Printer Friendly

The expression of the A6 fatty acyl desaturase-like gene from Pacific white shrimp (Litopenaeus vannamei) under different salinities and dietary lipid compositions.

ABSTRACT The synthesis of highly unsaturated fatty acids (HUFAs) from C18 fatty acids in the Pacific white shrimp, Litopenaeus vannamei, has long been debated in terms of the limited capacity or even the existence of fatty acid desaturase and elongase. In the present study, a A6 fatty acyl desaturase (Fad)-like gene was identified and characterized with a full length of 1,491 bp, including a 39-bp 5'-UTR (untranslated region), a 108-bp 3'-UTR, and a 1,344 bp open reading frame encoding a 448 amino acid protein. The protein contained a cytochrome b5-like heme/steroid binding domain and a Fad domain. The A6 Fad-like protein of L. vannamei shared 70%-77% sequence homology with those of Macrobrachium nipponense, Scylla paramamosain, Portunus trituberculatus and Eriocheir sinensis. When salinity was reduced from 30 to 3, A6 Fad-like gene expression significantly increased in the gills, muscles, eyestalk, and hepatopancreas (P < 0.05). The highest expression was observed in the hepatopancreas under salinity 3 in the linseed oil group, followed by the fish oil group. The results suggest that L. vannamei has a gene encoding a A6 Fad-like protein whose expression increases with decreased salinity and depends on the level of C18 fatty acids, such as [alpha]-linolenic acid and linoleic acid, in the diet. The present study improves the current understanding of A6 Fad-like genes in euryhaline shrimp species, particularly their mRNA expression under different conditions.

KEY WORDS: [DELTA]6 fatty acyl desaturase, gene expression, salinity, fatty acids, Litopenaeus vannamei

INTRODUCTION

Highly unsaturated fatty acids (HUFAs, over 20 carbons), including arachidonic (ARA; 20:4n-6), eicosapentaenoic (EPA; 20:5n-3), and docosahexaenoic (DHA; 22:6n-3) acids, are essential for many biological processes (Sargent et al. 1999, Simopoulos 1999). Freshwater teleosts synthesize HUFA from linoleic (LA; 18:2n-6) and a-linolenic (ALA; 18:3n-3) acids (Zheng et al. 2004b, Bell & Tocher 2009). Thus, the availability of LA and ALA is essential for the synthesis of HUFA. In contrast to teleosts, marine shrimp species require a dietary supply of HUFA because these organisms have a limited capability or inability to synthesize fatty acids from LA or ALA (Kanazawa et al. 1979). Recent studies have shown that the euryhaline organisms such as Siganus canaliculatus and Pagrus major can convert LA and ALA into HUFA in both brackish water and seawater, and this capacity increases at low salinity (Li et al. 2008, Sarker et al. 2011), but the information on this capability in euryhaline crustaceans remains unknown.

The molecular basis of HUFA synthesis is well known in aquatic vertebrates (Li et al. 2010). The ARA is synthesized through [DELTA]6 desaturation, producing 18:3n-6 from LA; subsequently, 18:3n-6 is elongated to 20:3n-6, and finally, 20:3n-6 is desaturated to 20:4n-6 through [DELTA]5 desaturation (Vance & Vance 2008). The EPA is synthesized from ALA through the same pathway and enzymes of ARA, but DHA synthesis requires two additional elongation steps, a step of secondary [DELTA]6 desaturation and a special P-oxidation step (Sprecher 2000). The processes for converting C18 fatty acids to HUFA are associated with the enzymes of fatty acyl desaturase (Fad) and elongase. Therefore, the A6 Fad gene has been studied in many freshwater and marine fish species (Zheng et al. 2004a, Zheng et al. 2005, Li et al. 2008, 2014). Previously, studies have shown that [DELTA]6 Fad genes, encoding integral-membrane enzymes, were observed in vertebrates, higher plants, fungi, and bacteria. These enzymes are described as front-end desaturases because they introduce a double bond between the pre-exiting double bond and the carboxyl (front) end of the fatty acid. Few studies have focused on crustaceans, such as Chinese mitten crab Eriocheir sinensis (Yang et al. 2013).

It is well known that Pacific white shrimp (Litopenaeus vannamei) is an euryhaline shrimp farmed worldwide (Bondad-Reantaso et al. 2012) in environments with salinities ranging from 0.5 to 50 (Samocha et al. 2002). Thus, L. vannamei is a good crustacean model to study the relationship between salinity and HUFA synthesis. Previous studies indicated HUFA as an essential component in tissues and cell membranes under salinity stress (Chen et al. 2014, 2015a). The characterization and regulation of the Fad gene have received considerable attention, including investigating the influence of dietary fatty acids (Zheng et al. 2004b, Li et al. 2008) and the effects of ambient salinity (Li et al. 2008). The characterization and regulation of the Fad gene has not yet been studied in L. vannamei. Using a previous transcriptomic dataset on this species (Chen et al. 2015a), the predicted open reading frame (ORF) sequence of the [DELTA]6 Fad-like gene was obtained from a previous transcriptomic dataset on this species (Chen et al. 2015a) and examined its expression under different salinity conditions and dietary lipid contents. These results enhance the current understanding of the [DELTA]6 Fad-like gene and its potential function in euryhaline shrimp.

MATERIALS AND METHODS

Experiment Animals, Diet, Design and Facilities

Juvenile white shrimp (1.98 [+ or -] 0.28 g) were obtained from the Shenzhen base of the South China Sea Fisheries Research Institute, Shenzhen, China. The salinity of the original habitat of shrimp was salinity 17, and the shrimp were acclimated to a salinity of 3 and 30 through daily adjustments of 2 before the experimental trial. During acclimation periods, the shrimp were fed a commercial diet (10% moisture, 40% crude protein, 8% crude lipid, 12% ash, 30% carbohydrates, 16.7 kJ [g.sup._1] digestible energy). The present study included two experiments to examine the effect of salinity and diet on the expression of the [DELTA]6 Fadlike gene. In Experiment I, after salinity acclimation, the shrimp were distributed in nine tanks at a density of 40 shrimp per tank (500 L) at a salinity of 3, 17, and 30 and fed a commercial diet for 8 wk. In Experiment II, the shrimp were distributed into 18 tanks at the same density at salinity 3 for 8 wk and fed six formulated diets containing different sources of lipids, including soybean oil (SO), beef tallow (BT), fish oil (FO), linseed oil (LO), and an equal combination of SO + BT + FO (soybean oil + beef tallow + fish oil, SBF) or SO + BT + LO (soybean oil + beef tallow + linseed oil, SBL). The dietary compositions and fatty acid profiles are shown in Tables 1 and 2, respectively, as determined in previous reports (Chen et al. 2014, 2015b). During the experiment, the shrimp were fed three times daily at 08:00, 16:00, and 22:00 h. Based on the amount of feed leftover from the previous day, the daily ration was adjusted to a feeding level slightly higher than satiation. The unused feed was removed daily using a siphon tube. The photoperiod was 12-h light and 12-h dark. Seawater was pumped from the Dayawan Coast in Shenzhen and filtered through a mixed sand-filter tank. Tap water (fresh water) was used to adjust salinity. One-third of the tank volume was exchanged once daily. The water quality parameters were monitored two to three times a week throughout the feeding trial and maintained at 28[degrees]C-30[degrees]C, pH 7.5-7.9, 5.2-6.4 mg [L.sup.-1] dissolved oxygen, and less than 0.02 mg [L.sup.-1] total ammonia nitrogen during the trial. At the end of the experiment, the shrimp were fasted for 24 h before sampling.

Sample Collection and RNA Extraction

Ten shrimp at intermolt stage C in each tank were dissected to obtain gill, muscle, eyestalk, and hepatopancreas tissue samples and subsequently stored at -80[degrees]C for nucleic acid extraction. Total RNA was extracted from target tissues using Trizol reagent (AidLab, Shanghai, China) according to the manufacturer's instructions, whereas RNA's quantity and quality were estimated by absorbance at 260 and 280 nm using a NanoDrop2000 (Thermo Fisher Scientific, Wilmington, DE) and agarose-gel electrophoresis.

The cDNA was reverse transcribed from total RNA using the PrimeScript RT reagent kit (Code No. RR036A; Takara, Japan). The reactions were performed in a volume of 20 [micro]L by adding 4 [micro]L of 5X PrimeScript RT Master Mix, 1 [micro]g of total RNA, and up to 20 [micro]l of RNase-free [H.sub.2]O. Reverse transcription was conducted at 37[degrees]C for 15 min and 85[degrees]C for 5 sec. The cDNA samples were stored at -80[degrees]C for gene cloning and real-time quantitative polymerase chain reaction (RT-qPCR) analysis.

Cloning of [DELTA]6 Fad-like cDNA

All primers (Table 3) were designed using Primer Premier 6 according to the ORF sequence predicted from the transcriptomic data (GenBank accession number SRP048814) of a previous study (Chen ct al. 2015a). The primer sequences (ORF 1 and 2) were used for PCR and were performed on the S1000 thermal cycler (Bio-Rad, CA) using 2X Taq PCR Master Mix (TianGen Biotech, Beijing, China) in a total volume of 25 [micro]L containing 1 [micro]L of each primer, 2 [micro]L of template, 12.5 [micro]L PCR Master Mix, and up to 25 [micro]L of RNase-free [H.sub.2]O (TianGen, China). The cycling condition was 94[degrees]C for 3 min, followed by 30 cycles of 94[degrees]C for 30 sec, 55[degrees]C for 30 sec, 72[degrees]C for 1 min, and a final extension of 72[degrees]C for 5 min. The 5'- and 3'-rapid amplifications of cDNA ends (Rapid Amplifications of cDNA Ends, RACE) were subsequently performed using a reagent kit (Code No. 6106; Takara, Japan) according to the manufacturer's instructions.

Sequence and Phylogenetic Analysis

The ORF of the cloned full-length cDNA of [DELTA]6 Fad-like gene was predicted using the URL (http://insilico.ehu.es/translate/). The amino acid sequence of the ORF was verified for homology analysis using the BLASTP 2.3.1+ [National Center for Biotechnology Information (NCBI), http://blast.ncbi.nlm.nih.gov/] program (Altschul et al. 1997, 2005), reflecting its comprehensive protein database (Marchler-Bauer & Bryant 2004, Marchler-Bauer et al. 2009, 2011, 2015). PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred) and SWISS-MODEL (http://swissmodel.expasy.org/) were used to predict the secondary and tertiary structures, respectively. TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0) was used to predict transmembrane domains. ProtParam (http://www.expasy.org/tools/protparam.html) was used to analyze the fundamental characteristics of the predicted proteins, including isoelectric point (pI), molecular weight (Mw), and aliphatic index.

[FIGURE 1 OMITTED]

A phylogenetic tree was constructed with MEGA version 6.0 using the neighbor-joining method. The amino acid sequences of other animals were obtained from NCBI Gen-Bank. The A6 Fad proteins of other species (GenBank accession number in parenthesis) used for phylogenetic analysis included Cyprinus carpio (AAG25711.1), Siganus canaliculatus (ABR12315.2), Labeo rohita (ABV01368.2), Rachycentron canadum (ACJ65149.1), Lates calcarifer (ACS91458.1), Muraenesox cinereus (AEV57605.1), Oreochromis niloticus (BAB62850.1), Salmo salar (NP_001165752.1), Scophthalmus maximus (AAS49163.1), Leishmania donovani (XP_003859509.1), Leishmania mexicana (XP_003873509.1), Antheraea pernyi (AD085597.1), Caenorhabditis elegans (AAC15586.1), Sparus aurata (AAL17639.1), Homo sapiens (AAD31282.1), Trypanosoma brucei (XP_822945.1), Leishmania mexicana (XP_003873509.1), Eriocheir sinensis (AFV15455.1), Portunus trituberculatus (AKG97524.1), Scylla paramamosain (ANA07380.1), and Macrobrachium nipponense (AMQ48726.1); the blasted A5 Fad gene of other species were from Octopus vulgaris (AEK20864.1), Caligus rogercresseyi (ACO10922.1), Caenorhabditis elegans (AAC95143.1), Mus musculus (BAB69894.1), Mortierella alpina (AAC39508.1), and Dictyostelium discoideum (BAA37090.1); the sphingolipid [DELTA]4 desaturase genes of other species were from Lepeophtheirus salmonis (ACO11978.1) and Caligus clemensi (ACO15178.1); and the acyl-CoA desaturase ([DELTA]9 Fad) gene was from Danaus plexippus (EHJ73552.1).

RT-qPCR Analysis of [DELTA]6 Fad-like Gene

In Experiment I, the expression of the [DELTA]6 Fad-like gene in the gills, muscles, eyestalk, and hepatopancreas was determined to determine the influence of salinity in different organs; in Experiment II, the expression of the [DELTA]6 Fad-like gene was measured in the hepatopancreas to examine the effects of different lipid sources on HUFA biosynthesis in Litopenaeus vannamei. All expressions were quantified using the CFX96 Touch real-time PCR system (Bio-Rad, CA), and the primers were designed to amplify a 101-bp fragment according to the full-length cDNA sequence (Table 3). The samples from each tissue were run in triplicate and normalized to the internal standard control gene, [beta]-actin (Table 3). Experiments were performed using specific RT-qPCR primers and cDNA as a template in a final volume of 20 [micro]L containing 10 [micro]L of SYBR Green Premix Ex Taq (2X) (Takara, Japan), 0.4 [micro]L of 10 mM gene-specific forward and reverse primers, 2 [micro]L of diluted cDNA template (200 ng/[micro]L), and 7.2 [micro]L of RNase-free [H.sub.2]O with the following cycling conditions: initial dcnaturation at 95[degrees]C for 30 sec followed by 40 cycles at 94[degrees]C for 15 sec, 58[degrees]C for 20 sec, 72[degrees]C for 20 sec, and a 0.5[degrees]C per 5-sec incremental increase from 60[degrees]C to 95[degrees]C.

Statistical Analyses

The relative mRNA expression of A6 desaturase in each sample was normalized to [beta]-actin expression and calculated using the comparative threshold cycle method (Pfaffl 2001). In experiment I, [DELTA]6 Fad-like gene expression was respectively determined in gill, eyestalk, hepatopancreas, and muscle tissue samples under a salinity of 30, 17, and 3. In addition, the gene expression in experiment II was determined in the hepatopancreas of a few shrimp with SO, BT, LO, FO, SBL, and SBF under a salinity of 3. Differences in gene expression among tissues were analyzed using a one-way analysis of variance followed by Duncan's multiple range tests (SPSS 19.0 package, SPSS Inc., New York, NY). Significant differences were set at P < 0.05.

RESULTS

Cloning, Characterization, and Identification of [DELTA]6 Fad-like Gene

The sequences of the [DELTA]6 Fad-like gene were assembled using BioEdit sequence alignment editor and the assembled gene, which were submitted to NCBI GenBank under accession number KT305965, containing a 39-bp 5' -UTR, 108-bp 3' -UTR, and a 1,344-bp ORF encoding a putative protein of 448 aa. The sequence of A6 Fad-like protein has a theoretical isoelectric point of 8.48, a molecular weight of 51.84 kDa, and an aliphatic index of 76.00. The number of negatively charged residues (Asp + Glu) was 47, and the number of positively charged residues (Arg + Lys) was 51. The total number of atoms was 7,228, and the molecular formula was [C.sub.2380][H.sub.3562][H.sub.3562][N.sub.629][O.sub.639] [S.sub.21]. The predicted secondary structure is shown in Figure 1. The tertiary structure and transmembrane domains are shown in Figure 2. The amino acid sequences of [DELTA]6 Fad-like protein are shown in Figure 3.

The Conserved Domains and Homology Analysis of [DELTA]6 Fad-like Gene

The conserved domain analysis using BLASTP 2.3.1 + revealed two conserved domains on this sequence, including a cytochrome b5-like heme/steroid binding domain (amino acids interval: 39-107) and a [DELTA]6 Fad-like domain (amino acids interval: 173-412). Homology analysis showed that the [DELTA]6 Fadlike protein of Litopenaeus vannamei shared 77%, 73%, 73%, and 70% sequence homology with that of Macrobrachium nipponense, Scylla paramamosain, Portunus trituberculatus and Eriocheir sinensis, respectively (Fig. 3). These crustacean species had the same heme-binding motif region, three histidine-rich regions [HXXXH, HXX(X)HH and Q/HXXHH (Napier et al. 2003)], and the cytochrome b5 domain (Fig. 3). The A6 Fad-like protein of L. vannamei only shared 20%-40% homology with that of fish or other species, such as Siganus canaliculatus. The neighbor-joining phylogenic tree revealed that the [DELTA]6 Fad-like gene of L. vannamei in the shrimp clade belonged to the crustacean branch and the highly conserved [DELTA]6 Fad gene family rather than other proteins of the lipid desaturase family (Fig. 4).

The Expression of [DELTA]6 Fad-like Gene Under Different Salinity Conditions or Different Diet Fatty Acid Profiles

[FIGURE 2 OMITTED]

The expression of [DELTA]6 Fad-like gene in the hepatopancreas of the salinity 3 group was the highest, followed by eyestalk and gill, whereas the lowest expression was observed in muscle (Fig. 5). The expression of the [DELTA]6 Fad-like gene in the eyestalk, gills, and hepatopancreas was significantly increased with decreasing salinity from 30 to 3. The expression of [DELTA]6 Fad-like gene in muscle showed no significant differences at a salinity of 3, 17, and 30. This result indicated that the hepatopancreas is the primary location of fatty acid synthesis and metabolism; therefore, the expression of the [DELTA]6 Fad-like gene was examined in Experiment II. The gene expression in the hepatopancreas of shrimp fed different lipid diets was highest in the LO and SBL diet groups, followed by the FO, SO, and BT diet groups, and the SBF diet group was the lowest, but there were no notable differences between SO, BT, and SBF diet groups. (Fig. 6).

[FIGURE 3 OMITTED]

DISCUSSION

The [DELTA]6 Fad gene plays a crucial role in HUFA biosynthesis and has been widely used as an indicator of HUFA synthesis capacity in vertebrates, such as fish (Tocher et al. 2006, Li et al. 2010). Even so, the role of the [DELTA]6 Fad gene in HUFA synthesis is rarely reported in crustaceans except for Eriocheir sinensis (Yang et al. 2013). The present study is the first to clone, sequence, and characterize the [DELTA]6 Fad-like gene from Litopenaeus vannamei.

The [DELTA]6 Fad-like gene in the present study contained two conserved domains, including a cytochrome b5-like heme/steroid binding domain and a [DELTA]6 Fad-like domain. The cytochrome b5-like domains include (in addition to the cytochrome b5) hemoprotein domains covalently associated with other redox domains of proteins, such as acyl lipid desaturase fusion protein. Various substrates, such as acyl-CoA and acyllipid desaturases, are involved in HUFA synthesis. Acyl-CoA desaturases require cytochrome b5, which serves as an electron donor in a number of biochemical reactions, including microsomal fatty acid desaturation and hydroxylation (Smith et al. 1995). Most eukaryotic desaturase domains have an adjacent N-terminal cytochrome b5-like domain (Smith et al. 1995, Sayanova et al. 1997, Napier et al. 2003). This domain family has extensive hydrophobic regions capable of spanning the membrane bilayer at least twice. The [DELTA]6 Fad-like domain encodes [DELTA]6 Fad and exhibits typical [DELTA]6 desaturase activity in most teleosts (Tocher et al. 2006, Santigosa et al. 2011). Because the predicted amino sequence shows high identity with [DELTA]6 desaturases from other species, including Macrobrachium nipponense (77%), Scylla paramamosain (73%), Portunus trituberculatus (73%) and Eriocheir sinensis (70%), rather than other lipid desaturase family proteins; the Fad gene identified in the present study should exhibit [DELTA]6 desaturase activity. The predicted amino acid sequences of Litopenaeus vannamei with M. nipponense, S. paramamosain, E. sinensis, and P. trituberculatus share the same heme-binding motif region, three histidine-rich regions (HXXXH, HXX(X)HH, and Q/HXXHH), and the cytochrome b5 domain (Fig. 3). This result is consistent with those of previous studies on E. sinensis (Yang et al. 2013). But, the deduced amino acid sequence only shares 20%-40% identity with fish species and other invertebrates. The sequence also shows low homology with that of mammals. After reviewing considerable literature, it could be speculated that the [DELTA]6-Fad gene in mammals and crustaceans plays the same role, although these species have several differences. Meanwhile, the neighbor-joining phylogenic tree of the [DELTA]6 Fad gene showed that the Fad-like gene of L. vannamei is in the crustacean branch and different from fish and other invertebrates. The [DELTA]6 Fad gene in crustaceans is a highly conserved protein different from that in fish.

Marine fish cannot synthesize HUFA to satisfy its requirement because of the limited enzyme activities of desaturase, but in some euryhaline fish, the limited desaturase activities could be stimulated through low salinity (Li et al. 2008, Sarker et al. 2011). As is known to all, Litopenaeus vannamei is a typical euryhaline species as its larvae develop in the ocean, whereas post larvae, juveniles and adults live in coastal and estuarine regions (FAO 2004). In Experiment I, the survival rate significantly reduced from 93.33% to 65.00% and weight gain also reduced from 652.28% to 548.34% when salinity reduced from 30 to 3 (Chen et al. 2014), and n-3 HUFAs in the diet could counteract the stress at low salinity. Fatty acids may play an important role in osmoregulation via supplying enough energy sources and affecting cell membrane structure (Chen et al. 2015a). In the present study, the expression of the [DELTA]6 Fad-like gene in eyestalk, hepatopancreas, muscle, and gill tissues significantly increased with decreasing salinity. In a previous study, we showed that the ALA content in the hepatopancreas increases with decreasing salinity from 30 to 3, and the EPA and DHA in muscle and gill tissues also increased with decreasing salinity from 30 to 3 (Chen et al. 2014). These results suggested that when the shrimp suffer from low salinity stress, the hepatopancreas may assimilate more ALA, EPA, and DHA from the diet, simulate the conversion of ALA to EPA and DHA, and subsequently transport EPA and DHA to other organs (such as the gills and muscle) to cope with low-salinity stress.

[FIGURE 4 OMITTED]

Low-salinity stress could stimulate the expression of the [DELTA]6 Fad-like gene, but the ability to synthesize HUFA was highly associated with the profile of fatty acids. Previous studies have shown that dietary LA and ALA could promote the expression of [DELTA]6 desaturase, whereas HUFA may suppress the expression of [DELTA]6 desaturase, and the promoting role of ALA on [DELTA]6 desaturase gene expression is stronger than that of LA (Zheng et al. 2004b, Li et al. 2008). In a previous study, we showed that a diet with higher HUFA or ALA can improve the adaption of Litopenaeus vannamei to low salinity as a result of the different composition of fatty acids in the diet (Chen et al. 2015b). In the present study, the higher expression of the [DELTA]6 Fad-like gene in the hepatopancreas in LO and SBL diet groups and lower expression in the FO and SBF diet groups might reflect the inhibitory effects of HUFAs (Li et al. 2014, Kuah et al. 2015). Meanwhile, higher DHA accumulation in the muscles of shrimp in the FO and SBF diet groups may reflect the higher DHA content in the diet (Chen et al. 2015b). Previous studies have shown that ALA is the precursor for DHA synthesis, but DHA accumulation only gradually increased in muscles when the ALA was less than 3 en% (percent of energy from lipid in gross energy), and extra ALA will inhibit the accumulation of DHA (Gibson et al. 2013, Li et al. 2014). As previously reported, the DHA and ALA content and the expression of the [DELTA]6 Fad-like gene was significantly lower in the BT diet compared with that in the SBL diet, but the DHA accumulation in muscle tissues from shrimp in the BT diet group was higher than that in the SBL diet group (Chen et al. 2015b). Therefore, although the mRNA expression of [DELTA]6 Fad-like gene was higher in the SBL group, the ALA content of SBL remained too high for DHA accumulation in muscle. Although the SO diet had a higher content of DHA than the BT diet, there was no significant difference in DHA accumulation in the muscle (Chen et al. 2015b). The ALA can be biosynthesized through the successive desaturation of oleic (C18:1 n-9) and LA (Cherif et al. 1975), and the BT diet had the highest oleic level. These findings may explain why BT and SO diet groups have relatively higher DHA accumulation, although both SO and BT diets had low DHA and ALA contents and expressed the [DELTA]6 Fad-like gene.

Moreover, shrimp fed an SBF diet showed the same expression of the [DELTA]6 Fad-like gene and ALA content as shrimp fed an BT diet, but the SBF diet group had a higher DHA content in muscle than the SO and BT diet groups (Chen et al. 2015b). This effect may reflect the higher DHA content in the SBF diet. Thus, we speculated that L. vannamei may convert oleic acid to ALA to synthesize DHA for adapting to low-salinity stress when ALA and DHA are deficient. Even so, this experiment still did not directly measure the conversion of ALA to DHA through [DELTA]6 Fad-like protein and whether this process actually occurs in L. vannamei needs further study.

[FIGURE 5 OMITTED]

[FIGURE 6 OMITTED]

In conclusion, this study is the first to report the [DELTA]6 Fadlike gene in Litopenaeus vannamei, involving the investigation of its expression in relation to HUFA biosynthesis under different salinity conditions or from different dietary lipid sources. The expression of the [DELTA]6 Fad-like gene was upregulated by decreasing salinity, likely associated with ALA and HUFA synthesis. Thus, it suggested that L. vannamei may convert ALA into DHA under both high and low salinity conditions and this activity may be stronger at low salinity than at high salinity. The present study provides data for HUFA biosynthesis in euryhaline shrimp, but this hypothesis requires confirmation in additional studies.

ACKNOWLEDGMENTS

The present study was financially supported through grants from the National Natural Science Foundation of China (No. 31472291) and partially funded through the E-Institute of Shanghai Municipal Education Commission (No. E03009).

LITERATURE CITED

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller & D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.

Altschul, S. F., J. C. Wootton, E. M. Gertz, R. Agarwala, A. Morgulis, A. A. Schaffer & Y. K. Yu. 2005. Protein database searches using compositionally adjusted substitution matrices. FEBS J. 272:5101-5109.

Bell, M. V. & D. R. Tocher. 2009. Biosynthesis of polyunsaturated fatty acids in aquatic ecosystems: general pathways and new directions. In: Kainz M., M. Brett & M. Arts, editors. Lipids in aquatic ecosystems. New York, NY: Springer. pp. 211-236.

Bondad-Reantaso, M. G., R. P. Subasinghe, H. Josupeit. J. Cai & X. Zhou. 2012. The role of crustacean fisheries and aquaculture in global food security: past, present and future. J. Invertebr. Pathol. 110:158-165.

Chen, K., E. Li, L. Gan, X. Wang, C. Xu, H. Lin, J. G. Qin & L. Chen. 2014. Growth and lipid metabolism of the Pacific white shrimp Litopenaeus vannamei at different salinities. J. Shellfish Res. 33:825-832.

Chen, K., E. Li, T. Li, C. Xu, X. Wang, H. Lin. J. G. Qin & L. Chen. 2015a. Transcriptome and molecular pathway analysis of the hepatopancreas in the Pacific white shrimp Litopenaeus vannamei under chronic low-salinity stress. PLoS One 10:e0131503.

Chen, K., E. Li, C. Xu, X. Wang, H. Lin, J. G. Qin & L. Chen. 2015b. Evaluation of different lipid sources in diet of Pacific white shrimp Litopenaeus vannamei at low salinity. Aquacult. Res. 2:163-168.

Cherif, A., J. Dubacq, R. Mache, A. Oursel & A. Tremolieres. 1975. Biosynthesis of [alpha]-linolenic acid by desaturation of oleic and linoleic acids in several organs of higher and lower plants and in algae. Phytochemistry 14:703-706.

FAO. 2004. Manejo sanitario y mantenimiento de la bioseguridad de los laboratorios de postlarvas de camaron bianco (Penaeus vannamei) en America Latina. FAO Documento Tecnico de Pesca. 66 pp.

Gibson, R. A., M. A. Neumann, E. L. Lien, K. A. Boyd & W. C. Tu. 2013. Docosahexaenoic acid synthesis from alpha-linolenic acid is inhibited by diets high in polyunsaturated fatty acids. Prostaglandins Leukot Essent Fatty Acids 88:139-146.

Kanazawa, A., S. Teshima & K. Ono. 1979. Relationship between essential fatty acid requirements of aquatic animals and the capacity for bioconversion of linolemc acid to highly unsaturated fatty acids. Comp. Biochem. Physiol. A 63B:295-298.

Kuah, M.-K., A. Jaya-Ram & A. C. Shu-Chien. 2015. The capacity for long-chain polyunsaturated fatty acid synthesis in a carnivorous vertebrate: functional characterisation and nutritional regulation of a Fads2 fatty acyl desaturase with [DELTA]4 activity and an Elovl5 elongase in striped snakehead (Channa striata). Biochim. Biophys. Acta 1851:248-260.

Li, Y.-y., C.-b. Hu, Y.-j. Zheng, X.-a. Xia, W.-j. Xu, S.-q. Wang, W.-z. Chen, Z.-w. Sun & J.-h. Huang. 2008. The effects of dietary fatty acids on liver fatty acid composition and A6-desaturase expression differ with ambient salinities in Siganus canaliculatus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151:183-190.

Li, S., K. Mai, W. Xu, Y. Yuan, Y. Zhang & Q. Ai. 2014. Characterization, mRNA expression and regulation of [DELTA]6 fatty acyl desaturase (FADS2) by dietary n - 3 long chain polyunsaturated fatty acid (LC-PUFA) levels in grouper larvae (Epinephelus coioides). Aquaculture 434:212-219.

Li, Y., O. Monroig, L. Zhang, S. Wang, X. Zheng, J. R. Dick, C. You & D. R. Tocher. 2010. Vertebrate fatty acyl desaturase with [DELTA]4 activity. Proc. Natl. Acad. Sci. USA 107:16840-16845.

Marchler-Bauer, A., J. B. Anderson, F. Chitsaz, M. K. Derbyshire, C. DeWeese-Scott, J. H. Fong, L. Y. Geer, R. C. Geer, N. R. Gonzales, M. Gwadz, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. H. Marchler, M. Mullokandov, J. S. Song, A. Tasneem, N. Thanki, R. A. Yamashita, D. Zhang, N. Zhang & S. H. Bryant. 2009. CDD: specific functional annotation with the conserved domain database. Nucleic Acids Res. 37:D205-D210.

Marchler-Bauer, A. & S. H. Bryant. 2004. CD-Search: protein domain annotations on the fly. Nucleic Acids Res. 32:W327-W331.

Marchler-Bauer, A., M. K. Derbyshire, N. R. Gonzales, S. Lu, F. Chitsaz, L. Y. Geer, R. C. Geer, J. He, M. Gwadz, D. I. Hurwitz, C. J. Lanczycki, F. Lu, G. H. Marchler, J. S. Song, N. Thanki, Z. Wang, R. A. Yamashita, D. Zhang, C. Zheng & S. H. Bryant. 2015. CDD: NCBl's conserved domain database. Nucleic Acids Res. 43: D222-D226.

Marchler-Bauer, A., S. Lu, J. B. Anderson, F. Chitsaz, M. K. Derbyshire, C. DeWeese-Scott, J. H. Fong, L. Y. Geer, R. C. Geer, N. R. Gonzales, M. Gwadz, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, F. Lu, G. H. Marchler, M. Mullokandov, M. V. Omelchenko, C. L. Robertson, J. S. Song, N. Thanki, R. A. Yamashita, D. Zhang, N. Zhang, C. Zheng & S. H. Bryant. 2011. CDD: a conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 39:D225-D229.

Napier, J. A., L. V. Michaelson & O. Sayanova. 2003. The role of cytochrome b5 fusion desaturases in the synthesis of polyunsaturated fatty acids. Prostaglandins Leukot. Essent. Fatty Acids 68:135-143.

Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45.

Samocha, T. M., L. Hamper, C. R. Emberson, A. D. Davis, D. Mcintosh, A. L. Lawrence & P. M. Van Wyk. 2002. Review of some recent developments in sustainable shrimp farming practices in Texas, Arizona, and Florida. J. Appl. Aquacult. 12:1-42.

Santigosa, E., F. Geay, T. Tonon, H. Le Delliou, H. Kuhl, R. Reinhardt, L. Corcos, C. Cahu, J. Zambonino-lnfante & D. Mazurais. 2011. Cloning, tissue expression analysis, and functional characterization of two A6-desaturase variants of sea bass (Dicentrarchus labrax L.). Mar. Biotechnol. (NY) 13:22-31.

Sargent, J., G. Bell, L. McEvoy, D. Tocher & A. Estevez. 1999. Recent developments in the essential fatty acid nutrition of fish. Aquaculture 177:191-199.

Sarker, M. A.-A., Y. Yamamoto, Y. Haga, M. S. A. Sarker, M. Miwa, G. Yoshizaki&S. Satoh. 2011. Influences of low salinity and dietary fatty acids on fatty acid composition and fatty acid desaturase and elongase expression in red sea bream Pagrus major. Fish. Sci. 77:385-396.

Sayanova, O., M. Smith, P. Lapinskas, A. Stobart, G. Dobson, W. Christie, P. Shewry & J. Napier. 1997. Expression of a borage desaturase cDNA containing an N-terminal cytochrome b5 domain results in the accumulation of high levels of A6-desaturated fatty acids in transgenic tobacco. Proc. Natl. Acad. Sci. USA 94:4211-4216.

Simopoulos, A. P. 1999. Essential fatty acids in health and chronic disease. Am. J. Clin. Nutr. 70:560s-569s.

Smith, M. A., J. A. Napier, R. Browne, P. R. Shewry & A. K. Stobart. 1995. Cytochrome b5 and fatty acid desaturation. Dordrecht, The Netherlands: Springer.

Sprecher, H. 2000. Metabolism of highly unsaturated n-3 and n-6 fatty acids. Biochim Biophys Acta 1486:219-231.

Tocher, D. R., X. Zheng, C. Schlechtriem, N. Hastings, J. R. Dick & A. J. Teale. 2006. Highly unsaturated fatty acid synthesis in marine fish: cloning, functional characterization, and nutritional regulation of fatty acyl [DELTA]6 desaturase of Atlantic cod (Gadus morhua L.). Lipids 41:1003-1016.

Vance, J. E. & D. E. Vance. 2008. Biochemistry of lipids, lipoproteins and membranes (Fifth Edition). San Diego, CA: Elsevier.

Yang, Z., Z. Guo, L. Ji, Q. Zeng, Y. Wang, X. Yang & Y. Cheng. 2013. Cloning and tissue distribution of a fatty acyl [DELTA]6-desaturase-like gene and effects of dietary lipid levels on its expression in the hepatopancreas of Chinese mitten crab (Eriocheir sinensis). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 165:99-105.

Zheng, X., I. Seiliez, N. Hastings, D. R. Tocher, S. Panserat, C. A. Dickson, P. Bergot & A. J. Teale. 2004a. Characterization and comparison of fatty acyl [DELTA]6 desaturase cDNAs from freshwater and marine teleost fish species. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139:269-279.

Zheng, X., D. R. Tocher, C. A. Dickson, J. G. Bell & A. J. Teale. 2004b. Effects of diets containing vegetable oil on expression of genes involved in highly unsaturated fatty acid biosynthesis in liver of Atlantic salmon (Salmo salar). Aquaculture 236:467-483.

Zheng, X., D. R. Tocher, C. A. Dickson, J. G. Bell & A. J. Teale. 2005. Highly unsaturated fatty acid synthesis in vertebrates: new insights with the cloning and characterization of a [DELTA]6 desaturase of Atlantic salmon. Lipids 40:13-24.

KE CHEN, (1,2) ERCHAO LI, (1,2,*) TONGYU LI, (2) CHANG XU, (2) ZHIXIN XU, (2) JIAN G. QIN (3) AND LIQIAO CHEN (2)

(1) State Key Laboratory of Marine Resource Utilization in South China Sea, No. 58, Renmin Road, Hainan University, Haikou, Hainan 570228, China; (2) Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, No. 500, Dongchuan Road, Shanghai 200241, China; (3) School of Biological Sciences, Flinders University, Sturt Road, Bedford Park, Adelaide, SA 5001, Australia

(*) Corresponding author. E-mail: ecli@bio.ecnu.edu.cn
TABLE 1.
Formulation and approximate composition of experimental diets (g/kg
diet).

Ingredients                           SO     BT     LO     FO     SBL

Casein                                320    320    320    320    320
Gelatin                                80     80     80     80     80
Corn starch                           330    330    330    330    330
Lipid (*)                              70     70     70     70     70
Cholesterol                             5      5      5      5      5
Lecithin                               10     10     10     10     10
Vitamin premix ([dagger])              20     20     20     20     20
Stay-C                                  1      1      1      1      1
Amino acid mixture ([double dagger])   30     30     30     30     30
Mineral premix ([section])              5      5      5      5      5
CMC                                    30     30     30     30     30
Ca[([H.sub.2]PO4).sub.2]                5.3    5.3    5.3    5.3    5.3
CaC[O.sub.3]                            2.2    2.2    2.2    2.2    2.2
Calcium lactate                         3.3    3.3    3.3    3.3    3.3
Na[H.sub.2]P[O.sub.4]                   4.2    4.2    4.2    4.2    4.2
[alpha]-cellulose                      84     84     84     84     84

Ingredients                             SBF    Commercial diet

Casein                                  320          320
Gelatin                                  80           80
Corn starch                             330          330
Lipid (*)                                70           70
Cholesterol                               5            5
Lecithin                                 10           10
Vitamin premix ([dagger])                20           20
Stay-C                                    1            1
Amino acid mixture ([double dagger])     30           30
Mineral premix ([section])                5            5
CMC                                      30           30
Ca[([H.sub.2]PO4).sub.2]                  5.3          5.3
CaC[O.sub.3]                              2.2          2.2
Calcium lactate                           3.3          3.3
Na[H.sub.2]P[O.sub.4]                     4.2          4.2
[alpha]-cellulose                        84           84

(*) Lipid: lipid resources included soybean oil (SO), beef tallow (BT),
fish oil (FO), linseed oil (LO), and equal combinations of SO + BFT +
FO (SBF) or SO + BFT + LNO (SBL).
([dagger]) Vitamin premix (g/kg premix): thiamin HC1, 0.5; riboflavin,
3.0; DL Ca-pantothenate, 5.0; nicotinic acid, 5.0; biotin, 0.05; folic
acid, 0.18; B12, 0.002; choline chloride, 100.0; inositol, 5.0;
menadione, 12.0; A acetate (20,000 IU/g), 5.0; D3 (400,000 IU/g),
0.002; DL-alpha-tocopheryl acetate (250 IU/g), 8.0; and
alpha-cellulose, 866.266.
([double dagger]) The amino acid mixture contained the following (g/300
g diet): glycine, 0.6 g; l-alanine, 0.6 g; l-glutamic acid, 0.6 g; and
betaine, 1.2 g.
([section]) Mineral premix (g TOO g premix): sodium dihydrogen
phosphate, 21.5; calcium dihydrogen phosphate, 26.5; calcium carbonate,
10.5; Ca-lactate, 16.5; cobalt chloride, 0.001; cupric sulfate
pentahydrate, 0.0625; ferrous sulfate, 1.0; magnesium sulfate
heptahydrate, 7.0995; manganous sulfate monohydrate, 0.1625; potassium
iodide, 0.0167; sodium selenite, 0.0025; and zinc sulfate heptahydrate,
3.298.

TABLE 2.
Fatty acid composition of experimental diets (percent by weight of
total fatty acids).

Fatty acid                    SO     BT     LO     FO    SBL    SBF

16:0                       14.37  23.05   9.99  21.47  13.67  18.05
18:0                        6.40  28.53   8.68   5.41  13.38  13.51
[SIGMA]SFA                 22.85  53.86  19.60  32.66  28.23  34.26
18:1(n-9)                  24.25  34.83  21.01  23.87  24.43  26.08
[SIGMA]MUFA                27.00  36.93  22.84  32.49  27.30  34.44
18:2(n-6)                  39.72   8.15  16.13  10.06  23.22  23.14
18:3(n-3)                   5.59   0.42  40.80   3.92  20.96   0.21
20:5(n-3)                   1.41   0.12   0.16   6.63   0.10   2.11
22:6(n-3)                   1.91   0.15   0.21   8.96   0.12   2.86
[SIGMA]PUFA                50.15   9.21  57.56  34.85  44.47  31.30
[SIGMA]n-3                  9.24   0.69  41.17  20.77  21.17   5.64
[SIGMA]n-6                 40.39   8.52  16.30  14.08  23.30  25.66
[SIGMA](n-3)/[SIGMA](n-6)   0.23   0.08   2.53   1.48   0.91   0.22

Fatty acid                 Commercial diet

16:0                            16.63
18:0                             4.36
[SIGMA]SFA                      24.34
18:1(n-9)                       26.21
[SIGMA]MUFA                     30.60
18:2(n-6)                       28.16
18:3(n-3)                        2.72
20:5(n-3)                        4.16
22:6(n-3)                        7.23
[SIGMA]PUFA                     45.07
[SIGMA]n-3                      15.31
[SIGMA]n-6                      29.75
[SIGMA](n-3)/[SIGMA](n-6)        0.51

Not all analyzed fatty acid fractions were included in this table.
Total saturated fatty acid ([SIGMA]SFA): 14:0. 16:0. 18:0. 20:0, 22:0.
Total monounsaturated fatty acid ([SIGMA]MUFA): 16:1, 18:l(n-9). 20:1,
22:1. Total polyunsaturated fatty acid ([SIGMA]PUFA): 18:2(n-6),
18:3(n-3), 20:2, 20:3(n-6), 20:4(n-6), 20:3(n-3), 20:5(n-3), 22:2,
22:3, 22:4, 22:5(n-3), 22:6(n-3). Total n-3 polyunsaturated fatty acid
([SIGMA] n-3): 18:3(n-3), 20:3(n-3), 20:5(n-3), 22:5(n-3), 22:6(n-3).
Total n-3 polyunsaturated fatty acid ([SIGMA] n-6): 18:2(n-6),
20:3(n-6). 20:4(n-6).

TABLE 3.
Sequences of the primers used for cloning and characterizing the
[DELTA]6 Fad gene.

Aim             Primers

5' RACE         5' end
ORF' cloning    ORF-1         F
                              R
                ORF-2         F
                              R
3' RACE         3' end
5' and 3' RACE  UPM (*)       Long
                              Short
RT-qPCR         ELO-Q         F
                              R
                FAD-Q         F
                              R
                [beta]-actin  F
                              R

Aim             Sequence (5' to 3)

5' RACE         GTCGTGGGAGGAGAAGAGGGTCAGGTC
ORF' cloning    CAACCGAGCCAGCAATTC
                CGTAGATGGTGTTGGTGAAG
                CCACAACTTCTTCCATCAGA
                CTGTCACTTCCATCCTGTC
3' RACE         ACCACCATGTTACCGTCCTGCTCT
5' and 3' RACE  CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
                5'-CTAATACGACTCACTATAGGGC
RT-qPCR         TCTCCTACGACAACATCAAG
                CGACACCAACCTGCTTAT
                TACACCTTCCACGACGAT
                ATCAGAATCATCCTCCAGTC
                CGCGACCTCACAGACTACCT
                GTGGTCATCTCCTGCTCGAA

(*) Universal Primer Mix (UPM); 10X UPM, containing a mixture of long
(0.4 [micro]M) and short (2 [micro]M) primers.
COPYRIGHT 2017 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Chen, Ke; Li, Erchao; Li, Tongyu; Xu, Chang; Xu, Zhixin; Qin, Jian G.; Chen, Liqiao
Publication:Journal of Shellfish Research
Article Type:Report
Date:Aug 1, 2017
Words:6661
Previous Article:Causes, diagnostics, and distribution of an ongoing penaeid shrimp black gill epidemic in the U.S. South Atlantic Bight.
Next Article:Feed alternatives for noble crayfish astacus astacus based on fatty acid and lipid analyses.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters