl transferase have an important role in the metabolism of alkaloids in the plants. This enzyme in the synthesis of indole monoterpenoid alkaloids in many medicinal plants like Rauwolfia serpentina is involved [18].

Cultured cells of transgenic plants Eschscholiza california with BBE antisense gene indicated 7-10 fold decrease in the total amount of benzophenatridin. The transgenic cells with antisense gene cyp80b1 resulted in a significant reduction in the amount of benzophenatridins In contrast, increased expression of BBE enzyme, indicated 5-6 fold increase in the total amount of benzophenatridines in hair root cultures of E. californica. Larkin and colleagues in 2007 showed that an increase in codeinon reductase (Cor) enzyme expression caused a significant increase in morphine alkaloids in all transgenic plants. over expression of this enzyme caused to an increase in alkaloid accumulation more than 28 percent in compare with total alkaloids in control plants and morphine has increased about 22 percent [19]. In another experiment, Allen and colleagues in 2004, showed that complete inhibition of all members of multi-gene family of Cor using RNAi, caused an increase the intermediate S--reticuline upstream of codeine, in transgenic plants than codeine, morphine and thebaine in control plants [1]. So far no reports on the simultaneous expression of two enzymes in the production of morphine have been reported and probably this is the first report for manipulating the initial and final enzyme pathway in the production of morphine in opium poppy. In this study, transient expression constructs made to evaluate the activity in leaves of poppy plants were used. Transient expression experiments with these two genes showed that overexpression of these genes under the control of driving CaMV35s in transgenic leaves, increased accumulation of morphine than the control plants. Plant leaf tissue, indicating the retention of morphine in the successful practice of driving these genes under the control of CaMV35S vector pBI121. The transient expression method as an appropriate strategy for production of valuable proteins of pharmaceutical compounds are used in molecular farming. According to the results of this experiment is predicted that the permanent expression of these genes in transgenic plants, will lead to manufacturing a plant with significant increase in their rate of production of important medicinal alkaloids.

Materials And Methods

* Plant materials:

In order to DNA extraction, young leaves from Rence cultivar of P. somniferum harvested by hand. Seeds were planted in Pit-Cocopit medium for 2 weeks in order to germination in 4[degrees]C in growth chamber. DNA extraction from 30 day-old leaves was done by CTAB protocol and the absorption ratio for DNA was calculated by Nano-drop spectophotometr.

* Bacterial strains:

The DH5[alpha] strain of E. coli and LBA4404 strain of Agrobacterium tumefaciens were used for transformation events in this study.

* Oligonucleotides:

Oligonucleotides used in this study are forward and reverse primers for TYDC and Cor genes and other sequences such as enhancers and termination sequences which are listed in table 1.

* Cloning vectors:

Cloning vectors used for transformation was pBI121 for overexpression construct, pGEMT-Easy vector for primary cloning of TYDC and Cor and pTZ57R/T vector for insertion genes of interest in E. coli.

* Transgenic events:

Transient transformation leaves from 60 day-old seedlings of the Rence cultivar of P. somniferum, were transformed with the construction of binary vector Cor pGEMT-Easy and TYDC pGEMT-Easy for primary cloning of these genes. The sticky ended full-lenghth P. somniferum Cor coding region and TYDC coding region was ligated into the XbaI digested vector pTZ57R/T separately.

All vectors were constructed at biotechnology laboratory of Islamic Azad University, Dezfool branch, by ligating SaqI and XbaI cassette from the vector pTZ57R/T into the vector pBI121 for overexpression event through Shunmann protocol.

The over-expression cassette of pBI121 for Cor and TYDC coding region, contains a subterranean CamV35s promoter element followed by a nos terminator. The direction of the inserted Cor and TYDC coding region was confirmed by restriction enzyme digest, separately (primer sequence for Cor and TYDC, Table 1.)

pBI121 over-expression vector was transformed through competition cell procedure in the disarmed Agrobacterium tumefaciens strain LBA4404.

* Morphine accumulation analysis:

Analysis of morphine accumulation by HPLC method was done by C18 column (4.6 x 250 mm). Mobile phase used for HPLC analysis contains 60% of water and 40% of Methanol in 0.75 ml/min pressure and 40 min retention time. (Figure 3 a-d). Morphine pick in this analysis was distinguished through UV absorption ratio compare with standard samples.

The leaves of seedlings which was transformed for Cor and TYDC and Co-transformed for both Cor and TYDC were harvested by hand. Transformed leaves from each treatment was ground for morphine analysis using a Sample mill (Retsch SM 2000). In this method, 3 grams of air-dried ground leaves was added to 65 ml of acid extractant (0.17 % phosphoric acid, 10% methanol) in a 150 ml conical flask and shaken by a shaker in 180 r.p.m for 60 minutes. Samples were filtered by Whatman No.6 filter paper and injected into autosampler vial for HPLC. (C18 column).

Results:

The confirmation of TYDC and Cor amplification by PCR product analysis, were studied on 1% agarose gel electrophorsis for 40 minutes. (Figure 1, a-b). Confirmation of TYDC and Cor insertion in pTZ57R/T vector were studied on 1 % agarose gel electrophorsis (figure 2, a-b). Forward and reverse primers were design by Oligo software in order to insert the TYDC and Cor coding region into pGEMT-Easy vector (Table 1). In order to amplification and conservation of Kozak- TYDC and Kozak- Cor, this two constructs were coloned into pTZ57R/T in DH5a strain of E. coli and this insertion was confirmed by cutting plasmid of interest with SacI and XbaI restriction enzymes (figure 2, a-b). After extraction of pBI121 plasmid of E. coli and digestion with SacI and XbaI for remove Gus gene, purification of TYDC and Cor coding region was done through Glass milk method and finally the construct insert to pBI121 vector through competition cell procedure and agroinfiltered on Papaver somniferum leaves for transient overexpression of TYDC and Cor genes.

Comparing the morphine accumulation in transgenic leaves by HPLC analysis in transgenic and control leaves of P.somniferum showed that there is significant difference between transgenic and control leaves for morphine accumulation. The morphine accumulation for Cor over-expression is higher than TYDC over-expression (Figure 3). It's probably due to converting the TYDC products into other alkaloids except of morphine in BBE bridge (Figure 4). As it is clear in secondary metabolite pathway of morphine production, it is a bridge in the middle region of the pathway which caused to produce Sanguinarine from TYDC products (Figure 4). So the TYDC products divided into sanguinarin and morphine while the only product of Cor gene is morphine.

[FIGURE 1 OMITTED]

On the other hand, morphine accumulation for Co-overexpression of TYDC and Cor is much more than the accumulation of these genes separately, probably because of more primary products for morphine production are available when the TYDC is over-expressed.

Discussion:

Morphine biosynthesis in the Papaver somniferum has been investigated for many years. It is known that benzoisoquinoline alkaloids, specifically morphinan alkaloids, accumulate in latex vesicles within poppy laticifers. Laticifer structure and differentiation has been analyzed in opium poppy and alkaloids accumulation has been describes in many studies about opium poppy [11,12,13,14,21]. Investigations in NCBI database site, showed that there are six alleles from a gene family that may have at least 10 members for codeinon reductase. Other investigations showed that there are five alleles for tyrosine decarboxilase in the same database. Analysis confirmed that enzyme activity for Cor and TYDC from various stages of developing opium poppy seedlings and roots, stem, leaf and capsules of mature poppy plants, indicated that transcript from these genes are present throughout the plant at all developmental stages [2]. The early steps of the morphine biosynthesis pathway leading from the primary metabolite tyrosine via the general isoquinoline pathway to the tetracyclic salutsridinol have been clarified both at the metabolite and the enzyme level [20].

[FIGURE 2 OMITTED]

According to studies conducted, so far no reports of manipulating genes encoding enzymes for TYDC has been expressed both for silencing and overexpressing. In most studies, TYDC gene family has been used as a marker for the study, tracking and regulating the biosynthesis of Isoquinoline alkaloids in opium poppy [4].

Fachinii and colleagues and El-Ahmady and Nessler has been studied the TYDC gene family with Gus gene expression to determine the gene family pathway in opium poppy. The TYDC gene family increase cell wall resistance in canola plants. [8,4].

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

TYDC is an enzyme that converts tyrosine to tyramine. Tyramine in combination with coumarin increased synamicamid hydroxides which can result in cell wall degradability. [8]. Product produced by TYDC leads to three different pathways in the biosynthesis of opium alkaloids and only one of these paths, leads to produce morphine [4]. The initial expectation was that the above overexpression for TYDC and Cor resulted in a significant increase in the amount of morphine, but other routes of morphine during their upstream products showed that the material produced by TYDC in addition to morphine, leads to produce other alkaloids in the other direction and therefore will not lead to a significant increase in the production of morphine through TYDC overexpression. Meanwhile the expression of Cor, since morphine is only a matter of production, has led to a significant increase in the amount of morphine [19]. On the other hand, there are still many unknown paths in which the enzyme reaction product by TYDC in combination with other molecules, leads to synthesis of secondary metabolites, which all have a tyrosine origin of this path. However, the amino acid tyrosine in the poppy is limited and thus causes the multiplicity of metabolic pathways in the synthesis of codeine and morphine is less [3].

Conclusion:

Over expressing the Cor and TYDC caused to increasing the morphine accumulation in transgenic leaves in Opium poppy. Morphine accumulation is significantly higher when the leaves are transformed for Cor instead of TYDC and this is probably due to morphine biosynthesis pathway which upstream products of TYDC have a different directions and produce some other alkaloids meanwhile the only product for Cor is morphine. On the other hand, co-overexpression the Cor and TYDC leads to higher morphine accumulation compare with transformation for these genes separately. Thus, if we like to produce morphine in plant leaf tissue, Cor over expression is economically benefit than TYDC over expression or Co-over expression the both genes.

Acknowledgment

This research was supported by the Institute of Medical Plants (IMP) and Biotechnology laboratory of agronomy and plant breeding department of agriculture faculty of Islamic Azad University, Dezfool branch.

References

[1.] Allen, R.S., A.G. Millgate, J.A. Chitty, J. Thisteleton, J.A.C. Miller, A.J. Fist, W.L. Gerlach and P.J. Larkin, 2004. RNAi mediated replacement of morphine with the non-narcotic alkaloid reticuline in Opium poppy. National Biotechnology, (11): 1559-1566.

[2.] Bernhard, U., L. Rainer and Toni, M. Kutchan, 1999. Molecular cloning and functional expression of codeinone reductase : the penultimate enzyme in morphine biosynthesis in the Opium poppy Papaver somniferum, The plant Jour. (18)(5): 468-475.

[3.] Bird, D.A. and P.J. Facchini, 2001. Berberine bridge enzyme: A key branch-point enzyme in benzylisoquinoline alkaloid biosynthesis contain a vascular sorting determinant, Planta Med. (213): 888-899.

[4.] El-Ahmadi, S.H. and C.L. Nessler, 2001. Cellular localization of tyrosine decarboxilase expression in transgenic Opium poppy and Tobacco, Plant Cell Reports, (20): 313-317.

[5.] Facchini, P.J., P. Catherin, C.J. Alison and B. Dean, 1996. Molecular characterization of berberin bridge enzyme genes from Opium poppy, Plant Physiology, 11(2): 1669-1677.

[6.] Facchini, P.J., H. Jill, B. Osman, 2006. Pharmacological aspects of the Opium poppy, The Senlis Council, Drug Policy Advisory Forum.

[7.] Facchini, P.J., M.H. Jillian, K.L. David, L.U. Natalia, P.M. Benjamin, S. Nailish and G.Z. Katherine, 2006. Opium poppy: Blueprint for an alkaloid factory, Springer Science, 10.1007/S 11101.

[8.] Facchini, P.J. and De V. Luca, 1995. Phloem specific expression of tyrosine/Dopa decarboxilase genes and biosynthesis of isoquinoline alkaloids in Opium poppy, Plant Cell Reports, (7): 1811-1821.

[9.] Huang, F.C. and T.M. Kutchan, 2000. Distribution of morphine and benzophenanthridine alkaloid gene transcript accumulation in Papaver somniferum. Phytochemistery, (53): 551- 564.

[10.] Kutchan, T.M., 1998. Molecular genetics of plant alkaloid biosynthesis, In "The Alkaloids", Cordell, G. Vol. 50: 257- 316, Academic press, San Diego.

[11.] Kutchan, T.M., S. Ayobe and C.J. Coscia, 1985. Cytodifferentiation and Papaver alkaloid accumulation, the chemistry and biology of isoquinoline alkaloids, Berline : Springer verlag, 281-294.

[12.] Kutchan, T.M., M.D. Rush and C.J. Coscia, 1986. Subcellular localization of alkaloids and dopamine in different vascular compartments of Papaver bracteatum, Plant Physiol. (81): 161-166.

[13.] Nessler, C.L. and P.G. Mahlberg, 1977. Ontogeny and cytochemistry of alkaloidal vesicles in laticifers of Papaver somniferum, American Jour.Bot, (64): 541-551.

[14.] Nessler,C.L. and P.G. Mahlberg, 1978. Laticifer ultrastructure and differentiation in seedlings of Papaver bracteatum, Papulation Arya II, American Journal of Botany, (65): 978-983.

[15.] Park, S.U. and P.J. Facchini, 2000. Agrobacterium rhizogenes--mediated transformation of Opium poppy (Papaver somniferum) and California poppy (Eschscholiza californica) Cham., root cultures, Journal, Exp.Bot. (51): 1005-1016.

[16.] Park, S.U., M. Yu and P.J. Facchini, 2002. Antisense RNA-mediated suppression of benzophenanthridine alkaloids biosynthesis in transgenic cell culture of California poppy, Plant Physiol. (128): 696-706.

[17.] Park, S.U., M. Yu and P.J. Facchini, 2003. Modulation of berberin bridge enzyme levels in transgenic root cultures of California poppy alters the accumulation of benzophenanthridine alkaloids, Plant Mol.Bio. (51): 153-164.

[18.] Pfitzuer, A. and J. Stockiget, 1983. Biogenetic link between sarpagine and ajmaline type alkaloids, Tetrahedron Lett., (24): 5197-5200.

[19.] Philip, J. Larkin, A.C. James, Miller, S.A. Robert, A.C. Julie, L.G. Wayne, F. Susanne, M.K. Toni and J.F. Anthony, 2007. Increasing morphinan alkaloid production by overexpressing codeinone reductase in transgenic Papaver somniferum, Plant Biotech.jour. 5(1): 26-37.

[20.] Rainer Lenz and Meinhart, H.Z., 1995. Purification and properties of codeinone reductase (NADPH) from Papaver somniferum cell cultures and differentiated plants, European Journal of Biochem. (233): 132-139.

[21.] Roberts, M.F., D. McCarthy, T.M. Kutchan and C.J. Coscia, 1983. Localization of enzymes and alkaloidal metabolites in Papaver latex. Arch.Biochem.Biophys. (222): 599-609.

[22.] Verpoorte, R., A.W. Alfermann, T.S. Johnson, 2007. Application of plant metabolic engineering, Springer.

(1) Seyed Ali Fazelzadeh Dezfooli, (2) Farrokh Darvish, (3) Mansour Omidi, (4) Houshang Alizadeh, (5) Shamsali Rezazadeh

(1) Department of plant breeding, Science and Research Branch, Islamic Azad University, Tehran, Iran (2) Department of plant breeding, Science and Research Branch, Islamic Azad University, Tehran, Iran, (3,4) Department of Agronomy and Plant breeding, Agriculture faculty, Tehran University, Iran (5) Institute of Medical Plants, Jahad-e-Daneshgahi, Tehran, Iran

Corresponding Author

Seyed Ali Fazelzadeh Dezfooli, Department of plant breeding, Science and Research Branch, Islamic Azad University, Tehran, Iran

E-mail: alifazelzadeh@yahoo.com
Table 1: Different types of Oligonucleutide sequences used for
transformation and PCR

Sequence Type 5' [right arrow] 3'

Forward 1 for Primer ACTTGCTCCAAGGCTGTGC
TYDC

Reverse 1 for Primer CAGCATTATGGATGACCCG
TYDC

Forward 2 for Primer + XbaI ATCTAGATAAACAATAGTCTTAACACTG
TYDC site + Kozak
 enhancer

Reverse 2 for Primer + SacI AGAGCTCAACTTGAAAAATCTGCTTCTTAAC
TYDC site +
 Termination
 codon

Forward 1 for Primer ATG GAG AGT AAT GGT GTA CCT ATG
Cor

Reverse 1 for Primer GAG TTC TGG GAT GAG AAG GAT TGA
Cor

Forward 2 for Primer + XbaI ATCTAGATAAACAATAGTTGGAGAGTAATGGTGTA
Cor site + Kozak
 enhancer

Reverse 2 for Primer + SacI GAGAGCTCGTTCTGGGATGAG AAGGATTGTTAA
Cor site +
 Termination
 codon
COPYRIGHT 2012 American-Eurasian Network for Scientific Information
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Dezfooli, Seyed Ali Fazelzadeh; Darvish, Farrokh; Omidi, Mansour; Alizadeh, Houshang; Rezazadeh, Sha
Publication:Advances in Environmental Biology
Article Type:Report
Geographic Code:1USA
Date:Jun 1, 2012
Words:2997
Previous Article:A mathematical model of nutrient management for pineapple cultivation in Malaysia.
Next Article:Conservation tillage in Mediterranean climate (a review).
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters