Printer Friendly

Target molecules in 3T3-L1 adipocytes differentiation are regulated by maslinic acid, a natural triterpene from Olea europaea.

ABSTRACT

Background: Metabolic syndrome is a set of pathologies among which stand out the obesity, which is related to the lipid droplet accumulation and changes to cellular morphology regulated by several molecules and transcription factors. Maslinic acid (MA) is a natural product with demonstrated pharmacological functions including anti-inflammation, anti-tumor and anti-oxidation, among others.

Purpose: Here we report the effects of MA on the adipogenesis process in 3T3-L1 cells.

Methods: Cell viability, glucose uptake, cytoplasmic triglyceride droplets, triglycerides quantification, gene transcription factors such as peroxisome proliferator-activated receptor [gamma] (PPAR[gamma]) and adipocyte fatty acid-binding protein (aP2) and intracellular [Ca.sup.2+] levels were determined in pre-adipocytes and adipocytes of 3T3-L1 cells.

Results: MA increased glucose uptake. MA also decreased lipid droplets and triglyceride levels, which is in concordance with the down-regulation of PPAR[gamma] and aP2. Finally, MA increased the intracellular [Ca.sup.2+] concentration, which could also be involved in the demonstrated antiadipogenic effect of this triterpene.

Conclusion: MA has been demonstrated as potential antiadipogenic compound in 3T3-L1 cells

Keywords:

Adipogenesis

Glucose uptake

Maslinic acid

PPAR[gamma] and aP2 transcription factors

Triglycerides

Introduction

The current criteria denote metabolic syndrome (MS) as a cluster of pathologies including abdominal obesity, atherogenic dyslipidemia (elevated triglyceride, small LDL particles, low HDL cholesterol), raised blood pressure, insulin resistance (with or without glucose intolerance), and prothrombotic and proinflammatory states. The growing prevalence of MS is a reflection of changing lifestyles in recent decades, which includes over nutrition and physical inactivity. This lifestyle results in an excess of adiposity that leads to obesity. Besides storing excess calories as triglycerides, obesity due to adipose tissue plays several important roles in MS (Horska et al., 2014). Adipose tissue acts as a complex endocrine gland and adipocytes express and secrete a large number of signaling molecules (Horska et al., 2014).

Adipogenesis process consists of the differentiation of preadipocytes to mature adipocytes which involves the accumulation of lipid droplets, changes in gene expression and cellular morphology (Bae et al., 2014). Furthermore, adipogenesis is regulated by several molecules such as insulin, insulin-like growth factor (IGF), glucose, free fatty acids among others, and different transcriptional factors as sterol regulatory element-binding protein (SREBP), peroxisome proliferator-activated receptor [gamma] (PPAR[gamma]) and adipocyte fatty acid-binding protein (aP2) (Bae et al., 2014). Given the importance of obesity in MS, it is interesting to study the effect of compounds that influence adipogenesis and the accumulation of triglycerides in the adipocytes, as potential treatments for MS.

Traditionally, plants have been used in popular medicine because they possess important biological properties beneficial to human health. These properties are due to the several active components found in different parts and organs of plants. The main chemical groups in plants are polyphenols, terpenoids, and alkaloids. These typical bioactive compounds are secondary metabolites with pharmacological activities such as anti-cancer, antioxidant, anti-inflamatory, anti-microbial, among others (Rufino-Palomares et al., 2015).

Maslinic acid (2[alpha], 3[beta]-dihydroxiolean-12-en-28-oic acid, MA), also known as crategolic acid, is a natural dihydroxylated (C-2 and C-3) pentacyclic triterpene included in the oleanane triterpenoids (Fig. 1(C)). As all pentacyclic triterpenes, the MA biosynthesis derives from de squalene, which is oxidized and cyclized by several enzymes to [beta]-amyrin and subsequently oxidation steps give rise to the triterpenic dialcohol erythrodiol, followed by the hydroxyl pentacyclic triterpencis acids, oleanolic acid (OA) and, finally, MA (Rufino-Palomares et al., 2015). Both, OA and MA have a carboxylic group in C-28 which is related to their bioactivities. In addition, MA unlike its precursor OA has a hydroxyl group in C-3, providing it different properties than its structural analogue. MA is found in several plants, including Olea europaea L (Oleaceae family). MA is present in the surface wax of fruit and leaves of this tree and on the olive oil, mainly in pomace oil (Reyes et al., 2006). MA concentration is dependent on several factors as olive variety, extraction method, oil quality, time after harvest, season of year, etc. Bianchi et al. (1994) found that in the olive skin the MA concentration ranged between 30 and 47% depending on olive tree variety and extracted with CHC13. In the same study, a subsequent treatment with MeOH was able to obtain higher MA concentration (78-90%). Chouaib et al. (2015) observed that MA concentration in pomace olive when extracted with hexane under ultra-sonication condition was 8.5 mg/g dry weight.

Studies have reported that MA has important biological properties, including anti-inflammatory, anti-oxidative, anti-cancer, hepato-protective and neuro-protective, anti-microbial, anti-viral and anti-parasitostatic effects, among others (reviewed by Rufino-Palomares et al. 2015).

In the present study, we aim to investigate the effects of maslinic acid (MA) on the adipogenesis process in 3T3-L1 cells. For this purpose, cell viability, glucose uptake, cytoplasmic triglyceride droplets, triglycerides quantification, gene transcription factors such as PPAR[gamma] and aP2 and intracellular [Ca.sup.2+] levels were determined in pre-adipocytes and adipocytes of 3T3-L1 cells.

Material and methods

Compounds

Maslinic acid (MA), provided by Biomaslinic, S.L (Granada, Spain). MA ([greater than or equal to] 98% purity) is a natural triterpene obtained as a byproduct of the olive oil manufacturing process from O. europaea. For determining purity of MA an ultra-high performance liquid chromatography time-of-flight mass spectrometry (UPLC/TOF-MS) analysis was carried out in the High Resolution Mass Spectrometry Unit of the Research Technical Services, University of Granada. Waters Alliance[R] Acquity UPLC H-Class system (Waters Corporation, Milford, USA) for chromatography and Waters Alliance[R] LCT Premier XE model for TOF-MS were used. Fig. 1(A) and(B) present the results for these analyses.

For each experiment, a concentrated solution of MA at 40mg/ml in DMSO was prepared and, immediately, this solution was diluted in culture medium to obtain the working concentrations. Final concentration of DMSO in cell culture medium including MA was always lower than 0.05% and this value correspond to the higher MA concentration assayed. All reagents were obtained from Sigma-Aldrich (St., Louis, MO, USA), except rosiglitazone obtained from Cayman Chemicals (Ann. Arbor, MI, USA). TRIzol reagent, Taq polymerase and lndo-AM that were provided from Invitrogen (Foster City, CA, USA) and iScript synthesis kit and iQ SYBR[R] Green Supermix kit that were obtained from Bio-Rad (Hercules, CA, USA).

Cell culture and differentiation

3T3-L1 cells, a subline derived from 3T3 fibroblasts of albino Swiss mice embryo compromised to differentiate into mature adipocytes, was acquired from the CIC (Science instrumentation Centre of the University of Granada, Spain). The cells were maintained in a humidified atmosphere with 5% C[O.sub.2] at 37[degrees]C. Cells were cultured in growth medium composed of DMEM high glucose, supplemented with 10% fetal bovine serum (FBS), 2mM glutamine, penicillin (50U/ml) and streptomycin (50 [micro]g/ml). Cells were passaged at pre-confluent densities by the use of a solution containing 0.05% trypsin and 0.5 mM EDTA.

To induce differentiation of cells. 3T3-L1 pre-adipocytes were seeded in culture plates and let grow in complete medium until they reached confluence. After this, growth medium was substituted by differentiation medium, which consisted of the same medium supplemented with 0.5 mM 3-isobutyril-l-methylxanthine (IBMX), 1 [micro]M dexamethasone, 10 [micro]g/ml insulin and 1 [micro]M rosiglitazone. Rosiglitazone was added for increase the rate of adipogenesis by activation of PPAR[gamma]. Cells were maintained in this medium for 3 days (days 0-3) and was replaced with fresh growth medium plus 5 [micro]g/ml insulin for two more days (days 4-5).

Finally, MA was added from day 0 of differentiation and maintained until the experiments were carried out (day 10) (Fig. 2).

MTT assay

Samples containing 200 pi cell suspension (1 x [10.sup.4] cells/well) were cultured in 96 well plates. Subsequent to adherence of the cells within 12 h of incubation, MA was added to the wells at a concentration between 0-100 [micro]g/ml and maintained during 24 h. MTT (5mg/ml) was dissolved in the medium and added to the wells at a final concentration of 0.5 mg/ml. Following 2 h of incubation. the generated formazan was dissolved in DMSO. Absorbance was measured at 550 nm in a plate reader (Bio-tek ELx800 Instrument, INC).

The concentration that caused 50% of inhibition of cell growth ([IC.sub.50]) was calculated following the formula: % cell viability = ([A.sub.0]-[A.sub.T])/ [A.sub.0] x 100, where [A.sub.0] is the control absorbance (100% of cell viability) and [A.sub.T] is de absorbance of the incubated cells with the different concentrations of MA. OriginPro 8 (Origin-Lab Corporation, USA) was used to performance a dose-response analysis by the following formula: y = [A.sub.1] + [A.sub.2]-[A.sub.1]/1+[10.sup.(LOGx0-x)p], where LOGx0 is the middle of the curve; p is the slope; A1 is the inferior asymptote and A2 is the upper asymptote of the curve fitting.

Glucose intake assay

The glucose intake was determined in 3T3-L1 pre-adipocytes. Cells were seeded in 6-well plates with a density of 5 x [10.sup.5] cells per well in growth medium. After 24 h, medium was replaced by fresh medium without FBS and incubated 2 h. Following that, the cells were treated with Krebs-Ringer-Hepes (KRH) buffer (50 mM Hepes pH 7.4. 136 mM NaCI. 4.7 mM KCl. 1.25 mM MgS[O.sub.4] and 1.25 mM Ca[Cl.sub.2]) and either left untreated or stimulated with 1.74 [micro]M insulin, or with or without 20 [micro]M cytochalasin B (inhibitor of glucose transporters). Insulin was used as positive control and cytochalasin as negative control. Furthermore, MA at a concentration between 0-10 [micro]g/ml was added to the cell culture together with the rest of compound (KRH buffer, insulin and cytochalasin B) for 30 min.

Glucose uptake was determined by the addition of START 10X buffer (1 [micro]Ci of 2-deoxi-D-[2, [6-.sup.3]H)-glucose in KRH buffer). Following a 10 min of incubation, the reaction was stopped by washing 3 times with KRH buffer. Cells were lysed with RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% deoxycholate, 0.1% SDS). Finally, radioactivity was calculated by scintillation counter (Beckman Coulter, Inc., CA, USA). Results were normalized for protein content measured by Bradford assay.

Oil Red O staining and quantification

Oil Red O (ORO) staining was performed in pre-adipocytes, differentiated adipocytes without compound and in differentiated adipocytes, treated (days 0-10) with various concentrations of MA (5-10 [micro]g/ml), on day 10. Cells were seeded on UV-sterilized slides in 24 wells plates and induced to differentiate as described previously. Briefly, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. Fixed cells were stained with 5% Oil Red O dissolved in isopropanol and diluted with 1.5 vols of deionized water for 1 h. Finally, the excess of staining was removed by successive washes with deionized water and cells were photographed using a bright field optical microscope. Image J 1.49 (NIH, USA) was used to quantify the stained areas.

Total TAG quantification

Differentiated 3T3-L1 adipocytes (day 10) treated with MA (since day 0) were washed with PBS and subjected to sonication in saline solution (2 M NaCl, 2 mM EDTA and 50 mM sodium phosphate, pH 7.4) in order to release the cellular content. Total triglycerides (TAG) were quantified by using the commercial kit GPO-Trinder (Sigma-Aldrich, TR0100) at 540 nm following the manufacturer's protocol. Results were expressed as mg TAG per mg protein. Protein quantification was performed by Bradford assay.

RNA isolation, cDNA synthesis and PCR

Total RNA was extracted from 3T3-L1 cells was isolated with TRIzol reagent (Invitrogen, Foster City, CA, USA) according to the manufacturer's protocols and RNA quality and quantity were assessed by gel electrophoresis and spectrophotometric (Nanodrop ND-1000, Nanodrop Labtech, Palaiseau, France). One [micro]g of the resulting total RNA was used for reverse-transcription that was carried out following the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) protocol.

The RT process was initiated with the incubation at 25[degrees]C for 5 min, 42[degrees]C for 30 min and finished at 85[degrees]C for 5 min and immediately cooled at 4[degrees]C. The amplification of the reverse-transcription products was carried out by PCR (1 [micro]l of cDNA, 1.5 mM Mg[Cl.sub.2], 20 [micro]M dNTPs, 10 pmol of primers (Promega, Charbonnieres, France) (Table 1) and 2.5 units of recombinant Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) in a MultiGene cycler (Labnet, Woodbridge, NJ).

Thermal cycling was initiated with the denaturalization at 95[degrees]C for 4 min, followed by 35 steps of PCR consisting of heating at 95[degrees]C for 1 min and at 60[degrees]C for 30 sec for annealing and at 72[degrees]C for 30 s for elongation, and finally one extension cycle more at 72[degrees]C for 5 min.

PCR products were separated by agarose gel electrophoresis (2%) and detected by UV.

Quantitative real-time PCR

Expression levels of mRNA were quantified using an iCycler thermocycler (Bio-Rad) and the iQ SYBR[R] Green Supermix Kit (100 mM KCl, 40 mM Tris-HCl pH 8.4, 0.4 mM of each dNTP, 50 U/ml iTaq polymerase, 6mM Mg[Cl.sub.2], SYBR[R] Green I, 20 nM fluorescein, Bio-Rad). Conditions of qPCR were: 1 [micro]l cDNA, 25 [micro]l SYBR[R] Green Supermix and 2 [micro]l of primers (2 [micro]M). Primer sequences are provided in Table 1.

The followed amplification program was an initial cycle of denaturalization at 95[degrees]C for 3 min, followed by 40 cycles of denaturalization at 95[degrees]C for 30 s, annealing at 60[degrees]C for 30s and elongation at 72[degrees]C for 30 s, and finally an extension cycle at 72[degrees]C for 1 min. Following the final PCR melting curves were systematically monitored (70[degrees]C temperature gradient at 0.5[degrees]C 10 [sec.sup.-1] from 70 to 95[degrees]C) to ensure that only one fragment was amplified.

Relative gene expression changes were calculated by comparative [C.sub.T] method using GADPH as the internal reference gene. This relative gene expression was quantitated as described in User Bulletin #2 for the ABI PRISM 7700 sequence detection system (Applied Biosystems). The fold change in the target genes (PPAR[gamma] and aP2) relative to the GADPH endogenous control gene was determined by: fold change = [2.sup.-[DELTA]([DELTA]CT)], where [DELTA][C.sub.T] = [C.sub.T], target-[C.sub.T], GADPH and [DELTA]([DELTA][C.sub.T]) = [DELTA][C.sub.T], stimulated - [DELTA][C.sub.T], control.

Intracellular calcium determination

[Ca.sup.2+] intracellular assay was performed as described by Navarrete et al. (2006) with the following modifications. 3T3-L1 pre-adipocytes were incubated with Tyrodes salt solution (Tyrode's salts T2145, Sigma-Aldrich) supplemented with 3 [micro]M Indo-AM (Invitrogen) at 37[degrees]C in the dark for 25 min. Following that, the excess of Indo-AM was removed by washing with Tyrodes salt solution. Using spectrofluorometry (Hitachi Ltd., Japan), [10.sup.6] cells/ml were analyzed.

Samples were excited at 338 nm and the emission was registered at 405 and 485 nm, which corresponded to [Ca.sup.2+]-Indo-1 and to Indo-1 free, respectively. After 120s of [Ca.sup.2+] measurement, MA was added at different concentrations (5, 10 and 25 [micro]/ml) and it was continued for 3 min more. Finally, 1 [micro]g/ml ionomycin was added at 300s of measurement. Ionomycin is a calcium hydrophobic ionophore is able to intercalate in the cellular membrane, increasing the [Ca.sup.2+] permeability and for this reason was used as positive control in this assay.

Statistical analysis

Data represents the mean [+ or -] SD and n indicates the number of biological replicates. Data were analyzed using one-way ANOVA with Tukey's multiple-comparison post-hoc test (or unpaired Student's t-test where stated) with p < 0.05 considered significant.

Results and discussion

Effect of MA on cell viability

Maslinic acid (MA) is well known to possess a wide range of biological functions, including anti-inflammatory, anti-oxidative, anti-cancer, hepato-protective and neuro-protective, anti-microbial, anti-viral and anti-parasitostatic effects (Rufino-Palomares et al., 2015). MA dosage needs to be adjusted according to the subject of the study, as cytotoxic effect of MA is different depending on cell line type and experimental conditions.

In the present work, we have evaluated the cytotoxic effect of MA on 3T3-L1 pre-adipocytes by using MIT assay. After 24 h of incubation (Fig. 3), results showed that concentrations between 0-10 [micro]g/ml of MA had no effect on 3T3-L1 viability (p>0.05). A decrease in number of cells was observed only in tested doses over 25 [micro]/ml of MA. In order to calculate concentrations of MA required for 50% growth inhibition ([IC.sub.50]) were performed a nonlinear-curve fit and [IC.sub.50] value was 25.3 [+ or -] 1.5 [micro]g/ml for 3T3-L1 pre-adipocytes. According to these results, we used as no cytotoxic concentration upon [IC.sub.50] value obtained, so our experimental treatments ranged between 0-10 [micro]g/ml of MA and 24 h to exposure except intracellular [Ca.sup.2+] determination, in which 25 [micro]g/ml MA concentration was also tested.

In other studies, cytotoxicity of MA has been performed in different tumoral cell lines, in order to evaluate the anticancer potential effect of this compound. Results for inhibition of growth by 50% ([IC.sub.50]), found in human colon cancer line (Caco-2), murine melanoma (B16F10) and human hepatoma (HepG2) cells were 52 [micro]g/ml, 37 [micro]g/ml and 47 [micro]g/ml, respectively (Mokhtari et al., 2015; Peragon et al., 2015; Reyes-Zurita et al., 2013; 2016). These values are similar to those found in 3T3-L1 cells obtained in the present study. On the other hand, a higher cytotoxic effect of MA was observed in other cell lines, such as HT29 in which the [IC.sub.50] value was of 15 [micro]g/ml (Rufino-Palomares et al., 2013).

To the best of our knowledge, this is the first study performed on 3T3-L1 pre-adipocytes for MA cytotoxicity. However, other natural compounds, such as chlorogenic, gallic and coumaric acids have been tested on 3T3-L1 pre-adipocytes, with [IC.sub.50] values of 25.5, 73 and 79 [micro]g/ml, respectively (Hsu et al., 2006). Wang et al. (2014) evaluated the cytotoxicity of cycloastragenol on 3T3-L1 preadipocytes and showed that the [IC.sub.50] value was 64 [micro]g/ml.

Modulation of MA on glucose uptake

Fig. 4 shows the results obtained from the scintillation counter for glucose uptake on 3T3-L1 cells treated with different concentrations of MA (0-10 [micro]g/ml). Treatment with cytochalasin B totally prevented glucose uptake by the inhibition of the glucose transporters, as expected. On the other hand, when insulin was added to the cells, glucose uptake was notably increased. Treatments with MA at different concentrations increased glucose uptake, both with or without insulin, regardless of MA dose. A dosage of 2.5 [micro]g/ml of MA was sufficient to induce an increase in glucose transportation to the intracellular space in this cell line.

Results from the present study show, for the first time that MA has the same response on glucose uptake on 3T3-L1 adipocytes as the above-mentioned compounds. Previous studies showed that adipose tissue plays an important role in controlling whole body glucose homeostasis in both normal and disease states (Rosen and Spiegelman 2006). Dysfunction of adipose tissue has been shown to result in insulin resistance (Horska et al., 2014).

Glucose uptake has been shown to increase in 3T3-L1 by different compounds, such as phenols and tannins among others, including terpenes. Fang et al. (2008) demonstrated that glucose uptake was up-regulated in 3T3-L1 cells treated with phenols kaempferol and quercetin. Similarly, tannins from Cichorium intybus (Muthusamy et al., 2008) stimulated glucose transport in 3T3L1 adipocytes. Furthermore, there are several compounds such as alkaloids (pronuciferine and nuciferine) and fatty acids (13-oxoOTA) in which this effect on glucose uptake has also been demonstrated (Ma et al., 2015). Studies are more limited regarding the effect of triterpenes on this target. He et al. (2014) found that 2.5, 5 and 10 [micro]M of ursolic acid (UA) enhanced glucose uptake in a dose-dependent manner. Other study by Mosa et al. (2014) confirmed that triterpenes from Protorhus longifolia at 50 [micro]g/ml effectively stimulated glucose uptake in 3T3-L1 adipocytes. Additionally, two triterpenes from Cyclocarya paliurus, cyclocaric acid B and cyclocarioside H, also showed beneficial effects on glucose uptake (Zhu et al.. 2015).

MA regulation of glucose uptake has not been described yet. Increased glucose uptake induced by MA could be closely related to its anti-diabetogenic bioactivity. The anti-diabetogenic bioactivity can be related to several mechanisms, as glycogen metabolism by enhancing the insulin signaling pathway or directly by activation of GLUT4 insulin independent. These effects have been demonstrated in vitro, in HepG2 cells (Liu et al., 2014) and in vivo (Guan et al., 2011: Mkhwanazi et al., 2014).

This bioactivity attributed to the MA has been described as consequence of several mechanisms of action. First, this compound inhibits glycogen Phosphorylase showing a potential to stimulate glycogen retention (Wen et al. 2008; Qian et al, 2011) and second, MA is related to insulin receptor (IR[beta]) phosphorylation increase (Liu et al, 2014). IR[beta] activation induces Akt phosphorylation and the subsequent inactivation of the glycogen synthase kinase 3[beta] which activates the glycogen synthase (Liu et al, 2014; Rufino-Palomares et al, 2015).

Besides these mechanisms, results obtained in the present study indicate that anti-diabetogenic activity in response to MA is due to the increased glucose uptake by the cells. Glucose uptake in cells is regulated by glucose transporters, GLUTI and GLUT4 (Scheepers et al, 2004). It has been known that GLUTI is essential for basal glucose transport in various tissues, whereas GLUT4 is selectively expressed in the insulin-responsive tissues, such as muscular and adipose. It has been demonstrated, in 3T3-L1 adipocytes, that triterpenes such as pachymic acid and ursolic acid increase insulin-stimulated GLUT4 expression and translocation (Huang et al, 2010; He et al, 2014).

This effect has been also described for MA, in a study by Mkhwanazi et al. (2014) in which MA at 20, 40 and 80 mg per kg, was administrated to the non-diabetic and STZ induced diabetic rats. Increased GLUT4 observed by these authors could be the mechanism by which, in the present study, MA stimulates glucose uptake in 3T3-L1 adipocytes. GLUT4 expression and translocation is regulated by insulin, a critical hormone in glucose homeostasis and transport of blood glucose (Zorzano et al, 2005).

One of the mechanisms that regulate insulin production is through the expression of protein-tyrosine phosphatase PTP1B. The inhibition of PTP1B improves insulin sensitivity and stimulates glucose uptake (Galic et al, 2005). Studies with triterpenes in diabetic rats, including MA, have shown that PTP1B expression is down-regulated (Castellano et al, 2013). These results have been also observed in some synthetic derivatives of MA (Qiu et al, 2009). Altogether, these findings support the higher glucose uptake observed in 3T3-L1 adipocytes in response to MA.

Influence of MA on 3T3-L1 cells adipogenesis

To evaluate the effects of MA on 3T3-L1 cells adipogenesis, differentiation of 3T3-L1 pre-adipocytes to mature adipocytes was induced in the presence of different concentrations of MA (days 0-5) and the treatment was maintained for a total of 10 days. Adipogenesis was evaluated by different ways: Oil Red O (ORO) staining and quantification of intracellular triglycerides (TAG) accumulation and genetic expression of adipogenesis target molecules (PPAR[gamma] and aP2).

Results of TAG accumulation in the interior of 3T3-L1 cells by ORO staining, showed that the differentiation process, in presence of MA (0-10 [micro]g/ml), produced a dose-dependent effect, decreasing the number of cells which had the TAG accumulation (Fig. 5(A)). After 10 days of MA treatment, at the highest dose used (10 [micro]g/ml), no cytotoxicity was found in 3T3-L1 adipocytes, but presented different cellular morphology lacking the accumulation of lipids. On the other hand, quantification on using microscope field of the number of adipocytes with cytoplasmic droplets of triglycerides (Fig. 5(B)) demonstrated the significant differences observed by ORO staining.

Regarding the TAG quantification by colorimetric reaction (Fig. 6), pre-adipocytes (PA) showed lower TAG levels than differentiated adipocytes without MA, as expected. Moreover, it was observed that cells treated with MA concentrations over 0.5 [micro]g/ml significantly decreased TAG concentration compared to those without MA.

Moreover, the effect MA on PPAR[gamma] and aP2 expression (by PCR) was performed and is shown in the Fig. 7. PPAR[gamma] (Fig. 7(A)) and aP2 (Fig. 7(B)) expression decreased significantly at all MA dosages (2.5 and 5 [micro]g/ml). These differences were the same between two doses used in the case of PPAR[gamma] gene, whereas aP2 expression decreased significantly more at 5 [micro]g/ml compared to 2.5 [micro]g/ml. The inhibition of the aP2 transcription in pre-adipocytes treated with MA was confirmed using qPCR (Fig. 8).

Besides insulin sensitivity and glucose uptake, PTP1B also regulates adiposity and expression of genes involved in lipogenesis (Rondinone et al., 2002). In this context, a positive correlation has been described between PTP1B and peroxisome proliferator-activated receptor (PPAR[gamma]), among other important genes involved in lipogenesis. PPAR[gamma] is predominantly expressed in adipose tissue as a key regulator of adipogenesis and glucose homeostasis (Lehrke and Lazar, 2005). The activation of PPAR[gamma] causes the increment in the transcription of genes involved in lipogenesis such as adipocyte fatty binding protein (aP2), which leads to the accumulation of triglycerides in the form of cytoplasmic droplets (Yang et al., 2013).

Altogether, results obtained in the present study showed that MA produces a decrease in all assayed parameters related to the adipogenesis process (PPAR[gamma], aP2, triglycerides and cytoplasmic droplets) in 3T3-L1 cells. Based on the available bibliography, we can hypothesize that the effect of MA on these parameters could be attributed to the down regulation of PTP1B as previously described (Qiu et al., 2009).

The same effects induced by several triterpenes have been also observed in 3T3-L1 cells in other studies (Mosa et al., 2014; Lee at al., 2010; Ahn et al., 2012). The study by Mosa et al. (2014) confirmed that lanostane, a triterpene isolated from Protorhus longifolia (Bernh.) Engl, at 1, 10 and 25 [micro]M, effectively decreased triglyceride accumulation in 3T3-L1 adipocytes after 48 h of treatment. However, the highest tested concentration (100 [micro]M) did not produce any effect associated to the inhibited endogenous triglyceride synthesis.

Similar effect has been observed for other lanostane triterpenes from the mushroom Canoderma lucidum in the same cells at 80 [micro]M and the m RNA expression levels of PPAR[gamma] was reduced by 45% in 3T3-L1 cells incubated with these triterpenes compared to the control cells (Lee at al., 2010). Other triterpene extracted from Agrimonia pilosa Ledeb, studied in 3T3-L1 cells is 1[beta]-hydxoxy-2-oxopomolic acid. This triterpene induces a decrease in triglyceride content and lipid droplets in cells, and inhibited adipocyte differentiation by suppressing PPAR[gamma] and aP2 at 100 [micro]M after 8 days of treatment (Ahn et al., 2012).

Moreover, although from a metabolic point of view the results obtained in the present study, including an increase of glucose uptake and a decrease of lipid droplets, TAG, PPAR[gamma] and aP2 levels induced by MA, could appear conflictive this fact could be justified by the 3T3-L1 cells energetic requirements. In this sense, MA has an evident effect on lipid synthesis reduction and consequently, the available energy by this pathway is not enough to satisfy energy requirements of these cells. So, other pathway supplying this energy might be employed, and this could be the carbohydrates catabolism. For this reason, glucose uptake could be increased when MA added to the 3T3-L1 cells.

Effect of MA on the intracellular [Ca.sup.2+] levels

The results of the measurement of the intracellular [Ca.sup.2+] levels by spectrofluorometric assay in pre-adipocytes treated with MA are presented in the Fig. 9.

Doses of 5, 10 and 25 [micro]g/ml of MA produced an increase in the intracellular [Ca.sup.2+] mobilization in a dose-dependent manner, being the major effect produced by the highest dosage of MA. Ionomycin, a calcium hydrophobic ionophore is able to intercalate in the cellular membrane, increasing the [Ca.sup.2+] permeability. For this reason, 1 [micro]g/ml of ionomycin was used as positive control and confirmed that intracellular [Ca.sup.2+] levels were not saturated. As indicated by previous studies, an increment in the intracellular [Ca.sup.2+] levels has been related to the inhibition of adipogenesis (Ntambi and Takova, 1996; Wang et al., 2014). Ntambi and Takova (1996) studied the effect of the calcium ionophore A23187 on the differentiation of 3T3-L1 pre-adipocytes.

Treatment of 3T3-L1 pre-adipocytes with this compound resulted in an increase of intracellular calcium storage. These authors related this response with the adipogenesis inhibition in a dose-dependent manner. Studies reported by Wang et al. (2104) have shown that cycloastragenol, a bioactive triterpenoid sapogenin from Chinese herbal medicine Radix astragali stimulated calcium mobilization in a dose dependent manner in 3T3-L1 preadipocytes, linking this response with a decrease in the lipid droplets accumulation. This result agrees with the observed in the present study by using MA in the same cell differentiation stage of the 3T3-L1 cells. So, results in the present research, indicate that the inhibition of the 3T3-L1 adipogenesis could be also due to the effect of MA on the intracellular [Ca.sup.2+] release.

Conclusion

MA has been demonstrated as potential antiadipogenic compound in 3T3-L1 cells, even at low concentrations. This effect could be related to several mechanisms (Fig. 10(A)). In this sense, MA increased glucose uptake. Moreover, MA treatment decreased lipid droplets and triglyceride levels in concordance with the downregulation of PPAR[gamma] and aP2. Finally, increased intracellular [Ca.sup.2+] concentration produced by MA could also be involved in the antiadipogenic effect of this triterpene (Fig. 10(B)). These findings could be the basis for future researches focused on the study of diseases related to metabolic syndrome.

ARTICLE INFO

Article history:

Received 18 February 2016

Revised 15 June 2016

Accepted 1 July 2016

Conflict of interest

No potential conflicts of interest relevant to this article were reported.

Acknowledgments

This study has been supported, in part, by funds of the consolidated Research Group BIO-157, from the General Secretariat of Universities, Research and Technology of the Ministry of Economy, Innovation, Science and Employment Government of the Junta de Andalucia (Spain), and by the Research Contract C-3650-00 under the program FEDER-INNTERCONECTA from the Spanish Government and European Union FEDER funds. AP-J was supported by a postdoctoral research contract Torres-Quevedo (PTQ 12-05739) from the Ministry of Economy and Competitiveness. NF-G was supported by Initiation-research fellowship from the Vice-rectorate of Scientific Policy and Research of University of Granada (ACG86/6, IDweb33). The authors thank to Biomaslinic S.L for the generous gift of maslinic acid to use completely without restrictions or obligations.

References

Ahn, E.K., Lee, JA, Seo, D.W., Hong. S.S., Oh, J.S., 2012. 1beta-Hydroxy-2-oxopomolic acid isolated from Agrimonia pilosa extract inhibits adipogenesis in 3T3-L1 cells. Biol. Pharm. Bull 35. 643-649.

Bae, C.R., Park, Y.K., Cha, YS., 2014. Quercetin-rich onion peel extract suppresses adipogenesis by down-regulating adipogenic transcription factors and gene expression in 3T3-L1 adipocytes. J. Sei. Food. Agrie. 94, 2655-2660.

Bianchi, G., Pozzi, N., Vlahov, G., 1994. Pentacydic triterpene acids in olives. Phytochemistry 37. 205-207.

Castellano, J.M., Guinda. A., Delgado, T., Rada. M., Cayuela. JA. 2013. Biochemical basis of the antidiabetic activity of oleanolic acid and related pentacydic triterpenes. Diabetes 62.1791-1799.

Chouaib, K., Hichri, F., Nguir. A., Daami-Remadi, M., Elie, N., Touboul, D., Jannet, H.B., Hamza, M .A., 2015. Semi-synthesis of new antimicrobial esters from the natural oleanolic and maslinic acids. Food Chem 183, 8-17.

Fang, X.K., Gao, J., Zhu. D.N., 2008. Kaempferol and quercetin isolated from Euonymus alacus improve glucose uptake of 3T3-L1 cells without adipogenesis activity. Ufe Sei 82. 615-622.

Galic, S., Hauser. C., Kahn. B.B., Haj, F.G., Neel. B.C., Tonks. N.K., Tiganis. T., 2005. Coordinated regulation of insulin signaling by the protein tyrosine phosphatases PTP1B and TCPTP. Mol. Cell. Biol. 25, 819-829.

Guan, T., Qian, Y., Tang. X., Huang. M., Huang. L. Li, Y., Sun, H., 2011. Maslinic acid, a natural inhibitor of glycogen Phosphorylase, reduces cerebral ischemic injury in hyperglycemic rats by GLT-1 up-regulation. J. Neurosci. Res. 89. 1829-1839.

He, Y.H., Li, W., Li, Y., Zhang. S.C., Wang, Y.W., Sun, C.H., 2014. Ursolic acid increases glucose uptake through the PI3K signaling pathway in adipocytes. Plos One 9, e110711.

Horska, K., Kucerova. J., Suchy. P., Kotolova, H., 2014. Metabolic syndrome--dysregulation of adipose tissue endocrine function. Ceska Slov. Farm. 63. 152-159.

Hsu, C.L. Huang, S.L, Yen, G.C., 2006. Inhibitory effect of phenolic acids on the proliferation of 3T3-L1 preadipocytes in relation to their antioxidant activity. J. Agrie. Food Chem. 54. 4191-4197.

Huang, Y.C., Chang. W.L. Huang, S.F., Lin, C.Y., Lin. H.C., Chang. T.C., 2010. Pachymic acid stimulates glucose uptake through enhanced GLUT4 expression and translocation. Eur. J. Pharmacol. 648, 39-49.

Lee, I., Kim, H., Youn. U, Kim. J., Min, B., Jung. H., Na. M., Hattori. M., Bae, K., 2010. Effect of lanostane triterpenes from the fruiting bodies of Ganoderma lucidum on adipocyte differentiation in 3T3-L1 cells. Planta Med. 76. 1558-1563.

Lehrke, M., Lazar. MA, 2005. The many faces of PPAR[gamma]. Cell 123, 993-999.

Liu, J., Wang. X., Chen, Y.P., Mao, L.F., Shang, J., Sun, H.B., Zhang, LY., 2014. Maslinic acid modulates glycogen metabolism by enhancing the insulin signaling pathway and inhibiting glycogen Phosphorylase. Chin. J. Nat. Med. 12, 259-265.

Ma, C.J., Li, C., He. Y.F., Xu, B., Mi. X.Q., Wang. H.L., Wang, Z.H., 2015. Pronuciferine and nuciferine inhibit lipogenesis in 3T3-L1 adipocytes by activating the AM PK signaling pathway. Life Sei 136, 120-125.

Mkhwanazi, B.N., Serumula. M.R., Myburg. R.B., Van Heerden. F.R., Musabayane. C.T., 2014. Antioxidant effects of maslinic acid in livers, hearts and kidneys of streptozotocin-induced diabetic rats: effects on kidney function. Renal Failure 36, 419-431.

Mokhtari, K., Rufino-Palomares, E.E., Perez-Jimenez, A., Reyes-Zurita, F.J., Figuera. C., Carcla-Salguero. L. Medina. P.P., Peragon, J., Lupiaflez. JA., 2015. Maslinic acid, a triterpene from olive, affects the antioxidant and mitochondrial status of B16F10 melanoma cells grown under stressful conditions. Evid. Based Complement. Altern. Med. 2015, 272457.

Mosa, RA. Naidoo. J.J., Nkomo. Fi., Mazibuko, S.E., Muller. C.J.F., Opoku. A.R., 2014. In vitro antihyperlipidemic potential of triterpenes from stem bark of Protorhus longifolia. Planta Med 80, 1685-1691.

Muthusamy, V.S., Anand. S., Sangeetha, K.N., Sujatha. S., Aran. B., Lakshmi, B.S., 2008. Tannins present in Cichorium incybus enhance glucose uptake and inhibit adipogenesis in 3T3-L1 adipocytes through PTP1B inhibition. Chem. Biol. Interact. 174. 69-78.

Navarrete, C., Sancho. R., Caballero. F.J., Pollastro, F., Fiebich. B.L, Sterner. O., Appendino, C., Munoz. E., 2006. Basiliolides, a class of tetracyclic C19 dilaciones from Thapsia garganica, release [Ca.sup.2+] from the endoplasmic reticulum and regulate the activity of the transcription factors nuclear factor of activated T cells, nuclear factor-kappa B, and activator protein 1 in T lymphocytes. J. Pharmacol. Exp. Ther. 319, 422-430.

Ntambi, J.M., Takova. T., 1996. Role of [Ca.sup.2+] in the early stages of murine adipocyte differentiation as evidenced by calcium mobilizing agents. Differentiation 60. 151-158.

Peragon, J., Rufino-Palomares. E.E., Munoz-Espada, I., Reyes-Zurita, F.J., Lupianez, J.A., 2015. A new HPLC-MS method for measuring maslinic acid and oleanolic acid in HT29 and HepG2 human cancer cells. Int. J. Mol. Sci. 16. 21681-21694.

Qian, Y., Cuan. T., Tang, X., Huang, L. Huang, M., Li, Y., Sun, H., 2011. Maslinic acid, a natural triterpenoid compound from Olea europaea. protects cortical neurons against oxygen-glucose deprivation-induced injury. Eur. J. Pharmacol 670. 148-153.

Qiu, W.-W., Shen. Q., Yang. F., Wang. B., Zou. H., Li, J.-Y., Li. J., Tang. J., 2009. Synthesis and biological evaluation of heterocyclic ring-substituted maslinic acid derivatives as novel inhibitors of protein tyrosine phosphatase 1B. Bioorg. Med. Chem. Lett 19, 6618-6622.

Reyes, F.J., Centelles. J.J., Lupianez, JA., Cascante, M., 2006. (2A1pha,3beta)-23-dihydroxyolean-12-en-28-oic acid, a new natural triterpene from Olea europea, induces caspase dependent apoptosis selectively in colon adenocarcinoma cells. FEBS Lett 580. 6302-6310.

Reyes-Zurita, F.J., Rufino-Palomares, E.E., Medina, P.P., Garcia-Salguero. E.L. Peragon. J., Cascante. M., Lupianez, JA. 2013. Antitumour activity on extrinsic apoptotic targets of the triterpenoid maslinic acid in p53-deficient Caco-2 adenocarcinoma cells. Biochimie 95, 2157-2167.

Reyes-Zurita, F.J., Rufino-Palomares, EE., Garda-Salguero, L, Peragon, J., Medina, P.P., Parra, A., Cascante, M., Lupianez, JA, 2016. Maslinic acid, a natural triterpene. induces a death receptor-mediated apoptotic mechanism in Caco-2 p53-deficient colon adenocarcinoma cell. PLoS One 11, e0146178.

Rondinone, C.M., Trevillyan, J.M., Clampit. J., Cum, R.J., Berg. C., Kroeger. P., Frost. L. Zinker, BA, Reilly, R., Ulrich, R., Butler. M., Monia, B.P., Jirousek, M.R., Waring. J.F., 2002. Protein tyrosine phosphatase 1b reduction regulates adiposity and expression of genes involved in lipogenesis. Diabetes 51, 2405-2411.

Rosen, E.D., Spiegelman. B.M., 2006. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444. 847-853.

Rufino-Palomares, E.E., Reyes-Zurita, F.J., Garcia-Salguero, L, Mokhtari, K., Medina. P.P., Lupianez. JA., Peragon, J., 2013. Maslinic acid, a triterpenic anti-tumoural agent, interferes with cytoskeleton protein expression in HT29 human colon-cancer cells. J. Proteomics 83. 15-25.

Rufino-Palomares, E.E., Perez-Jimenez. A., Reyes-Zurita, F.J., Garcia-Salguero. L. Mokhtari. K., Herrera-Merchan, A., Medina, P.P., Peragon, J., Lupianez, JA, 2015. Anti-cancer and anti-angiogenic properties of various natural pentacyclic tri-terpenoids and some of their chemical derivatives. Curr. Org. Chem. 19, 919-947.

Scheepers, A., Joost, H.G., Schurmann. A., 2004. The glucose transporter families SGLT and GLUT: Molecular basis of normal and aberrant function. J. Parenter. Enter. Nutr. 28, 364-371.

Wang, S.F., Zhai. CX, Liu. Q,. Wang. X., Ren. Z2., Zhang, Y.X., Zhang. Y.L, Wu, Q.H., Sun, S.N., Li, S.Y., Qiao, Y.J., 2014. Cycloastragenol. a triterpene aglycone derived from Radix astragali, suppresses the accumulation of cytoplasmic lipid droplet in 3T3-L1 adipocytes. Biochem. Bioph. Res. Co. 450, 306-311.

Wen, X., Sun, H., Liu, J., Cheng, K., Zhang. P., Zhang, L, Hao, J., Zhang. L, Ni, P., Zographos. S.E., Leonidas, D.D., Alexacou, K.M., Gimisis, T., Hayes, J.M., Oikonomakos, J.M., 2008. Naturally occurring pentacyclic triterpenes as inhibitors of glycogen Phosphorylase: synthesis, structure-activity relationships, and X-ray crystallography studies. J. Med. Chem 51, 3540-3554.

Yang, M.H., Avula, B., Smillie, T., Khan. IA., Khan, S.I., 2013. Screening of medicinal plants for PPARalpha and PPARgamma activation and evaluation of their effects on glucose uptake and 3T3-L1 adipogenesis. Planta Med 79,1084-1095.

Zhu, K.N., Jiang. C.H., Tian. YS., Xiao. N., Wu, Z.F., Ma, Y.L, Lin, Z., Fang, Si, Shang, X.L., Liu, K., Zhang, J., Liu, B.L, Yin, Z.Q,, 2015. Two triterpeniods from Cyclocarya paliurvs (Batal) Iljinsk (Juglandaceae) promote glucose uptake in 3T3-L1 adipocytes: The relationship to AM PK activation. Phytomedicine 22, 837-846.

Zorzano, A., Palacin, M., Guma. A., 2005. Mechanisms regulating GLUT4 glucose transporter expression and glucose transport in skeletal muscle. Acta Physiol. Scand 183, 43-58.

Amalia Perez-Jimenez (a,b), (1), **, Eva E. Rufino-Palomares (a,c), (1), ***, Nieves Fernandez-Gallego (a), (1) M. Carmen Ortuno-Costela (a), Fernando J. Reyes-Zurita (a), Juan Peragon (d), Leticia Garcia-Salguero (a), Khalida Mokhtari (a,e), Pedro P. Medina (a,c), Jose A. Lupianez (a), *

(a) Department of Biochemistry and Molecular Biology I, Faculty of Sciences, University of Granada, 18071 Granada, Spain

(b) Department of i+D+1, Biomaslinic S.L. Poligono Industrial de Escuzar, 18130 Granada Spain

(c) Pfizer Pharmaceutical-University of Granada-Government of Andalusian, Centre of Genomic and Oncologic Investigation (GENyO), Technological Park of Health Sciences, 18016 Granada, Spain

(d) Department of Experimental Biology, Biochemistry Section, Faculty of Experimental Biology, University of Jaen, 23071 Jaen, Spain

(e) Department of Biology. Faculty of Sciences, Mohammed I University, BP 717 60000 Oujda, Morocco

Abbreviations: aP2, adipocyte fatty acid-binding protein; Cr, threshold cycle; DMEM, dulbecco's modified eagle medium; DMSO, dimetilsulfoxide; FBS, fetal bovine serum; GADPH, glyceraldehyde 3-phosphate dehydrogenase; GLUT, glucose transporter; GPO, glycerol 1- phosphate oxidase; IBMX, 3-isobutyril 1-methylxanthine; [IC.sub.50], half maximal inhibitory concentration; IGF, insulin-like growth factor; IR[beta], insulin receptor; KRH, Krebs-Ringer-Hepes; MA, maslinic acid; MS. metabolic syndrome; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ORO. oil red O staining; PBS, phosphate buffered saline; PPAR[gamma], peroxisome proliferator-activated receptor [gamma]; PTP1B, protein-tyrosine phosphatase; RIPA buffer, radioimmunoprecipitation assay buffer; SDS, sodium dodecyl sulphate; SREBP, sterol regulatory element-binding protein: TAG, triglycerides.

* Corresponding author: Fax: +34958249945.

** Corresponding author.

*** Corresponding author.

E-mail addresses: calaya@ugr.es (A. Perez-Jimenez), evaevae@ugr.es (E.E. Rufino-Palomares), jlcara@ugr.es (JA. Lupianez).

(1) Authors who have contributed equally to the work

http://dx.doi.Org/10.1016/j.phymed.2016.07.00l

Table 1
Primer sequences for PCRs.

Gene           Forward primer 5'-3'     Reverse primer 5'-3'

PPAR[gamma]    CCAGAGTCTCCTGATCTGCG     GCCACCTCRRRCCTCTGCTC
aP2            AAGTGGGAGTGGGCTTTGC      TCCCCATTTACGCTGATGATC
GAPDH          TGGCAAAGTGGAGATTGTTGCC   AAGATGGTGATGGGCTTCCCG


----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2016 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original article
Author:Perez-Jimenez, Amalia; Rufino-Palomares, Eva E.; Fernandez-Gallego, Nieves; Ortuno-Costela, M. Carme
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Nov 15, 2016
Words:6887
Previous Article:Ginkgo biloba extract in combination with sorafenib is clinically safe and tolerable in advanced hepatocellular carcinoma patients.
Next Article:Isolation and characterization of bioactive metabolites from Xylaria psidii, an endophytic fungus of the medicinal plant Aegle marmelos and their...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |