Printer Friendly

The modulating effect of Persea americana fruit extract on the level of expression of fatty acid synthase complex, lipoprotein lipase, fibroblast growth factor-21 and leptin--A biochemical study in rats subjected to experimental hyperlipidemia and obesity.

ABSTRACT

Background: Obesity is a multifactorial disorder which is closely associated with hyperlipidemia. Avocados are edible fruits traditionally consumed for various health benefits including body weight reduction. Hypothesis/purpose: To determine the hypolipidemic and anti-obesity effect of hydro-alcoholic fruit extract of avocado (HFEA) in rats fed with high fat diet (HFD).

Study design: Male Sprague Dawley rats were divided into four groups. Groups 1 and 2 rats were fed with normal diet. Groups 3 and 4 rats were fed with HFD for 14 weeks. In addition, Groups 2 and 4 rats were co-administered with 100 mg/kg body weight of HFEA from 3rd week onwards.

Methods: The HFEA was subjected to HPLC to quantify the major phytonutrients. Body mass index (BMI), adiposity index (ADI), total fat pad mass (TFP), blood lipid levels were determined in all the groups of rats. The mRNA expression of fatty add synthase (FASN), lipoprotein lipase (LPL), fibroblast growth factor 21 (FGF21) and leptin was also assessed.

Results: HFEA was found to contain flavonoids: rutin-141.79, quercetin-5.25, luteolin-165, phenolic compounds: gallic acid-198.57, ellagic acid-238.22, vanillic acid-4.79 and phytosterols: betasitosterol-70, stigmasterol-12.5 (mg/100 g). HFEA reduced BMI, ADI, TFP, blood cholesterol, triglycerides, and LDL in rats fed with HFD. Serum leptin was found reduced in HFEA co-administered rats. The mRNA expression of FASN, LPL, and leptin in subcutaneous and visceral adipose tissue was found to be significantly reduced in HFEA coadministered rats. The gene expression of fibroblast growth factor-21 (FGF21) was found to be significantly increased in HFEA treated rats when compared to HFD control rats.

Conclusion: The hypolipidemic effect of HFEA may be partly due to its modulating effect on endogenous fat synthesis and adiponectin formation through the transcription factor FGF21. The results also show that avocado fruit extract has profound influence on leptin activity, which controls satiety and hunger to regulate the food intake.

Keywords:

Hyperlipidemia

Fatty acid synthase

Leptin

Fibroblast growth factor-21

Adiponectin

Lipoprotein lipase

Introduction

Obesity because of hyperlipidemia, a chronic metabolic disorder is being characterized by enlarged fat mass and increased blood lipid levels. Obesity is a complex trait influenced by diet, age, physical activity, and gene level expression of key enzymes involved in lipid metabolism (Brockmann and Bevova 2002). Obesity has been caused by eating too much with fewer mechanical work. Increased adipose tissue mass is the primary phenotypic characteristic of obesity. Adipose tissue, the largest storage site for triglycerides, plays an important role in energy homeostasis. In humans, adipose tissue is found beneath the skin (subcutaneous fat) and around internal organs (visceral fat). The number and distribution of adipose tissue will cause adverse effects such as hyperlipidemia, cardiovascular disease, and type 2 diabetes (Hurt et al. 2010). Therefore prevention and treatment of obesity are important for healthy life.

Adipose tissue is now recognized not only as a lipid storage site, but also as an active endocrine organ that secretes numerous adipocytokines. Leptin is a cytokine-like hormone released from white adipose tissue in direct proportion to fat mass (Friedman and Halaas 1998). Activation of hypothalamic leptin receptors suppresses food intake and promotes energy expenditures (Singla et al. 2010).

Obesity is associated with decreased lipolysis in adipose tissue. Increased activity of the lipogenic enzymes in adipose tissue may contribute to develop obesity. The gene encoding fatty acid synthase (FASN), a central enzyme in lipogenesis acts as a candidate gene for determining body fat mass. Increased FASN expression links metabolic changes of excess energy intake, including hyperinsulinemia, dyslipidemia and altered adipokine profile to increased body fat mass (Berndt et al. 2005).

Lipoprotein lipase (LPL) is a multifunctional enzyme produced by many tissues, including adipose tissue, cardiac and skeletal muscle, islets, and macrophages. Major role of LPL include the hydrolysis of TG-rich lipoproteins and the release of non-esterified fatty acids, used for metabolic energy in peripheral tissue such as muscle, or esterified into TG and stored in adipose tissue. LPL mRNA is found in human adipose tissue, and also in muscle, adrenal, kidneys, intestine, and neo-natal, but not in adult liver (Semenkovich et al. 1989).

Fibroblast growth factor 21 (FGF21) is a key mediator of fatty acid oxidation and lipid metabolism. Pharmacological doses of FGF21 improve glucose tolerance, and lower serum free fatty acids, and lead to weight loss in obese mice (Fisher et al. 2010).

Only a few drugs such as statins are well approved for their hypolipidemic activity. The ever increasing incidence of obesity demands the investigation of more reliable herbal drugs. Therefore, much attention is focused on natural products, which may increase fat oxidation, decrease fatty acid biosynthesis and reduce the fat mass. Traditionally, fruits are consumed for preventing various health problems including diabetes and obesity. Recent research has also indicated that fruits such as Garcinia indica, litchi, durian, jackfruit, mangosteen, acai, pomegranate, avocado, persimmon, guava, and blueberry possess potent medicinal values (Baliga et al. 2011).

Avocado, the only edible fruit of the family Lauracea, has been reported to have antibacterial, antifungal, hypotensive, anti-inflammatory, and immune-enhancing properties (Adeyemi et al. 2002). Avocados contain monounsaturated fatty acids, dietary fiber and essential phytonutrients (Fulgoni et al. 2013). Avocado-enriched diet is used to improve lipid profile in healthy and also in mild hypercholesterolemic patients, with or without hypertriglyceridemia (Lopez Ledesma et al. 1996). Hence the present study focused on evaluating the effect of hydro-alcoholic fruit extract of avocado on the gene level expression of FASN, LPL, FGF21, and leptin, which play important role in regulating lipid metabolism at the event of diet-induced hyperlipidemia.

Materials and methods

Chemicals and reagents

Assay kit for leptin (ab100773) from Abeam, Kolkata, India, Assay kits for total cholesterol and HDL (AA05-Cholesterol LS), triglyceride (AA18-Triglyceride LS) from Ensure Biotech Pvt Ltd, Hyderabad, India, RNeasy lipid tissue kit from Qiagen, USA and cDNA reverse transcription kit from Applied Biosystems-USA were used in this study. All other chemicals and reagents used were of analytical grade.

Preparation of hydro-alcoholic fruit extract of avocado (HFEA)

Fresh avocados were collected from Pallangi Village in Kodaikanal Hills (Tamil Nadu, India) during the period from October 2012 to February 2013 and authenticated by the plant taxonomist Dr. P. Jayaraman, Director, Plant Anatomy Research Centre (PARC), Chennai. The voucher specimen was deposited in the Department of Biochemistry, Bharathi Women's College, Chennai (Ref. no: PARC/2013/1458) for future reference. The seed was removed and the edible portion of the fruit (250 g) was chopped into small pieces, finely minced and repeatedly extracted using 70% ethanol (1:4). The extract was concentrated under reduced pressure by a rotary vacuum evaporator (Equitron-Medica Instrument MFC Co., Chennai) and the thick syrupy mass lyophilized (Lark Techno Knowledge, Chennai). The yield was found to be 7.379 g. Herb:extract ratio was calculated. We found that 33.87 g of avocado fruit pulp was required to obtain 1 g of the extract. Working concentrations of the drug were prepared using distilled water just before use.

High performance liquid chromatography (HPLC) analysis of HFEA

HPLC analysis was carried out for the quantitative determination of phytonutrients in HFEA.

Solid phase extraction and fractionation of phenolic acids using C18 column

Phenolic acids of HFEA was fractioned using a C18 Hypersil Gold Column (5 [micro]m, 150 x 4.6 mm). Reverse-phase HPLC (RP-HPLC) was carried out with the resulting fraction. Octadecylsilyl silica gel and A--phosphoric acid:water (0.5:99.5 v/v), B--acetonitrile were used as stationary and mobile phases, respectively. Gallic acid, coumaric acid, ellagic acid, ferulic acid, mandelic acid and vanillic acid were used as reference standards. For 20 [micro]l sample, a UV detector was set at 220 nm with a flow rate of 1.0 ml/min.

Fractionation of flavonoids

The presence of various flavonoids in HFEA was determined by HPLC technique (System name: LACHROM L-7000 MERCK, Proc. Method-HITACHI). Octadecylsilyl silica gel was used as stationary phase and acetonitrile, and sodium dihydrogen phosphate with dilute orthophosphoric acid as mobile phase. For reference rutin, quercetin, galangin and luteolin standards were used. For 10 [micro]; sample, the UV detector was set at 350 nm with a flow rate of 0.5 ml/min.

Fractionation of phytosterols

HFEA was subjected to gas liquid chromatography (GLC) for the fractionation of phytosterols. The analyses was done using a Waters Atlantis dC18,5 [micro]m, 150 x 2.1 mm column with a gradient of acetonitrile/water (0.01% acetic acid) at a flow rate of 0.5 ml/min and a column temperature of 30[degrees]C. Mobile phase: helium gas (99.99% purity) at a flow speed of 0.8 ml/min, and split ratio of 1:50. For 1 [micro]l sample, the temperature was set at 280[degrees]C. Column temperature: from 260 to 290[degrees]C at the rising speed of 10[degrees]C/min. Ionization mode: EI+. Electron energy: 70 eV. Interface temperature: 250[degrees]C. Ion source temperature: 200[degrees]C. Detection voltage: 350 V. Cholesterol, brassicasterol, stigmasterol, campesterol, and /3-sitosterol were used as reference standard.

Experimental animals

Male Sprague Dawley rats (175-200 g) kept in a temperature controlled (22 [+ or -] 2[degrees]C) environment with relative humidity of 44-55% under 12 h light/dark cycle. Diet and water were provided ad libitum.

Composition of hypercaloric/cafeteria/high fat diet (HFD)

The standard pellet diet was purchased from M/s Provimi Animal Nutrition India Pvt. Ltd. (Bangalore, India) which contains protein25%, carbohydrate-68.3%, fat-4.3%, and vitamins and minerals-2.7%. Ground labina-439, roasted peanut-215, casein-129, corn oil-61, French-fried potatoes-153, vitamins and minerals-3 (g/kg) were the ingredients used for preparing HFD (protein-28%, carbohydrate36%, fat-23%, vitamins, minerals, cinders, and water-13%). The finely ground ingredients were made into pellets and dried (Nascimento et al. 2008). The normal diet gives 3.48 kcal/g energy and HFD gives 4.6 kcal/g energy.

Experimental protocol

The animals were divided into four groups. Groups 1 and 2 rats were used as control and fed with normal diet. Groups 3 and 4 rats received HFD for 14 weeks. In addition, Groups 2 and 4 rats received 100 mg/kg body weight of HFEA from the 3rd week. The study protocol was approved by Institutional Animal Ethics Committee (IAEC-XIV/VELS/COL/43/CPCSEA/IAEC/15.07.2013). Once in a week, body weight was measured and BMI was calculated using the formula: BMI = weight (g)/[l.sup.2] (nose-anus) ([cm.sup.2]). At the end of the experimental period, rats were anesthetized by injecting 0.1 ml/100 g body weight of ketamine/xylazine mixture prepared by combining 1.5 ml of 100 mg/ml xylazine and 10 ml of 100 mg/ml ketamine and killed by cervical decapitation. Immediately, blood was collected and plasma/serum was separated and stored at 4[degrees]C until analysis. Adipose tissue (epididymal, visceral and retroperitoneal fat pads) was isolated, weighed and the total fat pad mass was determined. Adiposity index (ADI) was also determined by using the formula: (sum of total fat pad mass/body weight) x 100 and expressed as adiposity percent (%).

Biochemical analysis

The levels of serum total cholesterol, triglycerides, HDL and LDL were determined according to the kit protocol (Ensure Biotech Pvt Ltd, Hyderabad, India). Serum leptin level was quantified using commercial ELISA kit (Abeam, Kolkata, India).

Quantitative RT-PCR analysis

Total RNA was extracted from frozen adipose tissue (RNeasy lipid tissue mini kit) and quantified. According to the high-capacity cDNA reverse transcription kit protocol, reverse transcription reactions were performed with total RNA. For real-time PCR, an ABI PRISM Sequence Detection System 7700 (Applied Biosystems, USA) was used. The primer sequences used for the RT-PCR analysis such as FASN, LPL, Leptin and FGF21 areshown in Table 1. RT-PCR was performed as follows: 40 cycles of 95[degrees]C for 20 s (denaturation), 55[degrees]C for 30 s (annealing) and 60[degrees]C for 30 s (extension). GAPDH gene was used as an internal control. Ct values obtained were used to quantify mRNA expression.

Statistical analysis

Data were analyzed using a commercially available statistics software package (SPSS for window V.10). The statistically significant variation between different groups was determined by applying one way ANOVA with post-hoc Bonferroni test and the p Value < 0.05 was considered significant.

Results

HPLC-UV analysis of HFEA

Fractionation of phenols

The HPLC-UV chromatogram of HFEA showed the presence of four peaks at 220 nm with the retention time of 30.9, 35.9, and 43.2, respectively (Fig. 1b). The UV spectra of these peaks together with the analysis of retention time of standards (Fig. 1a and b) showed the presence of gallic acid (198.57 mg/100 g), ellagic acid (238.22 mg/100 g) and vanillic acid (4.79 mg/100 g). The total phenolic compounds were found to be 312.04 mg/100 g (Table 2).

Fractionation of flavonoids

The UV spectra of the flavonoids in HFEA by most reliable technique HPLC after extracting the flavonoid using the C18 Hypersil gold column, are shown in Fig. 1c and d. We have noted the presence of flavonoids in decreasing order of concentration of luteolin (165 mg/100 g) > rutin (141.79 mg/100 g) > quercetin (5.25 mg/100 g). The total flavonoid concentration noted was 441.58 mg/100 g (Table 2).

Extraction of phytosterols

Gas chromatography (GC) is the best and most widely used tool for the chromatographic separation, identification, and quantification of phytosterols. GC (Fig. le and f) has confirmed the presence of [beta]-sitosterol (70 mg/100 g) and stigmasterol (12.5 mg/100 g) as shown in Table 2.

Effect of HFEA on BMI, TFP, ADI and serum leptin level

Table 3 shows the BMI, TFP, ADI, and serum leptin level in control and experimental rats. There was a significant (p = 0.000) increase in the BMI of HFD control rats when compared to normal dietfed rats. HFEA-co-administered rats showed a significant decrease in BMI. Comparatively, TFP and ADI were also found to be significantly (p = 0.000) decreased in HFD + HFEA rats. There was a significant decrease in serum leptin level in HFEA-co-administered rats when compared to HFD control rats.

Effect of HFEA on blood lipids

Serum TC, TG, and LDL concentrations in HFD control rats were significantly increased (p = 0.000) and HDL level was significantly decreased when compared to normal rats (Table 4). HFEA effectively decreased the plasma TC, TG, and LDL levels and increased HDL level significantly (p = 0.001) in HFD + HFEA-fed rats.

Effect of HFEA on the expression of FASN and LPL in SAT and VAT

Expression of lipogenesis-related gene (FASN) and fatty acid oxidation-related gene (LPL) was measured by RT-PCR in SAT and VAT (Figs. 2 and 3). Expression of FASN mRNA expression in HFD control group was significantly (p = 0.000) higher than in normal diet group.

HFEA significantly (p = 0.000) suppressed the FASN mRNA expression when co-administered with HFD in both SAT and VAT. LPL gene expression was found to be significantly greater in HFD control group compared to normal rats. The mRNA LPL expression was found to be significantly decreased (p = 0.000) in HFD + HFEA group than in HFD control rats, which confirms that HFEA actively takes part in decreasing fat deposition in subcutaneous and visceral regions, a major contributor of abdominal obesity.

Effect of HFEA on the expression of FGF21 in SAT and VAT

Fig. 4 shows the mRNA expression of FGF21, a circulating hepatokine that favourably affects carbohydrate and lipid metabolism. FGF21 expression was found to be significantly (p = 0.000) lower in SAT and VAT of HFD rats. HFEA co-administration significantly (p = 0.000) increased the FGF21 gene expression in HFD + HFEA groups, therefore decreasing the adipocyte differentiation in obese condition.

Effect of HFEA on the expression ofleptin in SAT and VAT

Fig. 5 shows the mRNA expression of leptin, a most important adipocytokine in SAT and VAT of experimental rats. Leptin gene expression was significantly (p = 0.000) increased in HFD rats when compared to control rats. In SAT and VAT, leptin expression was found to be reduced in HFEA control and HFD + HFEA group of rats.

Discussion

Obesity, a life-threatening disease, is the fifth leading cause of death worldwide, with more than 2.8 million adults dying each year because of being overweight or obese (World Heart Federation, 2014). Obesity is defined as an increase in adipocyte number (hyperplasia) and size (hypertrophy).

Bioactive compounds, naturally occurring in fruits and vegetables have enormous potential in regulating adipocyte biology and thus studied for possible anti-obesity effects, based on that reduce food intake or fat absorption, promotes energy expenses, or prevents energy storage. In this study, the anti-obesity effect of avocado was determined by anthropometric measures such as BMI, TFP mass and ADI. BMI is just one signal of potential health risks associated with being overweight or obese. BMI is closely related to both percentage body fat and TFP mass (Gray 1991). In this study, it has been found that HFEA reduced the TFP and ADI significantly and the same is reflected in BMI (Table 3).

Flavonoids are plant pigments that have favourable metabolic effects because of their antioxidant powers. They have multiple targets including lowering blood pressure, reducing body weight, and preventing dyslipidemia (Tohill et al. 2004). Rutin, a glycosylated flavonoid widely spread in various plants, have beneficial effects on the cardiovascular diseases, possibly due to its antioxidant and anti-inflammatory properties (Middleton-Junior et al. 2000). Rutin prevents hyperlipidemia induced by high cholesterol diet (Al-Rejaie et al. 2013). Park et al. (2002) have also reported that rutin promote the excretion of fecal sterols, decrease the absorption of dietary cholesterol and lower the plasma and hepatic cholesterol concentration.

Quercetin exhibits a wide range of biological role with anticarcinogenic, anti-inflammatory and anti-viral properties. Hsu and Yen (2006) reported that incubating adipocytes with quercetin led to a fall in triacylglycerol content. Luteolin is a food-derived flavonoid present in medicinal plants and in some vegetables and spices. A recent review has provided evidence on the antioxidant, antiinflammatory, and antiallergic role of luteolin (Lin et al. 2008). The potential lipid-lowering effect observed in the present study might be due to the presence of these flavonoids in avocado fruit extract.

Natural phenolic acids present in plants provide many health benefits. Gallic acid (3,4,5-trihydroxybenzoic acid), a naturally rich phenolic compound exhibits hypolipidemic effect against mouse model of high fat diet induced obesity (Jang et al. 2008). HPLC-UV-spectra confirmed that P. americana is rich in ellagic acid. Ellagic acid is a phytochemical that can occur naturally in foods, and it is also a breakdown product of ellagitannins in intestines. Absorption of ellagic acid from food occurs quite rapidly, with maximum levels in blood after about 1 h. Ellagic acid has been shown to reduce blood cholesterol level in experimental model of hyperlipedemia (Maruthappan and Shakti Shree 2010).

HFEA is also found to contain vanillic acid, a benzoic acid derivative, which is a flavoring agent. It is an oxidized form of vanillin produced on converting vanillin to ferulic acid. It is well-known that obesity and hyperlipidemia are associated with inflammatory reactions. Various studies have provided evidence for the effectiveness of vanillic acid to manage immune or inflammatory responses (Lesage-Meessen et al. 1996).

Phytosterols are the plant analogs of cholesterol, which could act as anti-choleserolemic agents. The cholesterol-lowering effect of phytosterols involves inhibition of intestinal cholesterol absorption as well as reduction in hepatic cholesterol synthesis (Moghadasian and Frohlich 1999). The presence of beta-sitosterol and stigmasterol in HFEA confirmed by GC might have reduced the blood cholesterol and LDL in HFEA-co-administered rats.

Abdominal obesity is a major risk factor for diabetes and cardiovascular disease (Cornier et al. 2011). Excess VAT and SAT are key contributors to abdominal obesity but differ in their structural composition and metabolic significance (Bays et al. 2008). Small adipocytes in SAT play a powerful role as a buffer and involve in cellular uptake of circulating free fatty acids and TGs in the postprandial period. Fat increase in tissues promotes redistribution of free fatty acids to ectopic tissues such as VAT, liver, and skeletal muscle, predisposing to increased metabolic risk (Tan and Vidal-Puig 2008). VAT and SAT also differ in cytokine secretion profile such as leptin, adiponectin, interleukin-6, interleukin-8, plasminogen activator inhibitor 1, and angiotensin, which may play a significant role in developing metabolic syndrome (Yang and Smith 2007).

To uphold lipid homeostasis, adipocytes perform Iipogenesis or lipolysis. These two processes are regulated by hormones, lipid metabolites, and nutritional factors. Fatty acid synthase, lipoprotein lipase, FGF21, and leptin gene expression was studied in both SAT and VAT. Fatty acid synthase, a large multifunctional enzyme complex, initiates the synthesis of fatty acids in a cyclical reaction sequence. Ahn et al. (2008) also showed that quercetin decreased the sterol regulatory element-binding proteins (SREBP)-l and FASN with accompanying increase in acetyl-CoA carboxylase. A significant downregulation of FASN gene expression (Fig. 2) in HFD + HFEA-fed animals might have contributed for the lipid-lowering effect of avocado fruit extract rich in flavonoids (quercetin) and phytosterols (betasitosterol).

Lipoprotein lipase plays a vital role in the metabolism of lipids and lipoproteins. Major role of LPL includes the hydrolysis of TG-rich lipoproteins. The present study reveals that avocado fruit extract decreases the release of TG from lipoproteins and prevents their deposition in adipose tissue.

Leptin is a satiety hormone formed in fat cells to regulate the fat storage in the body. It regulates the sensation of hunger and energy expenditure. Fried et al. (2000) suggested that basal leptin level can be positively correlated with body fat. The report also showed that leptin might contribute to hepatic steatosis by promoting insulin resistance and by altering insulin signaling in hepatocytes, to promote influx of intracellular fatty acids (Uygun et al. 2000). The results show that avocado fruit extract reduces the pathogenesis of obesity probably by decreasing the level of leptin and reducing the calories from the diet.

Fibroblast growth factor-21 is an important transcription factor from the fibroblast growth factor family, produced by liver and adipose tissue and regulates lipid metabolism. It was shown that adiponectin is a downstream regulator of FGF21 and treatments with FGF21 improved both expression and secretion of adiponectin in adipocytes, increasing serum levels of adiponectin in mice (Lin et al. 2013). Co-administration of HFEA increased the expression of FGF21 in both SAT as well as in VAT which might have resulted in increased adiponectin formation and thereby reduced ADI. Expression and secretion of both adiponectin and FGF21 induced in adipose tissue might be due to the activation of peroxisome proliferator-activated receptor [gamma] (PPAR-[gamma]), a nuclear hormone receptor that has an important role in adipose tissue homeostasis. Therefore the results of the present investigation confirm that avocado fruit has promising effect in reducing the fat mass.

Conclusion

It is concluded that avocados have potent hypolipidemic property probably by altering the gene level expression of fatty acid synthase complex, lipoprotein lipase, FGF21, and leptin in visceral and subcutaneous adipose tissue. The presence of phytonutrients such as ellagic acid, gallic acid, vanillic acid, luteolin, quercetin, rutin, [beta]-sitosterol and stigmasterol might be accounted for the anti-obesity effect of avocados.

Conflict of interest

The authors declare no conflict of interest.

Abbreviations: HFEA, hydroalcoholic fruit extract of avocado; HFD, high fat diet; FGF21, fibroblast growth factor 21; FASN, fatty acid synthase; LPL, lipoprotein lipase; PPAR-y, peroxisome proliferator activated receptor y; BMI, body mass index; ADI, adiposity index; TFP, total fat pad; RP-HPLC, reverse phase-high performance liquid chromatography; GLC, gas liquid chromatography; HDL, high density lipoprotein; LDL, low density lipoprotein; SAT, subcutaneous adipose tissue; VAT, visceral adipose tissue.

ARTICLE INFO

Article history:

Received 21 November 2014

Revised 25 June 2015

Accepted 1 July 2015

Acknowledgment

The authors thank Indian Council of Medical Research-Senior Research Fellowship IRIS ID No: 2014-22230, New Delhi, India for the financial support to carry out the work.

References

Adeyemi, O.O., Okpo, S.O., Ogunti, O.O., 2002. Analgesic and anti-inflammatory effects of some aqueous extracts of leaves of Persea americana Mill (Lauraceae). Fitoterapia 73,375-380.

Ahn, J., Lee, H., Suna, K., Park, J., Ha, T., 2008. The anti-obesity effect of quercetin is mediated by the AMPK and MAPK signaling pathways. Biochem. Biophy. Res. 373, 545-549.

Al-Rejaie, S.S., Aleisa, A.M., Sayed-Ahmed, M.M., AL-Shabanah, O.A., Abuohashish, H.M., Ahmed, M.M., Al-Hosaini, K.A., Hafez, M.M., 2013. Protective effect of rutin on the antioxidant genes expression in hypercholestrolemic male Wistar rat. BMC Complement. Altern. Med. 13,136.

Baliga, M., Bhat, H., Pai, R., Boloor, R., Palatty, P., 2011. The chemistry and medicinal uses of the underutilized Indian fruit tree Garcinia indica Choisy (kokum): a review. Food Res. Int. 44,1856-1865.

Bays, H.E., Gonzalez-Campoy, J.M., Bray, GA, Kitabchi, A.E., Bergman. D.A., Schorr, A.B., Rodbard, H.W., Henry, R.R., 2008. Pathogenic potential of adipose tissue and metabolic consequences of adipocyte hypertrophy and increased visceral adiposity. Expert Rev. Cardiovasc. Ther. 6,343-368.

Berndt, J., Rioting, N., Kralisch, S., Kovacs, P., Fasshauer, M., Schon, M.R., Stumvou, M., Bluhe, M., 2005. Plasma visfatin concentrations and fat depot-specific mRNA expression in humans. Diabetes 54,2911-2916.

Brockmann, GA. Bevova, M.R., 2002. Using mouse models to dissect the genetics of obesity. Trends Genet. 18,367-376.

Cornier, M.A., Despres, J.P., Davis, N., et al., 2011. Assessing adiposity: a scientific statement from the American Heart Association. Circulation 124,1996-2019.

Fisher, F.M., Chui, P.C., Antonellis, P.J., Bina, H.A., Kharitonenkov, A., Flier, J.S., Maratos-Flier, E., 2010. Obesity is a fibroblast growth factor 21 (FGF21)-resistant state. Diabetes 59,2781-2789.

Fried, S.K., Ricci, M.R., Russell, C.D., Laferrere, B., 2000. Regulation of leptin production in humans. J. Nutr. 130,3127S-3131S.

Friedman, J.M., Halaas.J.L., 1998. Leptin and the regulation of body weight in mammals. Nature 395,763-770.

Fulgoni, V.L., Dreher, M., Davenport, A.J., 2013. Avocado consumption is associated with better diet quality and nutrient intake, and lower metabolic syndrome risk in US adults: results from the National Health and Nutrition Examination Survey (NHANES) 2001-2008. Nutr.J. 12,1.

Gray, D.S., Fujioka, K., 1991. Use of relative weight and body mass index for the determination of adiposity. J. Clin. Epidemiol. 44, 545-550.

Hsu, C.L., Yen, G.C., 2006. Induction of cell apoptosis in 3T3-L1 pre adipocytes by flavonoids is associated with their antioxidant activity. Mol. Nutr. Food Res. 50, 1072-1079.

Hurt, R.T., Kulisek, C, Buchanan, LA, McClave, SA, 2010. The obesity epidemic: challenges, health initiatives, and implications for gastroenterologists. Gastroenterol. Hepatol. 6,780-792.

Jang, A., Srinivasan, P., Lee, N.Y., Song, H.P., Lee, J.W., Lee, M., Jo, C, 2008. Comparison of hypolipidemic activity of synthetic gallic acid-linoleic acid ester with mixture of gallic acid and linoleic acid, gallic acid, and linoleic acid on high-fat diet induced obesity in C57BL/6 Cr Sic mice. Chem. Biol. Interact. 174,109-117.

Lesage-Meessen, L, Deiattre, M., Haon, M., Thibault, J.F., Ceccaldi, B.C., Brunerie, P., Asther, M., 1996. A two-step bioconversion process for vanillin production from ferulic acid combining Aspergillus nigerand Pycnoporus cinnabarinus. J. Biotechnol. 50,107-113.

Lin, Z., Tian, H., Lam, K.S., Lin, S., Hoo, R.C., Konishi, M., Itoh, N., Wang, Y., Bornstein, S.R., Xu, A., Li, X., 2013. Adiponectin mediates the metabolic effects of FGF21 on glucose homeostasis and insulin sensitivity in mice. Cell Metab. 7,779-789.

Lin, Y., Shi, R., Wang, X., Shen, H.M., 2008. Luteolin, a flavonoid with potential for cancer prevention and therapy. Curr. Cancer Drug Targets 8,634-646.

Lopez Ledesma, R.. Frati Munari, A.C., Hernandez Dominguez, B.C.. Cervantes Montalvo, S., Hernandez Luna, M.H., Juarez, C, Moran Lira, S., 1996. Monounsaturated fatty acid (avocado) rich diet for mild hypercholesterolemia. Arch. Med. Res. 27, 519-523.

Maruthappan, V., Sakthi Shree, K, 2010. Hypolipidemic activity of haritaki (Terminada chebula) in atherogenic diet induced hyperlipidemic rats. J. Adv. Pharm. Technol. Res. 1,229-235.

Middleton-Junior, E., Kandaswami, C, Theoharides, T.C., 2000. The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease and cancer. Pharmacol. Rev. 52,673-751.

Moghadasian, M.H., Frohlich, J.J., 1999. Effects of dietary phytosterols on cholesterol metabolism and atherosclerosis (clinical and experimental evidence). Am. J. Med. 107,588-594.

Nascimento, A.F., Sugizaki, M.M., Leopoldo, A.S., Lima-Leopoldo, A.P., Luvizotto, R.A., Nogueira, C.R., Cicogna, A.C., 2008. A hypercaloric pellet-diet cycle induces obesity and co-morbidities in Wistar rats. Arq. Bras. Endocrinol. Metab. 52, 968974.

Park, S.Y., Bok, S.H., Jeon, S.M., Park, Y.B., Lee, S.J.Jeong, T.S., Choi, M.S., 2002. Effect of rutin and tannic acid supplements on cholesterol metabolism in rats. Nutr. Res. 22, 283-295.

Semenkovich, C.F., Chen, S.H., Wims, M., Luo, C.C., Li, W.H., Chan, L, 1989. Lipoprotein lipase and hepatic lipase mRNA tissue specific expression, developmental regulation, and evolution. J. Lipid Res. 30,423-431.

Singla. P., Bardoloi, A., Parkash, A.K., 2010. Metabolic effects of obesity: a review. World J. Diabetes 15,76-88.

Tan, C.Y., Vidal-Puig, A., 2008. Adipose tissue expandability: the metabolic problems of obesity may arise from the inability to become more obese. Biochem. Soc. Trans. 36,935-940.

Tohill, B.C., Seymour, J., Serdula, M., Kettel-Khan, L, Rolls, B.J., 2004. What epidemiologic studies tell us about the relationship between fruit and vegetable consumption and body weight? Nutr. Rev. 62,365-374.

Uygun, A., Kadayifci, A., Yesilova, Z., et al., 2000. Serum leptin levels in patients with nonalcoholic steatohepatitis. Am. J. Gastroenterol. 95,3584-3589.

World Heart Federation-World Congress of Cardiology-25x25: At the heart of Global Health, Scientific Session 4-7 May 2014, Melbourne, Australia.

Yang, X., Smith, U, 2007. Adipose tissue distribution and risk of metabolic disease: does thiazolidinedione-induced adipose tissue redistribution provide a clue to the answer? Diabetologia 50,1127-1139.

Padmanabhan Monika, Arumugam Geetha *

Department of Biochemistry, Bharathi Women's College, Broadway, Chennai 600108, India

* Corresponding author. Tel.: +91 9444902506; fax: +91 44 25286411.

E-mail address: geethaugc2014@gmail.com, geethav21@yahoo.co.in (A. Geetha).

http://dx.doi.Org/10.1016/j.phymed.2015.07.001

Table 1
Primer sequence.

S. no.   Gene     Primer sequence

                  Forward (5'-3')           Reverse (5'-3')

1        FASN     GAGTCTGTCTCCCGCTTGAC      CCCTCCAGCATCTACACOT
2        LPL      GGAGGTCGCCACAAATAAAA      CTGACCAGCGGAAGTAGGAG
3        Leptin   GAGACCTCCTCCATCTGCTG      CATTCAGGGCTAAGCTCCAA
4        FGF21    GCCAACAACCAGATGGAACT      GCAAAGGCTCTACCATGCTC
5        GAPDH    CAAGGTCATCCATGACAACTTTG   CTCCACCACCCTGTTGCTGTAG

Table 2
Concentration of flavonoids, phenolic acids and
phytosterols in HFEA.

S. no            Phytochemicals    mg/100 g of HFEA
Flavonoids
1                Rutin             141.79
2                Quercetin           5.25
3                Luteolin          165
Phenolic acids
4                Gallic acid       198.57
5                Ellagic acid      238.22
6                Valinic acid        4.79
Phyto sterols
7                Beta-sitosterol    70
8                Stigmasterols      12.5

Table 3
Effect of HFEA on body mass index (BMI), total fat pad mass
(TFP), adiposity index (ADI) and serum leptin level.

Groups            BMI (g/[cm.sup.2])      TFP (g)

Control           0.68 [+ or -] 0.08      13.6 [+ or -] 1.62
HFEA control      0.57 [+ or -] 0.07 NS   12.7 [+ or -] 1.60 NS
HFD               1.52 [+ or -] 0.19 *    24.9 [+ or -] 3.41 *
HFD + HFEA (100   0.91 [+ or -] 0.10 *    18.3 [+ or -] 2.12 *
  mg/kg b.wt)

Groups            ADI (%)                 Leptin (ng/ml)

Control           4.97 [+ or -] 0.70      17.46 [+ or -] 1.76
HFEA control      4.48 [+ or -] 0.55 NS   15.23 [+ or -] 2.09 NS
HFD               6.84 [+ or -] 0.79 *    48.69 [+ or -] 7.16 *
HFD + HFEA (100   5.32 [+ or -] 0.63 *    34.71 [+ or -] 4.27 *
  mg/kg b.wt)

Data were analyzed by one way ANOVA followed by post-hoc
Bonferroni test. Values are expressed as mean [+ or -] SD for 6
animals in each group. Statistical significance was calculated by
comparing control vs HFEA control, control vs HFD, HFD vs HFD +
HFEA.

* p = 0.000, NS = non-significant.

Table 4
Effect of HFEA on serum total cholesterol (TC),
triglyceride (TG) and lipoprotein level.

Groups            TC (mg/dl)                  TG (mg/dl)

Control            68.72 [+ or -] 9.28         92.3 [+ or -] 9.32
HFEA control       61.14 [+ or -] 7.46 NS      84.6 [+ or -] 11.59 NS
HFD               123.44 [+ or -] 17.76 *     137.1 [+ or -] 14.94 *
HFD + HFEA (100    92.54 [+ or -] 11.10 (#)    97.4 [+ or -] 10.81 *
  mg/kg b.wt)

Groups            HDL (mg/dl)              LDL (mg/dl)

Control           24.3 [+ or -] 3.11       14.7 [+ or -] 1.70
HFEA control      26.4 [+ or -] 3.67 NS    12.9 [+ or -] 1.38 NS
HFD               16.9 [+ or -] 2.06 *     23.5 [+ or -] 2.65 *
HFD + HFEA (100   20.8 [+ or -] 2.93 (#)   18.4 [+ or -] 2.01 *
  mg/kg b.wt)

Data were analysed by one way ANOVA followed by post-hoc
Bonferroni test. Values are expressed as mean [+ or -] SD for 6
animals in each group. Statistical significance was calculated by
comparing control vs HFEA control, control vs HFD, HFD vs HFD +
HFEA.

* p = 0.000

(#) p = 0.001, NS = non-significant.
COPYRIGHT 2015 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Monika, Padmanabhan; Geetha, Arumugam
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Sep 15, 2015
Words:5457
Previous Article:Tanshinone IIA enhances the effects of TRAIL by downregulating survivin in human ovarian carcinoma cells.
Next Article:Cytotoxicity of a naturally occurring furoquinoline alkaloid and four acridone alkaloids towards multi-factorial drug-resistant cancer cells.
Topics:

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters