Printer Friendly

The chloroform extract of Cyclocarya paliurus attenuates high-fat diet induced non-alcoholic hepatic steatosis in Sprague Dawley rats.

ABSTRACT

Background: Hepatic steatosis (HS) is the early stage of nonalcoholic fatty liver disease which is caused by impaired hepatic lipid homeostasis. Cyclocarya paliurus, an herbal tea consumed in China, has been demonstrated to ameliorate abnormal lipid metabolism for the treatment of metabolic diseases.

Purpose: We aimed to investigate the regulative effect of chloroform extract from Cyclocarya paliurus (ChE) on treatment of HS, as well as key factors involved in hepatic lipid metabolism.

Study design: Sprague Dawley rats were fed with high-fat diet (HFD) for 6 weeks to induce HS and treated with or without ChE by gavage for 4 weeks.

Methods: The body weight, relative liver weight and liver fat content were measured. Serum and liver total cholesterol, triglyceride and non-esterified fatty acids, as well as hepatic malonaldehyde levels were accessed by biochemical methods. Serum and liver TNF-[alpha] levels were quantified by ELISA kit Histologic analysis and [sup.1]H-MRS study were performed to evaluate HS level. RT-PCR and Western blot were also applied to observe the expression changes of key factors involved in hepatic lipid intake, synthesis, utilization and export.

Results: ChE significantly decreased the rats' body weight, serum lipid and TNF-[alpha] level. ChE also reduced their relative liver weight, liver fat content, hepatic oxidative products and TNF-[alpha] level. Hepatic steatosis in HFD-fed rats was effectively regressed after 2-weeks administration of ChE. Moreover, ChE treatment remarkably reduced HFD-induced high expression level of fatty acid synthesis genes (including sterolregulatory element-binding protein 1, acetyl-CoA carboxylase 1 and fatty acid synthase). However, it had no effect on mRNA expression of some genes involved in lipid uptake, [beta]-oxidation and lipid outflow.

Conclusion: ChE exerted a promising regression effect on HS due to a reduced level of serum non-esterified fatty acids which might lead to a decrease in the amount of lipid taken in by the liver, as well as owing to the inhibition of hepatic lipid de novo synthesis to reduce liver lipid production.

Keywords:

Non-alcoholic fatty liver disease

Hepatic steatosis

Cyclocarya paliurus

Lipogenesis

Proton magnetic resonance spectrum

1. Introduction

Non-alcoholic fatty liver disease (NAFLD), gradually recognized as the most common cause of advanced liver disease, is characterized by an accumulation of hepatic lipid [mainly as triglyceride (TG)| without excess alcohol consumption (Petts et al., 2014). NAFLD includes a series of hepatic pathology ranging from hepatic steatosis to nonalcoholic steatohepatitis, which may trigger the development of fibrosis and cirrhosis, eventually lead to hepatocarcinoma (Choi and Diehl, 2008). Currently NAFLD has become the most common liver disease with about 20-30% of general population worldwide (Wong, 2013). The prevalence of NAFLD is associated with the increased incidence of obesity, diabetes, and cardiovascular diseases. Therefore, NAFLD is generally regarded as the hepatic manifestation of the metabolic syndrome.

The earlier step of NAFLD is hepatic steatosis (HS) which is characterized by accumulation of TG in the cytoplasm of hepatocytes and makes the liver more susceptible to various etiologies (Tilg and Moschen, 2010). Because hepatic lipid metabolism plays an important role in the pathogenesis of HS, the related signaling pathway regulation seems to be a potential strategy to ameliorate HS and block NAFLD progression. The imbalance between hepatic lipid utilization or export, as well as lipid uptake or synthesis, can lead to the occurrence of HS (Postic, 2009). Therefore, many functional factors involved in keeping the balance has become the promising therapeutic target. Transcription factors like sterol regulatory element-binding protein 1c (SREBP-1c) and peroxisome proliferator-activated receptor a (PPARa), play important roles in hepatic lipogenesis and lipid catabolism though regulating their downstream gene expression. In addition, some proteins, such as fatty acid translocase (CD36) and apolipoprotein B100 (apoB100), also affect hepatic lipid profiles, via regulating the uptake of non-esterified fatty acids (NEFAs) and the secretion of very low density lipoprotein (VLDL) respectively (Sozio et al., 2010).

Despite the important clinical significance, there are no effective drugs or therapeutic strategies for the treatment of NAFLD. Drugs currently available for anti-hyperglycemia (metformin) and lowering blood lipids (statins and fibrates) are applied to ameliorate HS, while their utilization are limited due to their potential adverse side effects (Dowman et al., 2011). The naturally-occurring ingredients and plant medicine for prevention and/or treatment of NAFLD has become increasingly popular. Some herbal plants like Salada oblonga, Sasa borealis and Rubi Fructus have exerted inhibitory effects on HS by modulating gene expression of hepatic lipid metabolism (Liu et al., 2013; Nam et al., 2014; Song et al., 2014).

Cyclocarya paliurus (CP) (Batal.) Iljinskaja (family Juglandaceae) is an endemic plant in China, widely used as a daily beverage. Pharmacological experiments have confirmed that CP extracts possess antioxidant, anti-inflammatory, anti-insulin resistance, anti-hyperglycemic and hypolipidemic activities (Ma et al., 2015; Wang et al., 2013; Zhu et al., 2015). It is notable that CP administration showed potential in improving lipid abnormalities, such as decreasing serum total cholesterol (TC) and TG levels, as well as suppressing excessive visceral fat accumulation in HFD treated rodents Qiang et al., 2015; Yao et al., 2015). In addition, CP treatment led to a decrease in hepatic TG concentration and the amount of liver lipid droplets, as well as the level of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in hyperlipidemia models. Our previous data revealed that CP chloroform extract (ChE) rich in triterpenoids exhibited better hypolipidemic effect than other fractions (Jiang et al., 2015). These findings suggest ChE might exert a hepatoprotective effect to ameliorate HS via regulation of hepatic lipid metabolism.

In the current study, we used proton magnetic resonance spectrum ([sup.1]H-MRS) to further evaluate the ChE treatment effect on HS, and investigated its regulation mechanism of key genes involved in liver TG metabolism, including hepatic lipid intake, de novo synthesis, catabolism and export.

2. Materials and methods

2.1. Plant material and extraction

The leaves of Cyclocarya paliurus (Batal.) Iljinskaja were collected from Nanjing Forestry University (Nanjing, Jiangsu, China) in July, and a voucher specimen (No. L20100033) was deposited in the herbarium of the university. The plant materials were authenticated by Prof. Min-Jian Qin from China Pharmaceutical University (Nanjing, Jiangsu, China). 1 kg of the dry leaves powder was extracted with 21 of 80% (v/v) ethanol under reflux for 3 times (2 h each). The extractives were combined, concentrated under reduced pressure and dried in vacuum to remove the solvent. The crude extract (101 g) was suspended in 21 of distilled water, then extracted with 3 1 of chloroform for 3 times. The chloroform extracting solution was also concentrated until dry to provide Cyclocarya paliurus chloroform extract (ChE, 45.6 g).

The components of ChE were determined by a Agilent 1260 Infinity HPLC system (Agilent Technologies, CA, USA) equipped with a UV detector, and a Grace Alltima ODS C18 column (5 pm, 4.6 mm x 250 mm). The UV detection wavelength was set at 210 nm and the column temperature was thermo stated at 30 [degrees]C. The gradient program was as follows: 0-15 min, 40% A; 15-25 min, 40% A to 50% A; 25-30, 50% A; 30-60 min, 50% to 55% A; 60-75 min, 55% A to 100% A; 75-85 min, 100% A. The chromatographic peaks of ChE (Fig. 1) were confirmed by corresponding references and calculated by the calibration curves, which were presented in the supplementary materials (Supplementary Table 1). There was presence of (1) 63.0 [+ or -] 4.0 mg/g of Arjunolic acid. (2) 18.5 [+ or -] 1.7 mg/g of Cyclocaric acid B, (3) 6.4 [+ or -] 0.5 mg/g of Pterocaryoside B, (4) 13.9 [+ or -] 1.1 mg/g of 3[beta], 23-dihyreoxy-12-ene-28-ursolic acid, (5) 14.5 [+ or -]1.3 mg/g of hederagenin, and (6) 12.7 [+ or -] 0.5 mg/g of Oleanolic acid in the ChE.

2.2. Animals, diet and study design

The care and treatment of these rats were in accordance with the Provisions and General Recommendation of Chinese Experimental Animals Administration Legislation. The animal protocol was approved by the Animal Care Ethics Committee of Southeast University (Dingjiaqiao Campus, Nanjing, Jiangsu, China) [Permission No. 20,140,806], Adequate measures were taken to minimize pain of the experimental animals.

40 male Sprague Dawley rats (180-220 g) were purchased from the experimental animal center of Nantong University (Nantong, Jiangsu, China) [Certificate No. SCXK (SU 12,014-000)], and were maintained in air-conditioned quarters at controlled temperature (26 [+ or -] 2 [degrees]C) with 12-h light/dark cycles and 30-70% relative humidity. Animals were allowed free access to water and standard diet for one week before onset of the experiments.

Rats were divided into two groups: one group of 10 rats was continuously fed with a standard diet (AIN-93 M, Anlimo Technology, Jiangsu, China; about 3601 kcal/kg, 10% of calories from fat (Reeves et al., 1993) for 10 weeks as the normal control group (NC), whereas another group of 30 rats was fed with HFD [containing cholesterol 2%, lard 10%, yolk 10%, bile sodium 0.5%, standard diet 77.5% (w/w); about 4016 kcal/kg, 30% of calories from fat] (Pang et al., 2002). Food and water were supplied ad libitum. After 6-weeks HFD feeding to induce HS, 30 HFD-fed rats were randomized into three groups: HFD control group (HC), CP chloroform extract group (ChE) and simvastatin group (SMT) (n=10 in each group). These rats were continuously fed with HFD for the next 4 weeks.

From the 7th week, rats of ChE group were administrated by oral gavage once per day with ChE at the dose of 1 g/kg in a volume of 1 ml/100 g in 0.5% sodium carboxyl methyl cellulose (CMCNa) per day. The dosage of ChE was chosen according to our previous study and the yield of ChE (Yao et al., 2015). The rats in SMT group were treated with 4mg/kg simvastatin (Yichang Yangtze River Pharmaceutical Co., Yidu, Hubei, China) in 0.5% CMC-Na solution as a positive control, to verify the model success and compare the efficacy between ChE and simvastatin treatment. Whereas, rats from control groups were given the same volume of CMC-Na. [sup.1]H-MRS study was performed at the end of each week.

After 4-weeks administration, animals were weighed and anesthetized with 10% chloral hydrate (0.3 ml/100 g) after fasting for 12 h Blood samples were collected from abdominal aortic. The liver was removed and rinsed with physiological saline solution, which was then immediately stored at -70 [degrees]C. The relative liver weight was also calculated as liver weight (g) divided by body weight (100g).

2.3. [sup.1]H-MRS study

At the end of the 6-10th week, 'H-MRS was performed on 3 randomly selected rats from each group to monitor the development of HS at Jiangsu Province Hospital on Integration of Chinese and Western Medicine. The rat was anesthetized with isoflurane, placed supinely and fixed to keep constant position. MR scans were performed on a 1.5T whole-body MR magnet (Echo speed; GE healthcare, Milwaukee, WI, USA) using a rat coil (Chenguang Medical Technologies Co., Ltd, Shanghai, China). The conventional axial fast-recovery fast spin echo (FRFSE) T2-weighted sequence was applied in the following conditions: TE = 102.0 ms, TR=5000 ms, NEX= 1.00, 5 mm slice thickness, 192 phase. A single voxel point resolved surface coil spectroscopy (SV PRESS) was used to obtain the spectral data. The MRS scan parameters were as follows: TE = 144.0 ms, TR= 1500.0 ms, NEX= 8. The regions of interest (ROIs) were manually set on axial T2 images at the right lateral lobe. The sagittal and coronal images were used to set appropriate ROI positions avoiding the major blood vessels, intra-hepatic bile ducts, and the lateral margin of the liver. 3 ROIs of each rat were analyzed. Chemical shifts were referenced to the water signal at 4.7 ppm, and the fat signals at 2.8, 2.1, 1.3 and 0.9 ppm (Liu et al., 2008). The peak area was measured by SAGE 7.3 (GE Medical system). The relative liver fat content is expressed as the ratio beteen the sum of the three fat peak areas and that of water together with fat peaks area (Changhong et al., 2007).

2.4. Biochemical analysis

Biochemical analysis was executed using commercial kits (Nanjing Jiancheng Bio-engineering Institute, Jiangsu, China). Blood samples were centrifuged at 3500 rpm, 4 [degrees]C for 10 min to obtain serum specimens. Level of serum TC, TG, NEFAs, ALT, AST and alkaline phosphatase (ALP) were determined by enzymatic methods.

0.3 g of fresh liver from each rat was homogenized in absolute ethanol at 4 [degrees]C, fixed volume to 3 ml and centrifuged at 3500 rpm, 4 [degrees]C for 10 min. The supernatant was used for the level determination of hepatic TC, TG, and NEFAs following the manufacturer's protocols.

2.5. Liver histologic analysis

One portion of the liver sample obtained from 3 rats of each group were immersed in 10% formalin neutral buffer solution for 48 h, then processed routinely, embedded in paraffin, sectioned to 3 pm thickness and stained with hematoxylin and eosin (H&E). To evaluate the degree of HS, the liver fat was scored as reported (Kuzu et al., 2008). HS was graded as follows: score 0, no steatosis and normal liver; score 1, <25% of intrahepatic fat droplet; score 2, 26-50% of intrahepatic fat droplets; score 3, 51-75% of intrahepatic fat; and score 4, >76% of intrahepatic fat droplets.

2.6. Measurement of liver malonaldehyde (MDA) level

Another portion of 0.3 g of the fresh liver from each rat was homogenized in physiological saline solution at 4 [degrees]C, adjusted volume to 3 ml and centrifuged at 3500 rpm, 4 [degrees]C for 10 min. The supernatant was used for the determination of liver MDA level as an index of lipid peroxidation products by commercial kits (Nanjing Jiancheng Bio-engineering Institute, Jiangsu, China).

2.7. Serum and liver TNF-[alpha] levels

The liver homogenates was prepared as described in 2.6. Both serum and liver levels of TNF-[alpha] were determined using commercial kits (Nanjing Jiancheng Bio-engineering Institute, Jiangsu, China).

2.8. Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis

Total RNA samples from livers of 6 random rats from each group were extracted using an RNApure tissue kit (Beijing CoWin Biotech Co., Ltd, Beijing, China) according to the manufacturer's instructions. Purity was determined using the 260/280 ratio on a Synergy H1 hybrid reader (Biotek, Winooski, Vermont, USA). Samples with a 260/280 ratio of 1.80 or greater were used for cDNA synthesis. cDNA was synthesized using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, Delaware, USA) with a S1000[TM] Thermal cycler (Bio-Rad, Hercules, California, USA), programmed 25 [degrees]C for 10 min, 50 [degrees]C for 30 min and 85 [degrees]C for 5 min. RT-PCR was performed with a Stratagene Mx3000P qPCR System (Agilent Technologies, La Jolla, California, USA) using the Maxima SYBR Green/ROX qPCR Master Mix (2x) (Thermo Scientific, Wilmington, Delaware, USA). Primers for the expression analysis of different genes were shown in Table 1, including genes involved in hepatic lipid intake, like CD36; genes related to lipid synthesis, like diacylglycerol acyltransferase 2 (DGAT-2), SREBP-1c and its downstream gene acetyl-CoA carboxylase 1 (ACC-1), fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD-1); genes in response to lipid catabolism, like PPAR[alpha] and its downstream gene carnitine palmitoyl transferase 1a (CPT-la), acyl-CoA oxidase 1 (ACOX-1); as well as gene function to lipid outflow like apoB100. The reaction volume was 25 [micro]l. The program had a UDG pre-treatment at 50 [degrees]C and an initial incubation at 95 [degrees]C for 10 min, followed by 40 cycles at 95 [degrees]C for 15 s, 60 [degrees]C for 30 s and 72 [degrees]C for 30 s. The gene expression of each sample was analyzed in triplicates and normalized against the internal control gene [beta]-actin. The mRNA levels are normalized to [beta]-actin mRNA and relative quantification was calculated according to the [2.sup.-[DELTA][DELTA]Ct] method (Livak and Schmittgen, 2001). Levels of the NC group were arbitrarily assigned a value of 1.

2.9. Western blot

Total liver protein was obtained from 3 rats in each group using KeyGEN Whole Cell Lysis Assay (KeyGENbio, Jiangsu, China). The protein content was determined with KeyGEN Bradford Protein Quantitation Assay (KeyGENbio, Jiangsu, China). Protein samples (70 [micro]g) were subjected to 10% SDS-PAGE, resolved by electrophoresis, and electrotransferred onto a NC membrane (Pall, New York, USA). After blocking, the membranes were individually incubated at 4 [degrees]C for overnight with rabbit anti-SREBP-1 (1:800, Santa Cruz Biotechnology, CA, USA), rabbit anti-ACC-1 (dilution 1:1000, Santa Cruz Biotechnology, CA, USA) and mouse anti-FAS (dilution 1:1000, Santa Cruz Biotechnology, CA, USA), goat anti-CD36 (dilution 1:1000, Santa Cruz Biotechnology, CA, USA), rabbit anti-PPAR[alpha] (dilution 1:1000, Santa Cruz Biotechnology, CA, USA) and mouse anti-apoB (dilution 1: 800, Santa Cruz Biotechnology, CA, USA) antibodies. The membranes were then incubated with the secondary goat anti-rabbit (1:1000 dilution, KeyGENbio, Jiangsu, China) or the goat anti-mouse (1:1000, KeyGENbio, Jiangsu, China) antibodies at room temperature for 2 h The immunoreactive bands were visualized using an ECL kit (KeyGENbio, Jiangsu, China). Quantification of the band intensity was performed using IPP 6.0 software, adjusted to GAPDH expression.

2.10. Statistics

The data were presented as means [+ or -] standard deviation (S.D.). Repeated measured ANOVA was used for data from [sup.1]H-MRS study. One-way ANOVA was used to compare differences between experimental groups. The ANOVA analysis was followed by LSD or Dunnett's T3 post-hoc test. SPSS19.0 was used for all analysis. P-value <0.05 was considered to be statistically significant.

3. Results

3.1. Effects of ChE on the general health, body weight and relative liver weight

All animals survived the duration of the treatment. HFD-fed rats showed dull furs while those fed with a normal diet did not. Rats of each group consumed an average about 20 g of diet per day, whereas the NC rats took in less energy compared to others because less calories contained in the standard diet (Table 2). Rats treated with HFD for 10 weeks showed an increased trend for the body weight gain and higher relative liver weight compared with the NC rats (p < 0.05, Table 2). After ChE administration, rats showed a significant decrease in the body weight and relative liver weight gain by 11.2% and 4.0% respectively, compared to HC rats (p < 0.05). Oral administration of SMT also reduced body weight gain and relative liver weight compared to the HC group (p < 0.05).

3.2. Effects of ChE on serum lipid profile

Compared with the NC rats, a significant increase in the serum total TC, TG and NEFAs levels were observed in the HC rats by 54.4%, 42.6%, and 52.7%, respectively (p < 0.05, Table 2). However, administration of ChE led to a marked decrease in TC, TG and NEFAs levels by 14%, 19.4 and 25.0% respectively, relative to the HC group (p < 0.05). The SMT treatment also significantly reduced the serum TC, TG and NEFAs levels compared to the HC group (p < 0.05).

3.3. Effects of ChE on liver lipid profile

HFD feeding generated a significant increase in liver TG, TC and NEFAs concentrations by 94.8%, 85.0% and 23.4% compared with the NC group (p <0.05, Table 2). While ChE administration resulted in the reduced level of liver TG, TC and NEFAs by 42.0%, 22.8% and 14.8%, respectively (p < 0.05). SMT-treated rats also exerted a significant lower level of liver TG, TC and NEFAs versus to the HC rats (p < 0.05).

3.4. [sup.1]H-MRS evaluation on the relative liver fat content

An axial view of the liver in a typical rat and the ROI location in the right lateral lobe of the liver were shown in Fig. 2A. Fig. 2B presented the resultant spectrum of two representative rats from HC and ChE group. Results from repeat measured ANOVA are shown in Fig. 2C. No significant differences were found in relative liver fat content among HFD-fed rats after 6-weeks modeling. However, rats in the HC group showed a significant high liver fat content compared to the NC rats (about 13.33-fold, p < 0.05). ChE intervention significantly reversed the accumulation of liver fat induced by HFD after 2-weeks gavage (p < 0.05). Interestingly. ChE treatment for 4 weeks dramatically decreased relative liver fat content by 82.1% compared with the HC group, as well as by 70.8% relative to the original content before administration (p < 0.05). in addition, a comparison between NC and ChE group indicated no statistical difference in the liver fat content at the end of treatment. Likewise, SMT treatment elicited a significant decrease in relative liver fat content (p < 0.05).

3.5. Effects of ChE on the histopathology of liver

As illustrated in Fig. 3, the histological evaluation of liver specimens showed swelling hepatocytes, irregular hepatocyte arrangement and an increase in the amount of hepatic fat in the HFD rats compared with the NC rats. However, ChE and SMT treatment to a large extent improved the degree of hepatic steatosis and reduced the lipid accumulation induced by HFD. The relative content of liver fat in the HC rats was 6.51-fold higher compared with that of the NC rats (Table 2, p < 0.05). After treatment with ChE to NAFLD rats, the liver lipid accumulation decreased by approximately 43.9% (p <0.05). Similarly, SMT treatment attenuated the liver lipid level compared to HC group (p <0.05).

3.6. Effect of ChE on inflammatory events

As described in Table 2, an increase in serum and liver levels of TNF-[alpha] were observed in the HC rats by 12.2% and 22.8%, respectively (p < 0.05). However, ChE administration led to a remarkable decrease by 5.4% and 9.0%, respectively (p <0.05). SMT treatment also showed the reduced level of serum and liver TNF-[alpha] (p < 0.05).

Furthermore, serum ALT, AST and ALP levels were significantly increased in HFD-fed rats by 28.2%, 25.6% and 41.3% respectively, compared to those in NC rats (Table 2, p < 0.05), while the increased levels were markedly lowered after ChE supplementation (by 14.1%, 12.2% and 19.1% respectively) and SMT treatment (p < 0.05).

3.7. Effect of ChE on liver lipid peroxide

The liver M DA level in the HC rats was about 1.87-fold compared to that in the NC rats (Table 2. p < 0.05). ChE treatment could markedly reverse the HFD-induced increase of liver M DA level by 42.8% when compared with HC rats (p < 0.05).

3.8. Effect of ChE on hepatic mRNA expression level

As shown in Fig. 4, the hepatic mRNA level of CD36 in HFD-fed rats was markedly increased to 1.47-fold as compared with that of the NC rats (p < 0.05). The mRNA level of CD36 showed no significant changes in rats treated with ChE, but a notable reduction by SMT treatment compared to that of the HC rats (p < 0.05).

High-fat feeding resulted in an up-regulation of the hepatic mRNA expression level of SREBP-1c, ACC-1 and FAS to 1.99, 1.47 and 1.32-fold respectively, compared to the NC rats (p < 0.05). After ChE treatment, the expression level of SREBP-1c was decreased by 36.2% compared to that of the HC group (p < 0.05). Similar results were also found with the mRNA expression of ACC-1 and FAS by 18.4% and 52.2%, respectively (p < 0.05). Although the mRNA level of SCD-land DGAT-2 was strongly up-regulated in HC rats (p <0.05), few change was observed on their mRNA expression in ChE-treated group. When compared to the HC group, SMT treatment exhibited significant down-regulation in the mRNA expression level of SREBP-lc. ACC-1, SCD-1, but modest influence on that of FAS and DGAT-2 (p < 0.05).

In addition, hepatic mRNA levels of PPAR[alpha] and ACOX-1 in the HC rats were markedly lower than those of the NC rats by 30.26% and 33.73% (p <0.05). However, their mRNA expression did not show noticeable change after ChE administration, as well as CPT-1a mRNA level after HFD or other treatments.

Furthermore, the hepatic mRNA level of apoBlOO in the HC rats was higher compared to the NC rats (29.38%, p < 0.05), and it was down-regulated by SMT treatment (p < 0.05), but not ChE administration.

3.9. Effect of ChE on hepatic protein expression levels

SREBP-1, ACC-1, FAS, CD36 and apoB100 expression levels of the HC rats increased about 11.34, 2.70, 1.53, 1.21 and 5.49 fold respectively, compared to those of the NC rats (p <0. 05, Fig. 5). ChE treatment led to a decrease in the expression levels of SREBP-1, ACC-1, FAS and apoB100 by 71.7%, 33.7%, 58.2% and 32.2% respectively, compared to the HC group (p < 0.05). In addition, HFD also significantly decreased hepatic protein expression level of PPAR[alpha] by 67.2%, while ChE administration showed no effect on the expression of CD36 and PPAR[alpha].

4. Discussion

Our study revealed that ChE exerted a promising regression effect on HS especially after 2 weeks of administration. This effect was partially through reducing serum NEFAs which might lead to a decrease in the amount of liver lipid intake, as well as suppressing hepatic lipid de novo synthesis. ChE also ameliorated HFD-induced hepatic oxidative stress and inflammation, leading to block the development of NAFLD.

The HFD-induced animal model of NAFLD has been widely used to investigate the pathogenesis and assess novel remedy (Lieber et ai., 2004). In the current study, we explored whether ChE can regress preexisting steatosis in HFD fed rat model of NAFLD. The findings indicated ChE dramatically improved HFD-induced abnormal serum and liver lipid profile, as well as liver function and body weight gain in consistent with our previous report (Ma et al., 2015). Furthermore, ChE exhibited a marked reduction of HFD-induced hepatic lipid accumulation by 42-82% from biochemical, histological and [sup.1]H-MRS analysis. Short-term clinical trials with limited participants usually suggested that therapeutic regimen such as weight loss and alimentary control were reported to regress HS by 21-43% (Adams and Angulo, 2006; Jin et al., 2012; Ueno et al., 1997). Although ChE could not reduce hepatic lipid contents in HFD-fed rats back to the normal level, it ameliorated hepatic lipid deposition to a large extent. Therefore, CP preparations may be an attractive alternative for NAFLD remedy if it is further demonstrated to effectively restore the normal level of hepatic lipid in well-designed and large-scale clinical trials.

In order to explore the underlying mechanisms of ChE beneficial effect on the HS, we examined the expression level of the key factors involved in the liver lipid metabolism, including hepatic lipid import and de novo synthesis, as well as lipid oxidation and efflux. It is believed that nearly 60% of TGs deposited in liver in NAFLD comes from circulating NEFAs, whereas NEFAs can be taken in by hepatocytes in proportion to their concentration via CD36 or diffusion (Nguyen et al., 2008). Meanwhile, de novo lipid synthesis leading to an increase in hepatic fat production, also contributes a lot to the occurrence of NAFLD which is under the control of several metabolic regulators (Nguyen et al., 2008). In particular, SREBP-1c is the principal regulator modulating the transcription of the key genes including ACC-1, FAS, and SCD-1 (Osborne, 2000). Both ACC-1 and FAS function to catalysis acetyl-CoA to form palmitic acid, which can be either desaturated with SCD-1 to palmitoleic acid or elongate by the long chain fatty acyl elongase to form stearic acid. Then these synthetic NEFAs (like palmitoleic acid and stearic acid) are used for TG synthesis. Despite SCD-1 is a target gene of SREBP-1c, its hepatic expression in rodents may be SREBP-1c-independent (Postic and Girard, 2008). Both clinical and laboratory experiments confirmed that hepatic expression of SREBP-1c, ACC-1 and FAS were up-regulated in NAFLD patients and HFD-fed mice (Higuchi et al., 2008; Morgan et al., 2008).

After ChE administration, hepatic lipid accumulation in HFD-fed rats was blocked as a result of reducing serum NEFAs level and hepatic de novo fatty acids synthesis. Although ChE did not show a significant effect on liver CD36 mRNA expression, the level of serum NEFAs as the substrate of liver lipid absorption was dramatically decreased. In general, NEFAs in the circulation can stem from dietary intake or adipose tissue lipolysis. Our previous study demonstrated that CP could not only reduce the absorption of exogenous lipid by inhibiting intestinal lipoprotein secretion (Ma et al., 2015), but also decrease visceral fat accumulation (Yao et al., 2015). Given the visceral fat with hyperlipolytic activity can generate a large amount of NEFAs into the vein (Feldstein et al., 2004), it is deduced that CP can eventually decrease the supply of liver NEFAs based on our previous results. Interestingly, ChE significantly showed an inhibitory effect on the circular level of TNF-[alpha] which contributes to adipocyte lipolysis (Ryden et al., 2004). These results suggest that ChE can decrease the serum NEFAs level via suppressing dietary lipid absorption and adipose tissue lipolysis. Besides, administration of ChE also reduced the high expression of ACC-1 and FAS which are closely correlated with SREBP-lc expression, whereas TNF-[alpha] was reported to stimulate hepatic lipid deposition by enhancing SREBP-1c gene expression (Endo et al., 2007). Therefore, ChE showed an inhibitory effect on TNF-[alpha] activity partly contribute to the interference of some factors related with the lipid synthesis.

Adenosine monophosphate-activated protein kinase (AMPK) is a central regulator of energy homeostasis which modulates some downstream targets related to lipid metabolism (Hardie et al., 2003). AMPK activation suppresses the expression of ACC and FAS via the down-regulation of SREBP-1c expression, and reduces lipid accumulation in human hepatic cells (Kohjima et al., 2008). Moreover, the activity of hormone-sensitive lipase which plays key role in lipolysis can be inhibited by AICAR-induced AMPK activation in adipocytes (Viollet et al., 2003). Combined with the previous results that ChE up-regulated AMPK activation (Zhu et al., 2015), it is reasonable to speculate that ChE possesses a beneficial effect on inhibiting lipid synthesis and lowering serum lipid level via AMPK related signal pathway.

As for the targets relevant to liver lipid metabolism and efflux, ChE failed to affect the hepatic mRNA and protein expression of PPAR[alpha], as well as the mRNA expression of apoB100, but down-regulated the protein expression of apoBIOO. PPAR, known as a ligand-activated transcription factor, is highly expressed in liver, skeletal muscle and brown adipose tissue, and up-regulates the expression of genes involved in fatty acids oxidation such as CPT-1a and ACOX-1. As a secretary protein, apoBIOO functions to transfer lipids out of hepatocytes, contributing to hepatic lipid accumulation under its dysregulation (Ota et al., 2008). The current experimental data suggested that the regression effect of ChE on HS may not attribute to regulating lipid oxidation or secretion, while the decreased expression of apoBIOO might be responsible for lowering the serum lipid profiles.

It is generally believed that the increased levels of NEFAs and TG are accompanied with free radicals production in NAFLD patients, resulting in oxidative stress and lipid peroxidation. The pro-inflammatory and pro-fibrogenic effects of M DA in liver are responsible for the progression of NAFLD (Day and James, 1998). In the present study, we found that HFD generated the increase in liver MDA level, while this trend was reversed by ChE administration. The interesting result indicated that ChE may exert protective effect against NAFLD development partly owing to their antioxidant activities.

To our knowledge, the diagnosis of NAFLD focuses on the evaluation of hepatic lipid storage by either imaging methods or liver biopsy with the exclusion of excessive alcohol consumption (Obika and Noguchi, 2012). Nonetheless, liver biopsy is considered as the gold standard for diagnosis of the advanced NAFLD, non-invasive diagnostic methods characterized by safety, reliability and repeatability are more attractive and valuable at the early stage of the disease (Gangadhar et al., 2014). Due to the non-invasive feature and higher sensitivity than other imaging methods, [sup.1]H-MRS offers a better choice for accurate quantification of intrahepatic lipid content (Schwenzer et al., 2009). Therefore, [sup.1]H-MRS is especially suitable for assessment of the HS dynamic changes. In recent years, many clinical and research investigations have successfully employed [sup.1]H-MRS assessment into their experiments to obtain expected results (Hockings et al., 2003; Phielix et al., 2013; Wang et al., 2008). In this study, [sup.1]H-MRS was applied to monitor the content change of the hepatic lipid. A significant decrease of the content was observed after two weeks of ChE administration.

Our previous study has revealed that ChE exerts better hypolipidemic effect than other solvent extractives (Jiang et al., 2015). Furthermore, ChE is rich in triterpenes such as Arjunolic acid, Cyclocaric acid B, Pterocaryoside B, 3[beta], 23-dihyreoxy-12-ene-28-ursolic acid, hederagenin, and Oleanolic acid. Interestingly, these compounds have been reported to improve lipid metabolism, reduce SREBP-1c expression and oxidative stress (Cui et al., 2013; Hong et al., 2006; Li et al., 2014; Sumitra et al., 2001; Yunoki et al., 2008). In further study, we will intend to explore the active component of ChE responsible for its ameliorative effects against hepatic lipid accumulation.

5. Conclusion

Taken together, the present study demonstrates that ChE possesses a repressive effect on HFD-induced HS, partially owing to its ability to reduce serum NEFAs and suppress the signal pathway of hepatic de novo lipid synthesis. Our findings provide new evidence for CP biological effects and a promising candidate drug or health care products for NAFLD.

Conflict of interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

ARTICLE INFO

Article history:

Received 8 September 2015

Revised 23 May 2016

Accepted 2 August 2016

Acknowledgments

This work was partially sponsored by grants awarded from the National Natural Science Foundation of China (No. 81001379, 81503316), the Ninth Batch of "Six Talent Peaks" Project of Jiangsu Province (NO. 2012-YY-008), the Development Program for the Young and Middle-aged Teachers of Common Colleges and Universities of JiangXi, and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Supplementary materials

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2016.08.003.

References

Adams, LA., Angulo. P., 2006. Treatment of non-alcoholic fatty liver disease. Postgrad. Med. J. 82, 315-322.

Liang, C.H., Liu, Y.B., Zhang, Z.L, Xie, S.F., Wang, Q.S., 2007. Initial study of quantitative analysis of fatty liver by 'H-MR spectroscopy imaging. Chin. J. Radiol. 41, 43-46.

Choi,. Si., Diehl, A.M., 2008. Hepatic triglyceride synthesis and nonalcoholic fatty liver disease. Curr. Opin. Lipidol. 19, 295-300.

Cui, W.X., Yang, J., Chen, X.Q., Mao, Q., Wei, X.L. Wen, X.D., Wang, a. 2013. Triterpenoid-rich fraction from Ilex hainanensis Merr. Attenuates non-alcoholic fatty liver disease induced by high fat diet in rats. Am. J. Chin. Med. 41, 487-502.

Day, C.P., James, O.F., 1998. Steatohepatitis: a tale of two "hits"? Gastroenterology 114, 842-845.

Dowman, J.K., Armstrong, M.J., Tomlinson, J.W., Newsome, P.N., 2011. Current therapeutic strategies in non-alcoholic fatty liver disease. Diabetes Obes. Metab. 13, 692-702.

Endo, M., Masaki, T., Seike, M., Yoshimatsu, H., 2007. TNF-[alpha] induces hepatic steatosis in mice by enhancing gene expression of sterol regulatory element binding protein-1c (SREBP-1c). Exp. Biol. Med. 232, 614-621.

Feldstein, A.E., Werneburg, N.W., Canbay, A., Cuicciardi, M.E., Bronk, S.F., Rydzewski, R., Burgart, L.J., Cores, G.J., 2004. Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology 40, 185-194.

Gangadhar, K., Chintapalli, K.N., Cortez, G., Nair, S.V., 2014. MR1 evaluation of fatty liver in day to day practice: Quantitative and qualitative methods. Egypt. J. Radiol. Nucl. Med. 45, 619-626.

Hardie, D.G., Scott, J.W., Pan. DA., Hudson, E.R., 2003. Management of cellular energy by the AMP-activated protein kinase system. FEBS Lett. 546, 113-120.

Higuchi, N., Kato, M., Shundo, Y., Tajiri, H., Tanaka, M., Yamashita, N., Kohjima, M., Kotoh, K., Nakamuta, M., Takayanagi, R., 2008. Liver X receptor in cooperation with SREBP-lc is a major lipid synthesis regulator in nonalcoholic fatty liver disease. Hepatol. Res. 38.1122-1129.

Hockings, P., Changani, K., Saeed, N., Reid, D., Birmingham, J., O'Brien, P., Osborne, J., Toseland, C., Buckingham, R., 2003. Rapid reversal of hepatic steatosis, and reduction of muscle triglyceride, by rosiglitazone: MRI/S studies in Zucker fatty rats. Diabetes Obes. Metab. 5, 234-243.

Hong, XZ., Tang, H.Q, Wu, LM., Li, L.D., 2006. Protective effects of the Alisma orientalis extract on the experimental nonalcoholic fatty liver disease. J. Pharm. Pharmacol. 58, 1391-1398.

Jiang, C.H., Wang, Q.Q, Wei, Y.J., Yao, N., Wu, Z.F., Ma, Y.L., Lin, Z., Zhao, M., Che, C.T., Yao, X.M., Zhang, J., Yin, Z.Q, 2015. Cholesterol-lowering effects and potential mechanisms of different polar extracts from Cyclocarya paliurus leave in hyperlipidemic mice. J. Ethnopharmacol. 176, 17-26.

Jin, Y.J., Kim, K.M., Hwang, S., Lee, S.G., Ha, T.Y., Song, G.W., Jung, D.H., Kim, K.H., Yu, E., Shim, J.H., Um, Y.S., Lee, H.C., Chung, Y.H., Lee, Y., Suh, D.J., 2012. Exercise and diet modification in non-obese non-alcoholic fatty liver disease: analysis of biopsies of living liver donors. J. Gastroenterol. Hepatol. 27, 1341-1347.

Kohjima, M., Higuchi, N., Kato, M., Kotoh, K., Yoshimoto, T., Fujino, T., Yada, M., Yada, R., Harada, N., Enjoji, M., 2008. SREBP-1c, regulated by the insulin and AM PK signaling pathways, plays a role in nonalcoholic fatty liver disease. Int. J. Mol. Med. 21, 507-511.

Kuzu, N., Bahcecioglu, I.H., Dagli, A.F., Ozercan, I.H., Ustundag, B., Sahin, K., 2008. Epigallocatechin gallate attenuates experimental non-alcoholic steatohepatitis induced by high fat diet. J. Gastroenterol. Hepatol. 23. e465-e470.

Li, S.T., Meng, F.Y., Liao, X.L, Wang, Y.M., Sun, Z.X., Guo, F.C., Li, X.X., Meng, M., Li, Y., Sun, C.H., 2014. Therapeutic role of ursolic acid on ameliorating hepatic steatosis and improving metabolic disorders in high-fat diet-induced non-alcoholic fatty liver disease rats. PLoS One 9. e86724.

Lieber, CS., Leo, M.A., Mak, K.M., Xu, Y., Cao, Q., Ren, C., Ponomarenko, A., De-Carli, LM., 2004. Model of nonalcoholic steatohepatitis. Am. J. Clin. Nutr. 79, 502-509.

Liu, L, Yang, M., Lin, X.M., U, Y., Liu, C.J., Yang, Y.F., Yamahara, J., Wang, J.W., Li, Y.H., 2013. Modulation of hepatic sterol regulatory element-binding protein-1c-mediated gene expression contributes to Salacia oblonga root-elicited improvement of fructose-induced fatty liver in rats. J. Ethnopharmacol. 150, 1045-1052.

Liu, Z.Y., Liang, CH., Wang, Q.S., Liu, Y.B., Xu, L. Zheng, J.H., Radiology, D.O., 2008. Evaluation of nonalcoholic fatty liver model in rats using 'H magnetic resonance spectroscopy. World Chin. J. Digestol. 16, 1612-1616.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402-408.

Ma, Y.L, Jiang, C.H., Yao, N., U. Y., Wang, Q.Q., Fang, S.Z., Shang, X.L. Zhao, M., Che, C.T., Ni, Y.C., 2015. Antihyperlipidemic effect of Cyclocarya paliurus (Batal.) lljinskaja extract and inhibition of apolipoprotein B48 overproduction in hyperlipidemic mice. J. Ethnopharmacol. 16, 286-296.

Morgan, K., Uyuni, A., Nandgiri, G., Mao, L. Castaneda, L. Kathirvel, E., French, S.W., Morgan, T.R., 2008. Altered expression of transcription factors and genes regulating lipogenesis in liver and adipose tissue of mice with high fat diet-induced obesity and nonalcoholic fatty liver disease. Eur. J. Gastroenterol. Hepatol. 20, 843-854.

Nam, M.K., Choi, H.R., Cho, J.S., Cho, S.M., Ha, K.C., Kim, T.H., Ryu, H.Y., Lee, Y.I., 2014. Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice. Mol. Med. Rep. 10, 1821-1827.

Nguyen, P., Leray, V., Diez, M., Serisier, S., Le Bloc'h, J., Siliart, B., Dumon, H., 2008. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. (Berl.) 92, 272-283.

Obika, M., Noguchi, H., 2012. Diagnosis and evaluation of nonalcoholic fatty liver disease. Exp. Diabetes Res., 145754 2012.

Osborne, T.F., 2000. Sterol regulatory element-binding proteins (SREBPs): key regulators of nutritional homeostasis and insulin action. J. Biol. Chem. 275, 32379-32382.

Ota, T., Gayet, C., Ginsberg, H.N., 2008. Inhibition of apolipoprotein B100 secretion by lipid-induced hepatic endoplasmic reticulum stress in rodents. J. Clin. Invest. 118. 316-332.

Pang, X.Y., Yao, M.H., Lu, Y.Q. Gong, Q.Y., 2002. Effect of soy isoflavones on malondialdehyde and superoxide dismutase of blood and liver in hypercholesterolemia rats. Chin. J. New Drugs. Clin. Rem. 21, 257-261.

Petts, G., Lloyd, K., Goldin, R., 2014. Fatty liver disease. Diagn. Histopathol. 20. 102-108.

Phielix, E., Brehm, A., Bernroider, E., Krssak, M., Anderwald, C.H., Krebs, M., Schmid, A., Nowotny, P., Roden, M., 2013. Effects of pioglitazone versus glimepiride exposure on hepatocellular fat content in type 2 diabetes. Diabetes, Obesity Metab. 15, 915-922.

Postic, C., 2009. The role of the lipogenic pathway in the development of hepatic steatosis. Diabetes Metab. 34, 643-648.

Postic, C., Girard, J., 2008. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J. Clin. Invest. 118, 829-838.

Reeves, P.G., Nielsen, F.H., Fahey, Jr., G., 1993. AIN-93 purified diets for laboratory rodents: final report of the American institute of nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J. Nutr. 123, 1939-1951.

Ryden, M., Arvidsson, E., Blomqvist, L, Perbeck, L, Dicker, A., Arner, P., 2004. Targets for TNF-alpha-induced lipolysis in human adipocytes. Biochem. Biophys. Res. Commun. 318, 168-175.

Schwenzer, N.F., Springer, F., Schraml, C. Stefan, N., Machann, J., Schick, F., 2009. Non-invasive assessment and quantification of liver steatosis by ultrasound, computed tomography and magnetic resonance. J. Hepatol. 51, 433-445.

Song, Y., Lee, S.J., Jang, S.H., Ha, J.H., Song, Y.M., Ko, Y.G., Kim, H.D., Min, W, Kang, S.N., Cho, J.H., 2014. Sasa borealis stem extract attenuates hepatic steatosis in high-fat diet-induced obese rats. Nutrients 6, 2179-2195.

Sozio, M .S., Liangpunsakul, S., Crabb, D., 2010. The role of lipid metabolism in the pathogenesis of alcoholic and nonalcoholic hepatic steatosis. Semin. Liver Dis. 30, 378-390.

Sumitra, M., Manikandan, P., Kumar, D.A., Arutselvan, N., Balakrishna, K., Manohar, B.M., Puvanakrishnan, R., 2001. Experimental myocardial necrosis in rats: role of arjunolic acid on platelet aggregation, coagulation and antioxidant status. Mol. Cell. Biochem. 224, 135-142.

Tilg, H., Moschen, A.R., 2010. Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology 52, 1836-1846.

Ueno, T., Sugawara, H., Sujaku, K., Hashimoto, O., Tsuji, R., Tamaki, S., Torimura, T., Inuzuka, S., Sata, M., Tanikawa, K., 1997. Therapeutic effects of restricted diet and exercise in obese patients with fatty liver. J. Hepatol. 27, 103-107.

Viollet, B., Andreelli, F., Jorgensen, S.B., Perrin, C, Flamez, D., Mu, J., Wojtaszewski, J.F.P., Schuit, F.C., Birnbaum, M., Richter, E., 2003. Physiological role of AMP-activated protein kinase (AMPK): insights from knockout mouse models. Biochem. Soc. Trans. 31, 216-219.

Wang, N., Dong, H., Wei, S.C., Lu, F.E., 2008. Application of proton magnetic resonance spectroscopy and computerized tomography in the diagnosis and treatment of nonalcoholic fatty liver disease. J. Huazhong Univ. Sei. Technol. (Med. Sei.) 28, 295-298.

Wang, Q.Q., Jiang, C.H., Fang, S.Z., Wang, J.H., Ji, Y., Shang, X.L., Ni, Y.C., Yin, Z.Q, Zhang, J., 2013. Antihyperglycemic, antihyperlipidemic and antioxidant effects of ethanol and aqueous extracts of Cyclocarya paliurus leaves in type 2 diabetic rats. J. Ethnopharmacol. 150, 1119-1127.

Wong, V.W., 2013. Nonalcoholic fatty liver disease in Asia: a story of growth. J. Gastroenterol. Hepatol. 28. 18-23.

Yao, X.M., Lin, Z., Jiang, C.H., Gao, M., Wang, Q.Q., Yao, N., Ma, Y.L, U, Y., Fang, S.Z., Shang, X.L, Ni, Y.C., Zhang, J., Yin, Z.Q, 2015. Cyclocarya paliurus prevents high fat diet induced hyperlipidemia and obesity in Sprague-Dawley rats. Can. J. Physiol. Pharmacol. 93, 677-686.

Yunoki, K., Sasaki, G., Tokuji, Y., Kinoshita, M., Naito, A., Aida, K., Ohnishi, M., 2008. Effect of dietary wine pomace extract and oleanolic acid on plasma lipids in rats fed high-fat diet and its DNA microarray analysis. J. Agrie. Food Chem. 56, 12052-12058.

Zhu, K.N., Jiang, C.H., Tian, Y.S., Xiao, N., Wu, Z.F., Ma, Y.L, Lin, Z., Fang, S.Z., Shang, X.L., Liu, K., Zhang. J., Liu, B.L, Yin, Z.Q. 2015. Two triterpeniods from Cyclocarya paliurus (Batal) lljinsk (Juglandaceae) promote glucose uptake in 3T3-L1 adipocytes: The relationship to AMPK activation. Phytomedicine 22, 837-846.

Chemical compounds studied in this article: Arjunolic acid (pubchem cid: 73.641) Cydocaric acid B (CAS No. 182315-46-4) Pterocaryoside B (CAS No. 168.146-27-8) Hederagenin (pubchem cid: 258.538) 3[beta], 23-dihyreoxy-12-ene-28-ursolic acid (CAS No.125137-37-3) Oleanolic acid (PubChem CID: 10.494)

Zi Lin (a,b), Zheng-Feng Wu (a,b), Cui-Hua Jiang (b,a), Qing-Wen Zhang (c), Sheng Ouyang (d,e), Chun-Tao Che (e), Jian Zhang (b), Zhi-Qi Yin (a,e), *

(a) Department of Natural Medicinal Chemistry &? State Key Laboratory of Natural Medicines. China Pharmaceutical University. Nanjing, Jiangsu 210009. China

(b) Laboratory of Translational Medicine, Jiangsu Province Academy of Traditional Chinese Medicine. Nanjing 210028. China

(c) State Key Laboratory of Quality Research in Chinese Medicine and Institute of Chinese Medical Sciences. University of Macau, Macao

(d) Department of Pharmacy, JiangXi University of Traditional Chinese Medicine, Nanchang 330004. PR China

(e) Department of Medicinal Chemistry and Pharmacognosy, and WHO Collaborating Center for Tradition Medicine. College of Pharmacy. University of Illinois at Chicago. Chicago. IL 60612, USA

Abbreviations: NAFLD, non-alcoholic fatty liver disease; Hs. hepatic steatosis; CP. Cyclocarya paliurus; ChE. Cyclocarya paliurus chloroform extract; HFD, highfat diet; SREBP-lc. sterol regulatory element-binding protein 1c; PPAR[alpha], peroxisome proliferator-activated receptor-[alpha]; TC. triglyceride; CD36. fatty acid translocase; apoB100, apolipoprotein B100; NEFAs, non-esterified fatty acids; VLDL, very low density lipoprotein; ALT. alanine aminotransferase: AST. aspartate aminotransferase; [sup.1]H-MRS, proton magnetic resonance spectrum; HPLC. high-performance liquid chromatography; NC, normal control; HC. HFD control; SMT. simvastatin; CMMC-Na, sodium carboxyl methyl cellulose; FRFSE, fast-recovery fast spin echo; SV PRESS, single voxel point resolved surface coil spectroscopy; ROIs. regions of interest; TC, total cholesterol: ALP, alkaline phosphatase; H&E, hematoxylin and eosin; MDA. malonaldehyde; RT-PCR, real-time quantitative reverse-transcriptase polymerase chain reaction; DCAT-2, diacylglycerol acyltransferase 2; ACC-1, acetylCoA carboxylase 1; FAS, fatty acid synthase; SCD-1, stearoyl-CoA desaturase 1; CPTla, carnitine palmitoyl transferase la; ACOX-1, acyl-CoA oxidase 1; AMPK, adenosine monophosphate-activated protein kinase.

* Corresponding author at: Department of Natural Medicinal Chemistry & State Key Laboratory of Natural Medicines. China Pharmaceutical University, No.24, Tongjiaxiang, Gulou District, Nanjing, 210009 Jiangsu. China. Fax: +86 25 85301528.

E-mail address: cpu-yzq@cpu.edu.cn (Z.-Q, Yin).

http://dx.doi.org/10.1016/j.phymed.2016.08.003

Table 1
Primer sequences for real time PCR assays.

Gene            Forward Primers          Reverse primers

CD36            AGCTGCACCACATATCTACACA   CTTTGTAACCCCACAAGAGTTCC
SREBP-1c        CCAAGTACACAGGAGGCCAT     AGATCTCTGCCAGTGTTGCC
SCD-1           CCTCCAAGAGATCTCCAGTTCC   CTCCATTCTGCAGGTTTCCG
ACC-1           TGTAGAAACCCCAACCGTCG     CTGGAAACCAAACTTGGCCG
FAS             CCAGCAGCATGATGTAGCAC     AGTTGCACACCACAAGGTCA
PPARa           CGGCGTTGAAAACAAGGAGG     CCTTGGCAAATTCCGTGAGC
CPT-l[alpha]    TGCAGTCGACTCACCTTTCC     TCAAAGAGCTCCACCTGCTG
ACOX-1a         ATTGCCACTACGTGCTCCTT     GCTCCCCTCAAGAAAGTCCC
apoB1OO         CTCTTCAGTGGCAGCAACAC     GCATTGGAGTAAGCCCCTGT
DCAT-2          CACATTGGCTGGCAACTTCC     TCCCACCACGATGACAATCG
[beta]-actin    GTGGGTATGGGTCAGAAG       AAACTGTGGTGCCAAATC

Sequences: 5' to 3'.

Table 2
Summary of metabolic parameters in rats of each group.

GROUP              NC                       HC

Body weight (g)    272.14 [+ or -] 35.34    338.22 [+ or -] 33.42 *
Relative liver     2.42 [+ or -] 0.21       2.77 [+ or -] 0.19 *
  weight (%)
Food intake        19.84 [+ or -] 2.71      20.83 [+ or -] 3.72
  (g/d)
Energy intake      71.44 [+ or -] 9.76      83.65 [+ or -] 11.93
  (kcal/d)
Serum
TG (mmol/l)        0.47 [+ or -] 0.08       0.67 [+ or -] 0.08-
NEFAs              1354.31 [+ or -] 345.46  2067.26 [+ or -] 434.89 *
  ([micro]mol/l)
TC (mmol/l)        1.58 [+ or -] 0.15       2.44 [+ or -] 0.36 *
ALT (U/l)          35.00 [+ or -] 3.39      44.88 [+ or -] 3.04 *
AST (U/l)          117.43 [+ or -] 13.61    147.33 [+ or -] 8.14 *
ALP (U/l)          160.11 [+ or -] 27.76    226.83 [+ or -] 37.77 *
TNF-[alpha]        78.35 [+ or -] 4.78      87.87 [+ or -] 3.42 *
  (ng/l)
Liver
TC (mg/g liver)    7.66 [+ or -] 2.27       14.92 [+ or -] 2.35 *
NEFAs              29.93 [+ or -] 5.21      32.00 [+ or -] 3.67 *
  ([micro]mol/g
  liver)
TC (mg/g liver)    1.40 [+ or -] 0.25       2.59 [+ or -] 0.27 *
Fat score (+)      0.43 [+ or -] 0.51       2.80 [+ or -] 0.63 **
MDA (mg/g liver)   19.15 [+ or -] 5.41      35.81 [+ or -] 6.29 **
TNF-[alpha]        598.45 [+ or -] 68.95    735.18 [+ or -] 72.14 **
  (pg/g liver)

GROUP              ChE                       SMT

Body weight (g)    300.7 [+ or -] 36.72#     29638 [+ or -] 28.55#
Relative liver     2.66 [+ or -] 0.22#       2.58 [+ or -] 0.20#
  weight (%)
Food intake        20.14 [+ or -] 2.43       20.61 [+ or -] 1.37
  (g/d)
Energy intake      80.88 [+ or -] 9.76       82.77 [+ or -] 12.09
  (kcal/d)
Serum
TG (mmol/l)        0.54 [+ or -] 0.06 *#     0.50 [+ or -] 0.06 *#
NEFAs              1551.73 [+ or -] 367.22#  1476.51 [+ or -] 383.83#
  ([micro]mol/l)
TC (mmol/l)        2.08 [+ or -] 0.36#       1.86[+ or -]0.39#
ALT (U/l)          38.57 [+ or -] 5.47 *#    39.83 [+ or -] 5.38 *#
AST (U/l)          129.00 [+ or -] 16.87 *#  135.14 [+ or -] 10.42 *#
ALP (U/l)          183.43 [+ or -]31.83 *#   176.17 [+ or -] 32.76 *#
TNF-[alpha]        83.05 [+ or -] 2.07#      78.98 [+ or -] 2.11 #
  (ng/l)
Liver
TC (mg/g liver)    8.66 [+ or -] 2.58#       8.92 [+ or -] 2.17#
NEFAs              27.27 [+ or -] 5.62#      25.98 [+ or -] 6.18#
  ([micro]mol/g
  liver)
TC (mg/g liver)    2.00 [+ or -] 0.28 *#     1.96 [+ or -] 0.27 *#
Fat score (+)      1.23 [+ or -] 0.44 **##   1.64 [+ or -] 0.50 **##
MDA (mg/g liver)   20.47 [+ or -] 4.14##     21.38 [+ or -] 5.29##
TNF-[alpha]        668.98 [+ or -] 54.82 *#  662.58 [+ or -] 58.55#
  (pg/g liver)

GROUP              P-value (HC vs. ChE)

Body weight (g)    0.022
Relative liver     0.049
  weight (%)
Food intake        0.86
  (g/d)
Energy intake      0.86
  (kcal/d)
Serum
TG (mmol/l)        0.0032
NEFAs              0.023
  ([micro]mol/l)
TC (mmol/l)        0.023
ALT (U/l)          0.0088
AST (U/l)          0.024
ALP (U/l)          0.023
TNF-[alpha]        0.039
  (ng/l)
Liver
TC (mg/g liver)    1.9E-5
NEFAs              0.049
  ([micro]mol/g
  liver)
TC (mg/g liver)    0.018
Fat score (+)      6.2E-9
MDA (mg/g liver)   1.8E-7
TNF-[alpha]        0.032
  (pg/g liver)

Croups: NC=normal control: HC=high-fat diet control: ChE=CP
chloroform extract: SMT=green tea. * p <0.05 compared with
NC; # p < 0.05 compared with HC.

Fig. 2. Results of the [sup.1]H-MRS study. Chemical shifts were
referenced to the water signal at 4.7ppm, and the fat signals at
2.8, 2.1, 1.3 and 0.9ppm. The relative liver fat content is
expressed as the percentage of the sum of the peak areas of the
three fat peaks to the sum of areas of water and fat peaks. A.
Axial spin-echo image through the liver of a Sprague Dawley rat
showing the placement of the ROI; B. typical MRS results from the
1# rat of HC group and the 3# rat of ChE group; C. Statistical
results of MRS relative liver fat contents. Results are represented
as mean [+ or -] S.D. of 3 independent experiments. Groups:
NC=normal control; HC=high-fat diet control; ChE=CP chloroform
extract; SMT=simvastatin. * p < 0.05 compared with NC; (#) p < 0.05
compared with HC; ([dagger]) p < 0.0,5 compared with week 6 of each
group by a repeated measure ANOVA within groups.

A

B

C

Week    P-value
        (HC vs. ChE)

6       0.73
7       6.60E-04
8       1.70E-05
9       2.10E-06
10      0.014

P value of ChE
(between weeks)     Week6

Week7               0.082
Week8               0.0092
Week9               0.0029
Week10             2.20E-05


----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2016 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Lin, Zi; Wu, Zheng-Feng; Jiang, Cui-Hua; Zhang, Qing-Wen; Ouyang, Sheng; Che, Chun-Tao; Zhang, Jian;
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Nov 15, 2016
Words:8749
Previous Article:Herbalog: a tool for target-based identification of herbal drug efficacy through molecular docking.
Next Article:Eremophila maculata--isolation of a rare naturally-occurring lignan glycoside and the hepatoprotective activity of the leaf extract.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters