Printer Friendly

The Genetic Diversity and Population Genetic Structure of the Red Panda, Ailurus fulgens, in Zoos in China.

1. Introduction

The important issues for conservation and management include both the identification of local populations and the origin of wild individuals. This can be done using morphological characteristics or tagging programs. However, genetic information can provide a niche over traditional methods. Understanding the distribution of genetic variation within a species and how it is affected by human activities is essential for the development of effective conservation and management programs. The red panda (Ailurus fulgens), a member of the order Carnivora, is an arboreal vegetarian mammal that depends almost mainly on a bamboo diet. The major threats to wild red pandas include habitat loss, fragmentation, and degradation [1]. Red panda population has declined by 50% over last three generations and this decline is still continuing [2]. The protection of wild populations and good management of captive red pandas are believed equally important for their conservation.

The red panda is one of the earth's living fossils since their ancestors originate more than ten million years ago across Eurasia. Currently red panda populations live sporadically in bamboo forests of India, Himalayan, and Heng-Duan mountains in Nepal, Bhutan, Myanmar, and China [3]. In China, its distribution is mainly found in Sichuan, Yunnan, and Tibet [4]. Analyses based on mitochondria DNA (mtDNA) and microsatellites can help infer levels of genetic variation, inbreeding, and relatedness within a population. Microsatellites are hypervariable loci, and are popular markers for population and conservation genetic researches at the intraspecific status due to their high mutation rates. The application of microsatellite analysis is viewed as an informative, cost effective, and reproducible method in investigating the genetic structure of animals including red pandas [3].

The three levels of biodiversity are ecosystem diversity, species diversity, and genetic diversity [5]; genetic diversity is the basis of other two counterparts. Comprehensively understanding the genetic diversity of a species facilitates the development of effective conservation strategies and measures. It was reported that in 2015, around 1382 red pandas have been registered with 413 bred in 50 zoos in China. These animals have been raised in China for >60 years [6] and their genetic diversity must be urgently assessed. Previous studies combined nine microsatellite loci and 551 bp of mitochondrial DNA control regions to analyze the genetic structures of wild red pandas across five populations (namely Qionglai, Liangshan, Xiaoxiangling, Gaoligong, and Tibet) [7]. Liang [8] used 28 microsatellite loci to examine the genetic diversity of the red pandas at the Chengdu Research Base of Giant Panda Breeding, Pixian Farm, and Kunming Zoo and observed high genetic diversity in all three populations. These limited results have potentially revealed the wild populations exhibited higher genetic diversity than the captive populations did, and therefore indicate the significance of breeding management within the zoos.

The current status of the genetic diversity of captive red pandas elsewhere in China remains unknown. The present study investigated the genetically diverse levels of 116 captive pandas using microsatellite analysis across the 11 captive populations. The data shown here shall present whether the current strategy of management and breeding programs in China zoos could maintain the versatile genetic structure of red pandas.

2. Methods

2.1. Sampling

All the animal handling and experimental protocols were performed following the red panda

[Ailurus fnlgens) care manual (created by the AZA red panda species survival plan[R]) and were carefully reviewed and approved by the ethics committee of the Straits Giant Panda Research and Exchange Center (FZ) with permission number of FZ-SGPREC-100-EA-091. All experiments were performed in accordance with relevant guidelines and regulations.

Captive red panda samples (n = 116) were collected from zoos or breeding bases in the following locations: Fuzhou, Wuxi, Shanghai, Beijing, Panyu, Guangzhou, Chongqing, Dazu, Mianning, Huangshan, and Wenling. A total of 100 blood samples, 13 skin samples, and 3 hair samples were collected. The blood samples were stored in EDTA-containing vacuum test tubes at -20[degrees]C. The samples of the skin tissue were taken from the outer edge of the ear after topical disinfection and were stored in 75% ethanol. The hair samples were retrieved from the back or from hair follicles on the tail of red pandas and were stored in 75% ethanol.

2.2. DNA Extraction

DNA extraction of the blood, skin, and hair samples was conducted through the sodium dodecyl sulfate and phenol-chloroform methods [9]. DNA quality was tested using 1% agarose gel electrophoresis, and concentration was measured using a NanoDrop 1000 spectrophotometer (Thermal Fisher Scientific, Waltham, MA, USA). Subsequently, the solution was diluted to 100 ng/qL and stored at -20[degrees]C.

2.3. Polymerase Chain Reaction and Genotyping

According to the previous studies [10-12], 19 microsatellite loci were screened for genetic diversity analysis, as shown in Table 1. For developing the multiplex PCR reaction, the forward primers (5'-end) were modified with the following fluorescent dyes: fluorescein amidite (FAM), hexachlorofluorescein (HEX), tetramethylrhodamine (TAMRA), and fluorescein isothiocyanate (FITC). The specifications of the polymerase chain reaction (PCR) are as follows: 2 [micro]L 10 * Buffer (25 mmol/L Mg[Cl.sub.2]), 0.4 [micro]L 2.5 mmol/L deoxyribose-containing nucleoside triphosphates, 10 [micro]mol/L forward and reverse primers (1 [micro]L each), 0.2 [micro]L Taq polymerase, 100 ng/uL DNA template of 1.0 [micro]L, and the rest was filled with ultrapure water to 20 [micro]L. PCR amplification steps were as follows: initial denaturation at 95[degrees]C for 5 min, denaturation at 94[degrees]C for 40 s, annealing at 51-60[degrees]C (depending on the primer melting temperature) for 40 s, extension at 72[degrees]C for 40 s. After 35 cycles, the DNA samples were further extended at 72 [degrees]C for 10 min and stored at 4[degrees]C thereafter. Subsequently, the PCR products were sequenced using an Applied Biosystems 3730*1 DNA Analyzer (Thermal Fisher Scientific, Waltham, MA, USA). The genotyping parameters were configured using GeneMapper 4.0 (Thermal Fisher Scientific, Waltham, MA, USA) and the GeneScan 500 LIZ Size Standard (Thermal Fisher Scientific, Waltham, MA, USA).

2.4. Statistical Method

The Microsatellite Toolkit (http://dscar.gene.ie-tcd./microsatellitetoolkit/m) was installed in Excel as an add-on to verify the accuracy of the input allele values and fragment intervals before the polymorphism information content (PIC) was calculated. The number of alleles (NA), observed heterozygosity ([H.sub.O]), expected heterozygosity ([H.sub.E]), and genetic distance between pairs ([F.sub.ST]) were calculated using Arlequin 3.5 [13]. FSTAT 2.9.3 [14] was employed for assessing the allelic richness (AR) and the fixation indices of F-statistics comprising the inbreeding coefficient of an individual relative to the total population ([F.sub.IT]), the genetic differentiation index ([F.sub.ST]), and the inbreeding coefficient of an individual relative to the subpopulation ([F.sub.IS]). The Hardy-Weinberg equilibrium was tested using GENEPOP 4.0 [15]. The common microsatellite loci between the present study and Liang [8] were used to compare the expected heterozygosity between the two studies through a one-way ANOVA using SPSS 14.0 (SPSS Inc., Chicago, IL, USA). The result of present study also compared the genetic diversity of captive populations with Hu's study about wild red pandas across the following five populations: Qionglai (QL), Liangshan (LS), Xiaoxiangling (XXL), Gaoligong (GLG), and Tibet (TIB) [7],

Genetic clustering analysis was conducted using Structure 2.3.1 [16]. Ten independent runs were simulated for each value of K (the number of clusters) between 1 and 10. The assumed mixed model and the frequency of associated alleles were simulated 1,000,000 times with 100,000 burn-in runs. The number of genetic clusters ([DELTA]K) was estimated using the equation [DELTA]K = m|L(K + 1) - 2L(K) + L(K - 1)|/s[L(K)] [17].

3. Results

3.1. Genetic Diversity of Populations

A total of 175 alleles were detected among the 116 red pandas screened through the 19 loci. The number of alleles in each locus ranged between 5 and 18 with a mean value of 9.21 [+ or -] 3.6 alleles; [H.sub.E] ranged between 0.528 and 0.901, with a mean value of 0.730 [+ or -] 0.115. [H.sub.O] ranged between 0.513 and 0.926, with a mean value of 0.719 [+ or -] 0.145, and PIC ranged between 0.469 and 0.889, with a mean value of 0.708 [+ or -] 0.131. Except for the moderate polymorphism level observed on the locus Aifu-39, all other loci exceeded 0.5 and exhibited a high polymorphism level, as shown in Table 2.

The expected heterozygosity of the captive populations in this study was compared with that in Liang's study [8] using the 16 common microsatellite loci. The expected heterozygosity among each captive population was nonsignificant (p > 0.05), as shown in Table 3. This result implies these red pandas in the zoos still possess similar level of genetic diversity as the wild animals do.

The genetic diversity of the captive populations was compared with that of the wild red panda populations in Hu et al. [7]. The different result revealed that the captive populations exhibited a slightly higher genetic diversity than the wild populations did, as shown in Table 4. Among the 11 captive populations, the Fuzhou population had the highest number of mean alleles with 7.11; the Mianning population had the highest allelic richness with 4.026. All 11 captive populations had HE and HO exceeding 0.5, as shown in Table 5. More data needed to be collected and validated for assessing the possible variances and underlying mechanisms.

3.2. Hardy-Weinberg Equilibrium Test

The present study verified the Hardy-Weinberg equilibrium of the 11 captive populations. The results revealed that the Fuzhou and Wuxi populations exhibited significant deviations from the Hardy-Weinberg equilibrium (p < 0.01), whereas other populations were in equilibrium, as shown in Table 5.

3.3. Genetic Differentiation between Pairs of Populations

Table 2 demonstrates that the [F.sub.IT] of all loci exhibited the significant value of 0.049 (p < 0.01). This result was contributed by 47.36% of the loci, and the [F.sub.IT] of all loci ranged from -0.209 (Aifu-12) to 0.269 (Aifu-7).

The mean [F.sub.IS] of all loci had a nonsignificant -0.006. Further analysis of the [F.sub.IS] of each population revealed that the [F.sub.IS] ranged from -0.73 (Beijing) to 0.111 (Huangshan). Only the Wuxi and Huangshan populations had a significantly positive [F.sub.IS], indicating low inbreeding levels in most populations, as shown in Table 5.

All loci contributed the significant [F.sub.ST] of the corresponding subpopulations ([F.sub.ST] = 0.055, p < 0.001). Further analysis of the genetic differentiation between pairs of populations revealed that most captive populations exhibited substantial genetic differentiation, as shown in Table 6.

3.4. Genetic Structure Analysis

Genetic structure analysis revealed that the maximum [DELTA]K occurred when k = 3 ([DELTA]K = 21.4), as shown in Figure 1. Figure 2 illustrates that the 11 captive populations can be grouped into three genetic clusters. When examining the genetic source of each individual in a captive population, the three genetic clusters from other captive populations were identified. In other words, the wild individuals in these captive populations are likely to be associated with several different mountain populations.

4. Discussion

Effective genetic management depends on comprehensively understanding the genetic diversity of captive populations. By analyzing the number of alleles, gene polymorphism (PIC), genetic richness, genetic heterozygosity, and the Hardy-Weinberg equilibrium, we revealed the genetic diversity of captive red pandas in the specific zoos in China.

In conservation genetics research, NA is a critical indicator of the genetic variation of a population. The mean NA of the 11 captive populations ranged from 4.05 (Beijing) to 7.11 (Fuzhou), indicating the abundant genetic variation in captive populations. The mean NA of the Fuzhou population was 7.11, indicating the genetic diversity of this population. This may be attributed to the many red pandas in the Fuzhou population, which increased the NA. Liang et al. [8] reported high NAs from the 28 polymorphic microsatellite loci in the Chengdu Research Base of Giant Panda Breeding (9.09), Pixian Farm (6.69), and Kunming Zoo (3.72), and proposed that all three populations exhibited high genetic diversity. However, sample size is one of the determinants for NA, a larger NA may be detected in a larger sample size. Therefore, a more comparable result can be obtained through the allelic richness of populations. In the study of the effect of habitat cave interference on the population size and genetic richness of David's myotis (Myotis davidii), You et al. [18] reported that allelic richness was not correlated to the population size. Among our 11 populations, the Mianning population exhibited the highest allelic richness at 4.026, whereas the Beijing population had the lowest at 3.505. The analysis of allelic richness indicated that the Mianning population should had a higher genetic diversity.

The comparison of our results and those in the findings from Liang et al. [8] showed that the captive populations had nonsignificant [H.sub.E] in 10 loci ranging from 0.668 to 0.779, as shown in Table 3. Hu et al. [7] reported the [H.sub.O] and [H.sub.E] of 0.679 and 0.719 in the diversity of red pandas in Qionglai, Liangshan, Xiaoxiangling, Gaoligong, and Tibet (n = 105), whereas the present study reported the [H.sub.O] and [H.sub.E] of 0.719 and 0.730, respectively (n = 116). The mean NA of the wild populations in Hu et al. [7] was 9.2, whereas that of the captive populations here was 9.3, as shown in Table 4. Among the nine microsatellite loci employed in Hu et al. [7], seven were consistent with those in our study. Comparing heterozygosity and mean NA revealed that the captive populations had slightly higher genetic diversity than the wild populations did. However, the meaning of this little difference should need more cases and analysis to uncover the reasons.

Yan et al. [19] reported that the captive giant pandas in the Wolong National Nature Reserve had a lower genetic diversity than the wild population of giant pandas in Qionglai did, with [H.sub.E] of 0.620 and 0.779, respectively. This phenomenon is not observed in red pandas, and we thought that the high genetic diversity of captive red pandas can be attributed to the supplement of wild populations to achieve the genetic admixture of captive and wild individuals.

Red pandas have a short life expectancy, high mortality rate, and low offspring survival rate, resulting in difficult self-sustainment among the captive populations in China [20]. The sustainability of red panda reproduction relies on supplementary sources from the wild, and some institutions still obtained wild red pandas as of 2007. The high genetic diversity of captive red panda populations can be attributed to the regular infusion of wild blood and manage stud book more efficiently. This necessitates verification of pedigree data and builds a standard management about red pandas in China.

The essence of the Hardy-Weinberg equilibrium in red panda populations refers to the unchanged genetic and genotype frequencies throughout generations in a large- scale and randomized mating population in the absence of external effects such as selection, migration, and mutation. The Hardy-Weinberg equilibrium is based on random mating in natural populations [21]. Endangered species frequently deviate from the Hardy-Weinberg equilibrium because of heterozygote deficiency caused by subspecies, inbreeding, and null alleles [22]. The present study revealed that the captive Fuzhou population significantly deviated from the Hardy- Weinberg equilibrium. Although natural mating was practiced in this population, mating selectivity led to varying breeding participation among individual red pandas. The paternity test of the captive Fuzhou population [23] using microsatellite amplification revealed that two male red pandas were responsible for most of the breeding, which should contribute to the deviation from the Hardy-Weinberg equilibrium.

The present study estimated the genetic status among the red panda populations through an F-statistic. The genetic differentiation coefficient ([F.sub.ST]) is a critical indicator of genetic differentiation among subpopulations. It measures the variance of the average heterozygosity in a subpopulation relative to the total population, ranging between 0 and 1. Wright [24] argued that an [F.sub.ST] value between 0 and 0.05 indicates a low level of genetic differentiation between subpopulations, 0.05-0.15 indicates moderate genetic differentiation, and 0.15-0.25 indicates a high level of genetic differentiation. The present study reported a moderate genetic differentiation among the red panda subpopulations in all microsatellite loci ([F.sub.ST] = 0.055). Further analysis revealed that most population pairs had a significantly high [F.sub.ST], indicating a high level of genetic differentiation between captive populations.

The inbreeding coefficient [F.sub.IS] indicated the decreased proportion of heterozygotes because of nonrandom mating among individuals in a subpopulation. The range of [F.sub.IS] is between -1 and 1. A positive [F.sub.IS] indicates severe inbreeding in a population, resulting in heterozygote deficiency, whereas a negative [F.sub.IS] indicates an outbreeding and heterozygote-surplus population. In this study, the captive populations in Fuzhou, Shanghai, Beijing, Guangzhou, and Wenling had negative [F.sub.IS] values, indicating a heterozygote surplus; whereas those in Wuxi, Panyu, Chonqing, Dazu, Mianning, and Huangshan had various degrees of heterozygote deficiency. The mean [F.sub.IS] of the total population was -0.067, revealing a low level of inbreeding in the total population. Wang et al. [25] examined the genetics of 34 giant pandas in two major captive populations in China (the Chengdu Research Base of Giant Panda Breeding and the China Research and Conservation Center for Giant Panda in Wolong), and reported [F.sub.IS] values of 0.3221 and 0.3983, respectively. By contrast, captive red panda populations exhibited lower [F.sub.IS], indicating a low level of inbreeding. Inbreeding existed to an extent in some captive populations such as Huangshan ([F.sub.IS] = 0.111). The existing captive red pandas have a small population scattered in the zoos throughout China, and few subpopulations have 10 or more red pandas. Therefore, although the existing population has a high level of genetic diversity, the small population may lead to increased inbreeding between captive red pandas in the future.

Cluster analysis is an ideal instrument for genetic structure analysis of a population. The principle of clustering is to assume each analyzed individual has a common ancestor in all categories, and genetically similar individuals are clustered together to estimate the probability values of each category belonging to the said ancestor. When an individual has a more than 80% probability of being classified to a specific category, the individual is inferred to belong in this category. The present study conducted structure analysis to group the 11 captive populations into three clusters. Hu et al. [7] reported that the five wild red panda populations were grouped into three genetic clusters (Gaoligong-Tibet, Xiaoxiangling, and Qionglai-Liangshan). The pedigree record of the Fuzhou captive population revealed that the ancestors originated from (1) Yele County, Mianning, Sichuan (Xiaoxiangling Range), (2) Mabian, Sichuan (Liangshan Range), and (3) Yunnan (Gaoligong Range). The clustering result of the captive Fuzhou population was consistent with that of the wild population, reflecting the mountainous origin of the wild individuals in the captive population. However, most pedigree records of red pandas in China are poorly documented, resulting in difficulties in the development of in-depth genetic management. Therefore, strengthening the investigation of the wild origins of captive red pandas is imperative for the genetic management of captive red panda populations.

5. Conclusions

The genetic diversity among captive red pandas is similar to that of the wild population. A proper and scientifically-based management program should be established to avoid inbreeding and maintain the genetic diversity in captive red pandas.

doi: 10.3390/ani10061008

Author Contributions: Data curation, Y.-f.X.; funding acquisition, C.-C.C.; investigation, Y.-f.X., C.-C.L. and S.-h.X.; methodology, C.-C.L.; project administration, C.-C.L. and S.-h.X.; resources, C.-C.C.; supervision, C.- S.L. and C.-C.C.; validation, C.-S.L. All authors have read and agreed to the published version of the manuscript.

Funding: This research received no external funding.

Acknowledgments: We appreciate Hu Yibo and Shan Lei from the Institute of Zoology of the Chinese Academy of Science for the support and assistance they provided and the zoos that provided research samples. We would also like to thank Chia L. Tan from the San Diego Zoo Institute for Conservation Research in the United States for editing the English abstract.

Conflicts of Interest: All the authors- Yun-fang Xiu, Su-hui Xu, Cheng-Chi Liu, Chen-Si Lin and Chin-Cheng Chou declare no potential conflict of interest.

References

[1.] Su, B.; Fu, Y.; Wang, Y.X.; Chakraborty, R. Genetic diversity and population history of the red panda (Ailurus fulgens) as inferred from mitochondrial DNA sequence variations. Mol. Biol. Evol. 2001, 18, 1070-1076. [CrossRef]

[2.] Wei, F.; Feng, Z.; Wang, Z.; Hu, J. Current distribution, status and conservation of wild red pandas Ailurus fulgens in China. Biol. Conserv. 1997,89,285-291. [CrossRef]

[3.] Kumar, A.; Rai, U.; Roka, B.; Jha, A.K.; Reddy, RA. Genetic assessment of captive red panda (Ailurus fulgens) population. SpringerPlus. 2016, 5, 1750. [CrossRef]

[4.] Thapa, A.; Hu, Y.; Wei, F. The endangered red panda (Ailurus fulgens): Ecology and conservation approaches across the entire range. Biol. Conserv. 2018, 220, 112-121. [CrossRef]

[5.] Yue, T.X. Studies and questions of biological diversity. Acta Ecol. Sin. 2001, 21, 462-467.

[6.] Hu, H.G.; Shen, X.Y. The history and status of captive red panda breeding in China. Wild Anim. 1997, 18, 16-18.

[7.] Hu, Y.; Guo, Y.U.; Qi, D.; Zhan, X.; Wu, H.U.A.; Bruford, M.W.; Wei, F. Genetic structuring and recent demographic history of red pandas (Ailurus fulgens) inferred from microsatellite and mitochondrial DNA. Mol. Ecol. 2011, 20, 2662-2675. [CrossRef]

[8.] Liang, X. Construct the microsatellite libraries from red panda (Ailurus fulgens) and identified the loci used for analysis. Master's Thesis, Sichuan University, Chengdu, China, 2007.

[9.] Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989.

[10.] Liu, Z.J.; Zhang, B.W.; Wei, F.W.; Li, M. Isolation and characterization of microsatellite loci for the red panda (Ailurus fulgens). Mol. Ecol. Notes 2005, 5, 27-29. [CrossRef]

[11.] Zhang, L.; Liang, X.; Zhang, Z.; Shen, F.; Zhang, W.; Wei, K.; Yang, Z.; Hou, R.; Yue, B.; Kamata, H.; et al. Identification and characterization of ten polymorphic microsatellite loci in red panda Ailurus fulgens. Conserv. Genet. 2008, 9, 787-790. [CrossRef]

[12.] Wu, H.; Zhan, X.J.; Guo, Y.; Zhang, Z.; Zhu, L.; Yan, L.; Li, M.; Wei, F.- W. Isolation and characterization of 12 novel microsatellite loci for the red panda (Ailurus fulgens). Conserv. Genet. 2009, 10, 523-525. [CrossRef]

[13.] Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2005, 1,47. [CrossRef]

[14.] Goudet, J. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Updated from Goudet (1995). Available online: https://www.scienceopen.com/document?vid=b577cf2d-d522-4831- a4a7-d05d435e72cf (accessed on 8 June 2020).

[15.] Rousset, F. Genepop'007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103-106. [CrossRef]

[16.] Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945-959.

[17.] Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611-2620. [CrossRef]

[18.] You, Y.Y. Influence on endemic bat Myotis davidii population size and genetic richenss by the habit cave interference. J. Biol. 2013, 32, 314-331.

[19.] Yan, L.; Huang, Y.; Zhang, B.; Zhang, S.; Zhang, H.; Wei, F.; Wang, P. Status and prognosis of genetic diversity in captive giant pandas (Ailuropoda melanoleuca) in Wolong. Acta Theriol. Sin. 2006, 26, 317-324.

[20.] Xiu, Y.F.; Chen, Y.C.; Shao, L.P.; Xu, S.H. Rearing and Reproduction of Lesser Panda in Fuzhou Area. Sichuan J. Zool. 2007, 25, 875-878.

[21.] Nechtelberger, D.; Kaltwasser, C.; Stur, I.; Meyer, J.N.; Brem, G.; Mueller, M.; Mueller, S. DNA microsatellite analysis for parentage control in austrian pigs. Anim. Biotechnol. 2001, 12, 141-144. [CrossRef]

[22.] Ardren, W.R.; Borer, S.; Thrower, F.; Joyce, J.E.; Kapuscinski, A.R. Inheritance of 12 microsatellite loci in Oncorhynchus mykiss. J. Hered. 1999, 90, 529-536. [CrossRef]

[23.] Xiu, Y.F.; Fi, B.C.; Chen, Y.S.; Zhang, Y.N.; Xu, S.H. Paternity identification of red panda using microsatellite genotyping. Acta Theriol. Sin. 2015, 35, 55-64.

[24.] Wright, S. Varisbility Within and Among Natural Populations. In Evolution and the Genetics of Populations; University of Chicago Press: Chicago, IL, USA, 1978; Volume 4.

[25.] Wang, F.; Peng, Z.-X.; Zhang, J.-G.; Tian, L.; Han, H.-B.; Cao, Z.-C.; Zhang, Z.-H.; Shen, F.-J.; Li, D.-S.; Zhang, H.-M.; et al. Studies on genetic diversity of captive giant pandas (Ailuropoda melanoleuca) based on microsatellite DNA markers. Prog. Biochem. Biophys. 2007, 34, 1279-1287.

Yun-fang Xiu (1), Cheng-Chi Liu (2), Su-hui Xu (1), Chen-Si Lin (2) and Chin- Cheng Chou (2), *

(1) Strait (Fuzhou) Giant Panda Research and Exchange Center, No. 88, Mengshan Road, Fuzhou 350001, China; tuna950@gmail.com (Y.-f.X.); Icatcl0727255@gmail.com (S.-h.X.)

(2) Department of Veterinary Medicine, National Taiwan University, No. 1, Sec. 4, Roosevelt Rd., Taipei 10617, Taiwan; brain.argi@gmail.com (C.-C.L.); cslin100@ntu.edu.tw (C.-S.L.)

* Correspondence: chouchin@ntu.edu.tw

Received: 18 April 2020; Accepted: 7 June 2020; Published: 9 June 2020

Caption: Figure 1. [DELTA]K deviation curve.

Caption: Figure 2. Bayesian genetic clustering of the 11 captive populations.
Table 1. 19 short tandem repeat (STR) markers used for analysis of
genetic diversity.

                         GenBank
Loci      Reference   Accession No.    Primers Sequences (5'-3')

RP-1        [10]        AY685403         F:CGCCCAGGTACCCTAGAGT
                                      R:TCCCCACGTTCACTGCAGCATTATC
RP-11       [10]        AY685406         F:TGAATGTTGCCTTGCTCT
                                        R:CACCACCTCTTACTGTTCTC
RP-l01      [10]        AY685406      F:ACAGACTGAAAAGGCTTAACAGAGT
                                       R:CGGTCCATGGTATTCTCCTGTAG
RP-102      [10]        AY685407      F:ATGCAGAAGAGAATGGAAGCCTGG
                                      R:TTCCTGGCAACGATTTCATCCTCAA
RP-108      [10]         AY60885        F:GTCTCCTCTAACAGCCCACAC
                                      R:GAGGCCACTCTCAACTTTAGTAGAA
RP-l33      [10]        AY685409      F:GCAGGAAGAAGAGGTACTGGTTTCA
                                      R:AACAAGATGCCAGGAAGATACTTTC
RP-137      [10]        AY685410        F:CACCGTACCCGAGACACCAA
                                      R:AAAGAAGAGAAAGTGAAGTGGCAGC
Aifu-1       [8]        EF408640         F:CCTGCATCAGACTCAGCA
                                        R:GGTATCAGACGTGGGAACTA
Aifu-2       [8]        EF408641         F:GACCCAGCCCTAACTCAAA
                                         R:CCTGCATTAGGCTCCACA
Aifu-5       [8]        EF408644        F:GAATAATGAGCTTGCCTTCC
                                        R:TTGACATTGGCTATGTGAACA
Aifu-7       [8]        EF408646         F:CCTGCATCAGACTCAGCA
                                        R:CTGGCTTGCAGACAGGAAAT
Aifu-8       [8]        EF408647         F:TTTACAAAGCAGAGCGTC
                                         R:AAATCCTGTCGAACCATG
Aifu-25      [8]        EF408651         F:AATTGCATGAGCCAGTTC
                                         R:GCCAGGGTTTTACCAGAG
Aifu-27      [8]        EF408655        F:CTCAGAATCTTTCATTGCCA
                                        R:TTCCTCAATCCTCTGTTCAA
Aifu-12     [11]        EF620036         F:TTTGCCAGTAAGCACCCG
                                        R:TGGAACTCAGAGGAGCAGTC
Aifu-15     [11]        EF620039        F:AGTACCAGCAGTAGGATAGCA
                                        R:TAAGAGCACTCAGAGGGAAAC
Rp6         [12]        EU487250        F:ACTGAGGCGAAGAAAGGAGC
                                        R:CATGGGCATTGAAGATGGTG
Rp9         [12]        EU487208         F:ACAAACTGGAATGTAAAGG
                                        R:CACATGCTTATGTTATAGGG
RP13        [12]        EU487212        F:TCCCTTACGCTTCCTCCTTT
                                        R:GCAGGCGGAGAATTGGTTGG

                                        Labelling   Size Range
Loci             Repeat Motif              Dye         (bp)

RP-1      [(GT).sub.5]AT[(GT).sub.10]     FITC       160-198

RP-11            [(CA).sub.12]             FAM       101-127

RP-l01           [(AG).sub.20]             HEX       155-173

RP-102     [(CG).sub.4][(TG).sub.10]       HEX       199-209

RP-108     [(TG).sub.3][(CA).sub.3]       TAMRA      217-265
               CTTA[(CA).sub.16]
RP-l33           [(AC).sub.16]            TAMRA      205-233

RP-137    [(AC).sub.16][(AG).sub.12]       FAM       141-153

Aifu-1          [(ATAG).sub.12]            FAM       140-176

Aifu-2          [(CTAC).sub.11]            HEX       125-141

Aifu-5          [(GATA).sub.13]           TAMRA      336-352

Aifu-7          [(GATA).sub.11]            HEX       221-249

Aifu-8          [(GATA).sub.15]            FAM       123-171

Aifu-25         [(CTAT).sub.15]            HEX       153-205

Aifu-27       (CTAT)13CCACA(GT)15         TAMRA      255-289

Aifu-12          [(CA).sub.19]            TAMRA      259-269

Aifu-15   [(CA).sub.3]CG[(CA).sub.6]       FAM       120-150

Rp6              [(CA).sub.13]             HEX       154-166

Rp9              [(CA).sub.20]            TAMRA      125-143

RP13             [(GT).sub.18]             HEX       126-224

               Ta
Loci      ([degrees]C)

RP-1           58

RP-11          51

RP-l01         56

RP-102         57

RP-108         58

RP-l33         56

RP-137         52

Aifu-1         58

Aifu-2         57

Aifu-5         55

Aifu-7         60

Aifu-8         59

Aifu-25        54

Aifu-27        54

Aifu-12        58

Aifu-15        58

Rp6            56

Rp9            58

RP13           52

Table 2. The genetic characteristics of 19 STR from all the samples.
* Significant (p < 0.05); ** (p < 0.01).

                                       Expected         Observed
Loci                 Number of      Heterozygosity   Heterozygosity
                    Alleles (NA)     ([H.sub.E])          (Ho)

RP-1                     11             0.568            0.547
RP-101                   8              0.853            0.866
RP-102                   5              0.659            0.600
RP-108                   13             0.852            0.703
RP-133                   12             0.814            0.844
RP-137                   7              0.713            0.595
Aifu-25                  10             0.769            0.786
Aifu-27                  18             0.901            0.926
Aifu-39                  6              0.528            0.513
Aifu-1                   9              0.827            0.867
Aifu-2                   5              0.571            0.525
Aifu-5                   5              0.732            0.762
Aifu-7                   11             0.776            0.519
Aifu-8                   12             0.854            0.835
Aifu-12                  6              0.730            0.875
Aifu-15                  7              0.661            0.602
Rp6                      6              0.601            0.625
Rp9                      10             0.779            0.867
RP11                     14             0.878            0.809
All loci                175
Mean [+ or -] SD   9.210 [+ or -]   0.730 [+ or -]   0.719 [+ or -]
                        3.6             0.115            0.145

                    Polymorphism       Fixation Indices
Loci                Information          of the Total
                   Content (PIC)    Population ([F.sub.IT])

RP-1                   0.553                 0.019
RP-101                 0.829                -0.018
RP-102                 0.606                0.099 *
RP-108                 0.837               0.138 **
RP-133                 0.787                -0.028
RP-137                 0.676               0.155 **
Aifu-25                0.739                -0.024
Aifu-27                0.889                -0.024
Aifu-39                0.469                 0.015
Aifu-1                 0.848                0.049 *
Aifu-2                 0.515                0.120 *
Aifu-5                 0.681                -0.046
Aifu-7                 0.762               0.269 **
Aifu-8                 0.845                 0.038
Aifu-12                0.681                -0.209
Aifu-15                0.599                 0.111
Rp6                    0.531                -0.075
Rp9                    0.751               0.115 **
RP11                   0.856                0.097 *
All loci                                   0.049 **
Mean [+ or -] SD   0.708 [+ or -]
                       0.131

                        Genetic           Inbreeding Coefficient
Loci                Differentiation             within the
                   Index ([F.sub.ST])   Subpopulation ([F.sub.IS])

RP-1                    0.062 **                  -0.046
RP-101                  0.037 **                  -0.057
RP-102                  0.09 **                   0.011
RP-108                  0.032 **                 0.110 **
RP-133                  0.055 **                  -0.086
RP-137                  0.105 **                  0.058
Aifu-25                 0.037 **                  -0.064
Aifu-27                 0.031 **                  -0.056
Aifu-39                 0.038 **                  -0.026
Aifu-1                  0.035 **                  0.015
Aifu-2                  0.115 **                  0.005
Aifu-5                  0.033 *                   -0.082
Aifu-7                  0.067 **                 0.217 **
Aifu-8                  0.056 **                  -0.018
Aifu-12                 0.04 **                   -0.259
Aifu-15                 0.034 *                    0.08
Rp6                     0.03 **                   -0.108
Rp9                     0.091 **                  0.027
RP11                    0.067 **                  0.032
All loci                0.055 **                  -0.006
Mean [+ or -] SD

Table 3. The comparison of mean expected heterozygosity from captive
populations. * Source: Liang (2007).

Locus      * Chengdu    * Pixian   * Kunming   Fuzhou    Wuxi

Aifu-1      0.852       0.811       0.786      0.878     0.865
Aifu-2      0.720       0.742       0.464      0.408     0.697
Aifu-5      0.787       0.721       0.250      0.688     0.783
Aifu-7      0.606       0.774       0.679      0.805     0.662
Aifu-8      0.833       0.774       0.893      0.864     0.805
Aifu-25     0.803       0.884       0.785      0.784     0.706
Aifu-27     0.874       0.948       0.893      0.885     0.784
Aifu-12     0.862       0.816       0.750      0.763     0.827
Aifu-15     0.667       0.784       0.893      0.585     0.662
Aifu-39     0.636       0.537       0.857      0.508     0.500
Mean        0.764       0.779       0.725      0.717     0.729

Locus     Shanghai   Beijing    Panyu    Guangzhou   Chongqi   Dazu

Aifu-1     0.875      0.727     0.833      0.769      0.773    0.833
Aifu-2     0.739      0.439     0.625      0.560      0.409    0.697
Aifu-5     0.654      0.714     0.767      0.703      0.689    0.750
Aifu-7     0.882      0.511     0.517      0.747      0.682    0.429
Aifu-8     0.556      0.818     0.858      0.857      0.712    0.848
Aifu-25    0.732      0.712     0.700      0.697      0.667    0.733
Aifu-27    0.955      0.864     0.875      0.933      0.879    0.848
Aifu-12    0.582      0.682     0.658      0.626      0.758    0.644
Aifu-15    0.442      0.803     0.700      0.788      0.644    0.758
Aifu-39    0.621      0.409     0.517      0.143      0.318    0.591
Mean       0.704      0.668     0.705      0.682      0.653    0.713

Locus     Mianning   Huangshan   Wenling

Aifu-1     0.765       0.857      0.833
Aifu-2     0.451       0.495      0.621
Aifu-5     0.717       0.833      0.712
Aifu-7     0.846       0.788      0.733
Aifu-8     0.941       0.846      0.879
Aifu-25    0.692       0.758      0.833
Aifu-27    0.950       0.955      0.844
Aifu-12    0.642       0.511      0.712
Aifu-15    0.660       0.538      0.803
Aifu-39    0.621       0.582      0.652
Mean       0.728       0.716      0.762

Table 4. The comparison of genetic diversity from captive
populations and wild populations of red panda. The bold indicates
the sum of the above numbers.

                   No. of
Populations#    Individuals#   MNA#   [H.sub.O]#   [H.sub.E]#

Qionglai             26        6.2      0.743        0.688
Liangshan            28        5.8      0.700        0.704
Xiaoxiangling        27        5.8      0.564        0.634
Gaoligong            20        7.1      0.712        0.732
Tibet                4         4.6      0.722        0.770
The wild            105#       9.2#     0.679#       0.719#
  population#
Fuzhou               41        7.1      0.732        0.722
Wuxi                 11        5.2      0.711        0.647
Shanghai             9         5.0      0.693        0.747
Mianning             9         4.0      0.715        0.734
Panyu                8         5.0      0.693        0.746
Guangzhou            7         4.5      0.669        0.684
Huangshan            7         3.8      0.702        0.631
Beijing              6         4.1      0.683        0.744
Chongqi              6         4.2      0.673        0.644
Dazu                 6         3.9      0.749        0.734
Wenling              6         3.9      0.740        0.782
The captive         116#       9.3#     0.719#       0.730#
  population#

Note: The sum of the above numbers indicated with #.

Table 5. Genetic diversity from 11 captive red panda populations. *
Significant (p < 0.05).

Population   Number of    Mean Number of    Mean Allelic
             Individual   Alleles (MNA)    Richness (MAR)

Fuzhou           41            7.11            3.913
Wuxi             11            5.21            3.751
Shanghai         9             5.00            3.767
Beijing          6             4.05            3.505
Panyu            8             4.95            3.837
Guangzhou        7             4.53            3.748
Chongqi          6             4.16            3.573
Dazu             6             4.37            3.908
Mianning         9             5.42            4.026
Huangshan        7             4.58            3.797
Wenling          6             4.53            3.903

                                               Inbreeding Coefficient
                Expected         Observed              within
Population   Heterozygosity   Heterozygosity     the Subpopulation
              ([H.sub.E])      ([H.sub.o])          ([F.sub.IS])

Fuzhou           0.722            0.732                -0.033
Wuxi             0.647            0.711               0.088 *
Shanghai         0.747            0.693                -0.083
Beijing          0.744            0.683               -0.173 *
Panyu            0.746            0.693                0.093
Guangzhou        0.684            0.669                -0.013
Chongqi          0.644            0.673                0.062
Dazu             0.734            0.749                0.015
Mianning         0.728            0.715                0.001
Huangshan        0.631            0.702               0.111 *
Wenling          0.782            0.740                -0.067

Population    Hardy-Weinberg
             Equilibrium (p)

Fuzhou           0.0005 *
Wuxi             0.0019 *
Shanghai          0.5411
Beijing           0.7836
Panyu             0.1594
Guangzhou         0.7825
Chongqi           0.5984
Dazu              0.4263
Mianning          0.5719
Huangshan         0.5751
Wenling           0.5476

Table 6. Genetic differentiation between pairs of red panda
populations ([F.sub.ST]). * Significant (p < 0.05); ** (p < 0.01).

              Fuzhou        Wuxi       Shanghai     Beijing
Fuzhou
Wuxi        0.03516 **
Shanghai    0.09036 **   0.06169 **
Beijing     0.09087 **   0.08553 **   0.14506 **
Panyu       0.04102 **    0.01701     0.08110 **   0.06893 **
Guangzhou   0.05748 **    0.01548     0.09509 **   0.14693 **
Chongqi     0.06221 **   0.08104 **   0.15260 **   0.08600 *
Dazu        0.05353 **   0.02749 **   0.06415 **   0.06820 *
Mianning    0.03928 **   0.05463 **   0.10666 **   0.11472 **
Huangshan   0.02033 *     -0.00260    0.08273 **   0.09260 **
Wenling     0.02254      -0.01230     0.06954 **   0.06412 *

              Panyu      Guangzhou     Chongqi      Dazu
Fuzhou
Wuxi
Shanghai
Beijing
Panyu
Guangzhou    0.02757
Chongqi     0.07274 **   0.13591 **
Dazu         -0.00950    0.08728 *    0.08683 **
Mianning    0.03229 *    0.06161 **   0.08486 **   0.33040
Huangshan    0.02300     0.03790 *    0.05496 *    0.03520
Wenling      -0.01610     0.00955      0.04418     0.01600

             Mianning    Huangshan
Fuzhou
Wuxi
Shanghai
Beijing
Panyu
Guangzhou
Chongqi
Dazu
Mianning
Huangshan   0.04779 **
Wenling     0.03280 *    -0.00860
COPYRIGHT 2020 MDPI AG
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2020 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Xiu, Yun-fang; Liu, Cheng-Chi; Xu, Su-hui; Lin, Chen-Si; Chou, Chin-Cheng
Publication:Animals (Basel)
Article Type:Report
Geographic Code:9CHIN
Date:Jun 1, 2020
Words:6037
Previous Article:Not the Cat's Meow? The Impact of Posing with Cats on Female Perceptions of Male Dateability.
Next Article:Legal and Ethical Aspects of 'Best Interests' Decision-Making for Medical Treatment of Companion Animals in the UK.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |