Printer Friendly

The polymorphisms of Ser49Gly and Gly389Arg in beta-1-adrenergic receptor gene in major depression.

INTRODUCTION

The beta-1-adrenergic receptor (ADRBI) gene, which is a G-protein coupled postsynaptic receptor; mediates the physiological effects of catecholamines (I). ADRB I is encoded by a gene composed of 45 amino acids and is located on chromosome 10q24-26, a site where positive linkage to affective disorders is reported (2,3). Many polymorphisms of the ADRB I gene were studied before, but 13 of them were found to change the amino acids of the ADRBI protein (4,5). Ser49Gly and Gly389Arg have been identified as two functional polymorphisms among these variants. The change of adenine to guanine at the 145th position results in the change of the amino acid serine to glycine (Ser49Gly), and the substitution of cytosine with guanine results in the change of the amino acid glycine to arginine (Gly389Arg) (6,7). Although the majority of studies for Ser49Gly and Gly389Arg are about cardiovascular disorders, the C allele of the Gly389Arg polymorphism was found to be afunctional polymorphism associated with an enhanced coupling to the stimulatory Gs-protein and increased adenylyl cyclase activation, which are often observed in affective disorders (8). Another study about Gly389Arg polymorphism revealed an association of CC homozygosis with antidepressant treatment (9).

It's known that low trait levels of extraversion are linked to increased vulnerability to major depression and anxiety (10), and a research on Ser49Gly functional polymorphism in the beta-1-adrenergic receptor has indicated an association between low extraversion and depression (II). Additionally, another study revealed that mental stress-induced myocardial ischemia is more common among patients homozygous for the Ser49 allele (12).

The relation of increased adenylyl cyclase activation, antidepressant treatment response, low extraversion properties, and mental stress-related cardiovascular disorders reveals the importance of those polymorphisms. However; although there is remarkable evidence about the association of Ser49Gly and Gly389Arg polymorphisms in depression, only a limited number of studies have focused on these. We therefore tested a possible association of Ser49Gly and Gly389Arg polymorphism in the beta-1-adrenergic receptor in a sample of 144 patients diagnosed as having major depression by comparing them with 105 healthy controls.

METHODS

Subjects

A total of 144 patients with major depression diagnosed according to the DSM-IV criteria and 105 healthy controls between the ages of 18 and 75 were included in the study The study included patients who were admitted to the outpatient clinic of the psychiatry department of a university hospital between August 2008 and October 2010. The standardized structured interviews were performed by psychiatrists using SCID I and II questionnaires (13,14,15). Patients with any current comorbid psychiatric and personality disorders, alcohol or substance dependence, any other drug use, a history of serious head injury and those with a psychiatric disorder history in their first-degree relatives were excluded from the study Among 167 first episode depression subjects, 15 were excluded when recruiting patients because they met the criteria for the family history of a psychiatric disorder and eight were excluded because of a comorbid psychiatric disorder The subjects did not receive any pharmacological or non-pharmacological treatment during the sampling. All patients were chosen from among patients who had their first episode. A sample of 105 healthy subjects for the control group was non-related with the patients matched for age and gender Both groups were from the same region in Turkey

All patients and controls gave informed, written consent to participate in the study which was approved by Suleyman Demirel University Ethic Committee.

Genotype Analysis

Deoxyribonucleic acid was extracted from frozen whole blood according to standard methods. The subjects were genotyped for two ADRBI polymorphisms that resulted in serine/glycine (Ser49Gly) and arginine/glycine (Arg389Gly) amino acid substitutions (8,16).

Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) with primers described by Maqbool et al. (16) was used for genotyping. The following selected primary sequences for the analysis of Ser49Gly polymorphism in the ADRBI gene were applied. Forward Primer: 5'-CCGGGCTTCTGGGGTGTTCC-3' and Reverse Primer: 5'-GGCGAGGTGATGGCGAGGTAGC-3'.

The selected primary sequences for Gly389Arg polymorphism in the ADRBI gene were as follows: Forward Primer: 5' CGCTCTGCTGGCTGCCCTTCTTCC 3'and Reverse Primer: 5' TGGGCTTCGAGTTCACCTGCTATC 3'.

Ser49Gly polymorphism of the ADRB1 gene: A 564-bp gene region including the Ser49Gly polymorphism was amplified by PCR. A 25-[micro]L reaction mixture, which contained sterile distilled water (9.8 [micro]L), forward primer (0.5 [micro]L), reverse primer (0.5 [micro]L), Mg[Cl.sub.2] (1.5 [micro]L), deoxynucleotide triphosphate (dNTP) mixture (2.5 [micro]L), genomic DNA (4.0 mL), dimethyl sulfoxide (DMSO) (2.5 [micro]L), Taq DNA (0.2 [micro]L), and buffer (2.5 [micro]L), was prepared for each sample.

Thirty-five PCR cycles were performed for each reaction. The conditions were denaturation for 4 min at 95[degrees]C, amplification (denaturation for 30 s at 95[degrees]C, annealing for 30 s at 64[degrees]C, and extension for 45 s at 72[degrees]C), and a final extension at 72[degrees]C for 7 min. The analysis of the Ser49Gly polymorphism was performed by EcoO1091 (DraI) restriction enzyme, which was obtained from Escherichia coli. The amplified 564-bp target region of the ADRBI gene did not include any cutting region for the EcoO1091 restriction enzyme; however the substitution of adenine with guanine caused a cutting region. The PCR products were visualized by electrophoresis on 2% agarose gels.

Gly389Arg polymorphism of ADR[beta]1 gene: A 530-bp gene region including the Gly389Arg polymorphism was amplified by PCR. A 25-[micro]L reaction mixture, which contained sterile distilled water (9.8 [micro]L), forward primer (0.5 [micro]L), reverse primer (0.5 [micro]L), Mg[Cl.sub.2] (I.5 [micro]L), dNTP mixture (2.5 [micro]L), genomic DNA (4.0 mL), DMSO (2.5 [micro]L), Taq DNA (0.2 [micro]L), and buffer (2.5 [micro]L), was prepared for each sample. The PCR conditions were denaturation for 4 min at 95[degrees]C, amplification (denaturation for 30 s at 95[degrees]C, annealing for 30 s at 64[degrees]C, and extension for 45 s at 72[degrees]C), and a final extension at 72[degrees]C for 7 min. Analysis of the Gly389Arg polymorphism was performed by BcgI, which was obtained from Bacillus coagulans where the substitution of cytosine with guanine formed a cutting region on DNA. The PCR products were visualized by electrophoresis on 2% agarose gels.

Statistical Analysis

General statistical analyses were performed with the Statistical Package for the Social Sciences (SPSS Inc., Chicago, IL, USA) software (version 15.0). Polymorphisms of the ADRBI gene between the patients and controls were evaluated by using Chi-square test, ANOVA, t-test, and correlation analysis. A p-value of less than 0.05 was considered statistically significant.

RESULTS

A total of 144 major depressive disorder patients and 105 healthy controls were included in the study Of the 144 major depressive disorder patients, 112 (77.8%) were female and 32 (22.2%) were male. The mean age for the major depressive disorder group was 43.08 [+ or -] 13.59 years. Of the 105 participants in the control group, 77 (73.3%) were female and 28 (26.7%) were male, and the mean age for the control group was 41.43 [+ or -] 15.50 years. There was no difference between the controls and patients in gender and age (p=0.529; p=0.721).

Results of the ADRBI Gene Ser49Gly Polymorphism

The results for the ADRBI gene Ser49Gly polymorphism in the major depressive disorder and control groups were evaluated based on the size and number of fragments obtained by RFLP. The substitution of adenine with guanine at the extracellular amino-terminal 145 results in a change of serine to glycine in the 49th codon. According to our results, we observed that the homozygous wild type (AA) genotype had a single 564-bp DNA fragment, homozygous mutant type (GG) had two DNA fragments with 345 bp and 219 bp, and heterozygous type (AG) had three fragments with 564 bp, 345 bp, and 219 bp (Figure 1).

Of the 144 participants in the major depressive disorder group, 77 (53.5%) had homozygous wild type (AA), 57 (39.6%) had heterozygous type (AG), and 10 (6.9%) had mutant (GG) genotype. Of the 105 participants in the control group, 74 (70.5%) had homozygous wild type (AA), 23 (21.9%) had heterozygous type (AG), and 8 (7.6%) had mutant (GG) genotype. As shown in Table 1, there was no significant difference between the major depressive disorder and control groups after the analysis of genotype and allele frequencies of the Ser49Gly polymorphism in the ADRB gene (p=0.626; p=0.863).

Results of ADRBI Gene Gly389Arg Polymorphism

The results for the ADRBI gene Gly389Arg polymorphism in the major depressive disorder and control groups were evaluated based on the size and number of fragments obtained by RFLP The change of cytosine (C) to guanine (G) at the 1165 position resulted in the substitution of glycine to arginine. This polymorphic variant is located in the intracellular cytoplasmic tail portion (16).

In the major depressive disorder group, the homozygous wild type (GG) had a single 530-bp DNA fragment, homozygous mutant type (CC) had two DNA fragments with sizes of 342 bp and 154 bp (homozygous mutant type had another fragment that could not be observed on the gel), and heterozygous type (GC) had three DNA fragments of 530 bp, 342 bp, and 154bp (Figure 2).

Of the 144 participants in the major depressive disorder group, 75 (52.1 %) had homozygous wild type (GG), 59 (41.0%) had heterozygous type (GC), and 10 (6.9%) had homozygous mutant genotype (CC). Of the 105 participants in the control group, 56 (53.3%) had homozygous wild type (GG), 42 (40.0%) had heterozygous type (GC), and 7 (6.7%) had homozygous mutant (CC) genotype. As shown in Table 2, there was no significant difference between the major depressive disorder and control groups after the analysis of genotype and allele frequencies of the Gly389Arg polymorphism in the ADRB I gene (p=0.625; p=0.9 14).

DISCUSSION

Although some studies have investigated the functions of beta-adrenergic receptors in affective disorders, there is little evidence about the polymorphisms of beta-adrenergic receptors in major depressive disorder It is necessary to compare the difference of polymorphisms between patients and controls to investigate the susceptibility to major depressive disorder

There are two known functional polymorphisms of the ADRBI gene: Ser49Gly and Gly389Arg that are located on 10th chromosome (10q24-10q26) (3,9). Zill et al. (9) suggested that there is no relationship between the polymorphism of Gly389Arg and major depressive disorder However this research also showed that beta-1-adrenergic receptor gene influences the antidepressant treatment response in major depression. Stein et al. (10) showed the polymorphisms of Ser49Gly and Gly389Arg to be associated with introvert personalities, social phobia, and depressive disorders. Additionally another study reported that dysfunctional beta-1-adrenergic signaling is found in subjects who are carriers of Ser49 and 389Gly whereas normal function is maintained for subjects who are homozygous for 49Gly/49Gly and 389Arg/389Arg (17).

With this regard, we investigated the polymorphisms and allele frequencies of Ser49Gly and Gly389Arg in a sample of the Turkish population for major depressive disorder The mutant variants that may cause a conformational and functional change in ADRB I receptors were compared between major depressive disorder patients and healthy controls. The mutant genotype (GG) for the Ser49Gly polymorphism was found 6.9% for the major depressive group and 7.6% for the control group. Additionally, the mutant genotype (GG) for the Gly389Arg polymorphism was 6.9% and 6.7% in the major depressive disorder and control groups, respectively Although we found no significant difference between the control and major depressive disorder groups for the Ser49Gly and Gly389Arg polymorphisms, phenotypic complexity in psychiatric disorders should be considered. Conflicting results in literature and our research supports the hypothesis that specific phenotypes can be effective in different depression groups. The heterogeneity of symptoms in major depressive disorder should be an important factor for determining polymorphisms. In a recent study conducted by Veen et al. (I 8), it was found that many gene sets associate with anhedonic depression. Therefore, we should not generalize our results for all types of depression not to be associated with Ser49Gly and Gly389Arg polymorphisms. Additionally all participants in this study were ethnically homogenous, which is an important consideration for generalizing the results.

The patients with a family history of any psychiatric disorder were not enrolled in our study in order to exclude other genetic susceptibilities and to not define the diagnoses according to the statements of the patients. However; this could be another important reason for obtaining negative results. Further longitudinal studies including first-degree relatives with depression would provide more information about Ser49Gly and Gly389Arg polymorphisms.

The limitations of our study are as follows: we did not sample all known variations of the ADRBI receptor genes that would have a small affect or interactions with other genes. The small number of study subjects, sample size of control subjects, and population stratification may affect the study and cause a negative result. We did not apply another scale for depression. Although we included the first episode and medication naive patients to exclude the role of psychotropics and other long-term environmental factors, some patients with first episode of major depression could include those with bipolar disorders.

Finally our preliminary findings do not suggest that the polymorphism of Ser49Gly and Gly389Arg in the ADRB I gene has a major effect on major depressive disorder. Further case control studies by controlling the types of major depressive disorders and including interactions of gene-gene, gene-environment, and other variations with larger sample sizes are required to elucidate the role of beta-1-adrenergic gene polymorphisms in major depressive disorder

DOI: 10.5152/npa.2015.7321

Conflict of Interest: No conflict of interest was declared by the authors.

Financial Disclosure: This study was supported by Scientific Research Projects Comittee of Suleyman Demirel University. (No. 21 80-TU-10 Project)

REFERENCES

(1.) Frielle T Kobilka B, Lefkowitz RJ, Caron MG. Pluman beta 1- and beta 2-adrenergic receptors: structurally and functionally related receptors derived from distinct genes. Trends Neurosci 1989; 11:321-324. [CrossRef]

(2.) Frielle T Collins S, Daniel KW, Caron MG, Lefkowitz RJ, Kobilka BK. Cloning of the cDNA for the human beta 1-adrenergic receptor Proc Natl Acad Sci U S A 1987; 84:7920-7924. [CrossRef]

(3.) Rice JP Goate A, Williams JT Bierut L, Dorr D, Wu W, Shears S, Gopalakrishnan G, Edenberg HJ, Foroud T Nurnberger J Jr. Gershon ES, Detera-Wadleigh SD, Goldin LR, Guroff JJ, McMahon FJ, Simpson S, MacKinnon D, Mclnnis M, Stine OC, DePaulo JR, Blehar MC, Reich T Initial genomes can of the NIMEd genetics initiative bipolar pedigrees: Chromosomes 1, 6, 8, 10, and 12. Am J Med Genet 1997; 74:247-253. [CrossRef]

(4.) Liu ZQ, Liu J, Xiang ZH, Flu MX Mo W, Wang LS, Ou-Yang DS, He N, Wang D, Zhou HH. Distributive characteristics of Ser49Gly and Gly389Arg genetic polymorphisms of |31-adrenoceptor in Chinese Han and Dai populations. Acta Pharmacol Sin 2006; 27:254-258. [CrossRef]

(5.) Taylor MR. Pharmacogenetics of the human beta adrenergic receptors. Pharmacogenomicsj 2007; 7:29-37. [CrossRef]

(6.) Maqbool A, Hall AS, Ball SG, Balmforth AJ. Common polymorphisms of beta I-adrenoreceptor: identification and rapid screening assay. Lancet 1999; 353:897. [CrossRef]

(7.) Taylor MR, Bristol MR. The emerging pharmacogenomics of the beta-adrenergic receptors. Congest Heart Fail 2004; 10:281-288. [CrossRef]

(8.) Mason DA, Moore JD, Green SA, Liggett SB. Again of function polymorphism in a G-protein coupling domain of the human beta 1-adrenergic receptor J Biol Chem 1999; 274:12670-12674. [CrossRef]

(9.) Zill P Baghai TC, Engel R, Zwanzger R Schule C, Minov C, Behrens S, Bottlender R, Jager M, Rupprecht R, Moller HJ, Ackenheil M, Bondy B. Beta-1-Adrenergic Receptor Gene in Major Depression: Influence on Antidepressant Treatment Response. Am J Med Genet B Neuropsychiatr Genet 2003; 120:85-89. [CrossRef]

(10.) Stein MB, Schork NJ, Gelemter J. A Polymorphism of the Beta 1-Adrenergic Receptor Is Associated Mil Lew EXtraversion. Biol Psychiatry 2004; 56:217-224. [CrossRef]

(11.) Kotov R, Gamez W, Schmidt p Watson D. Linking big personality traits to anxiety, depressive, and substance use disorders: a meta-analysis. Psychol Bull 2010; 136:768-821. [CrossRef]

(12.) Hassan M, York KM, Li H, Li Q, Gong Y Langaee TY Fillingim RB, Johnson JA, Sheps DS. Association of beta I-adrenergic receptor genetic polymorphism with mental stress-induced myocardial ischemia in patients with coronal/artery disease. Arch Intern Med 2008; I 68:763-770. [CrossRef]

(13.) Corapcioglu A, Aydemir O, Yildiz M, Esen Danaci A, Koroglu E. DSM-IV Eksen I Ruhsal bozukluklarina gore Turkce yapilandirilmis klinik degerlendirmenin guvenirligi. Ilac ve Tedavi Dergisi 1999; 12:33-36.

(14.) First MB, Spitzer RL, Gibbon M, Williams JBW. Structured Clinical Interview for DSM-IV Axis I Disorders, Clinician Version (SCID-CV). Washington DC: American Psychiatric Press, Inc. 1996.

(15.) Coskunol H, Bagdiken I, Sorias S, Saygili R. SCID-II (Turkce versiyonu) gorusmesinin kisilik bozukluklarindaki guvenilirligi. Turk Psikoloji Dergisi 1994; 9:26-29.

(16.) Maqbool A, Hall AS, Ball SG, Balmforth AJ. Common polymorphisms of beta I-adrenoceptor: Identification and rapid screening assay. Lancet 1999; 353:897. [CrossRef]

(17.) Sandilands AJ, O'Shaughnessy KM. The functional significance of genetic variation within the beta-adrenoceptor Br J Clin Pharmacol 2005; 60:235-243. [CrossRef]

(18.) van Veen T Goeman JJ, Monajemi R, Wardenaar KJ, Hartman CA, Snieder H, Nolte IM, Penninx BW, Zitman FG. Different gene sets contribute to different symptom dimensions of depression and anxiety. Am J Med Genet B Neuropsychiatr Genet 2012; 159B:5 19-528. [CrossRef]

Suleyman KOKUT [1], Inci Meltem ATAY [2], Efkan UZ [3], Abdullah AKPINAR [2], Arif DEMIRDAS [2]

[1] Clinic of Psychiatry, Serik Public Hospital, Antalya, Turkey

[2] Department of Psychiatry, Suleyman Demirel University, Faculty of Medicine, Isparta, Turkey

[3] Department of Biochemistry, Suleyman Demirel University, Faculty of Medicine, Isparta, Turkey

Correspondence Address: Dr Inci Meltem Atay, Department of Psychiatry, Suleyman Demirel University Faculty of Medicine, Isparta, Turkey Phone: +90 532 626 68 52 E-mail: incimeltem@gmail.com

Received: 10.07.2013 Accepted: 05.12.2013

Table 1. Genotype distribution and allele frequencies of the
Ser49Gly polymorphism in the ADRBI gene among patients with
major depression (MD) and controls

                Genotypes

          n     AA n(%)     AG n(%)     GG n(%)

MD        144   77 (53.5)   57 (39.6)   10(6.9)
Control   105   74 (70.5)   23(21.9)    8(7.6)

                p * = 0.626

                Allele frequencies

          n     A n(%)        G n(%)

MD        144   21 1 (73.2)   77 (26.8)
Control   105   74 (70.5)     23(21.9)

                p * = 0.863

* Chi-square test. MD: major depression; AA: homozygous wild
type; AG: heterozygous type; GG: homozygous mutant type; A:
adenine; G: guanine

Table 2. Genotype distribution and allele frequencies of the
Gly389Arg polymorphism in the ADRB I gene among patients
with major depression (MD) and controls

          n     Genotypes

                GG n(%)      GC n(%)      CC n(%)

MD        144   75(52.1%)    59(41.0%)    10(6.9%)
Control   105   56 (53.3%)   42 (40.0%)   7 (6.7%)

                p * = 0.625

          n     Allele frequencies

                G n(%)        C n(%)

MD        144   209 (72.5%)   79 (27.5)
Control   105   154(73.3%)    56 (26.7%)

                p * = 0.914

* Chi-square test. MD: major depression; GG: homozygous wild
type; GC: heterozygous type; CC: homozygous mutant type; G:
guanine; C: cytosine
COPYRIGHT 2015 AVES
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article
Author:Kokut, Suleyman; Atay, Inci Meltem; Uz, Efkan; Akpinar, Abdullah; Demirdas, Arif
Publication:Archives of Neuropsychiatry
Article Type:Report
Date:Jun 1, 2015
Words:3196
Previous Article:What are the predictors of death in patients with cranio-cervical artery dissection?
Next Article:Turkish version study of "Parkinson's Disease Quality of Life Questionnaire" (PDQL).
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |