Printer Friendly

Tanshinone II-A attenuates cardiac fibrosis and modulates collagen metabolism in rats with renovascular hypertension.

ABSTRACT

The adaptive changes that develop in the pressure-overloaded left ventricular myocardium include cardiac hypertrophy and interstitial fibrosis. The objectives of the present study were to evaluate the effects of Tanshinone II-A, a bioactive diterpene quinone isolated from Danshen, on cardiac fibrosis and collagen metabolism in rats with renovascular hypertension. Male Sprague-Dawley rats were subjected to two-kidney two-clip (2K2C) or sham operation (sham) and treated with Valsartan (Val, 26.7 mg/kg/d), Tanshinone II-A (Tsn, 70, 35 mg/kg/d) or vehicle. Six weeks later, systolic blood pressure (BP), LV weight, collagen abundance, cardiac function parameters, hydroxyproline content and mRNA levels of matrix metalloproteinase (MMP)-2, MMP-9, tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 were evaluated. Both high-dose (Tsn-H, 70 mg/kg/d)and low-dose (Tsn-L, 35 mg/kg/d) of Tsn failed to attenuate 2K2C-induced BP elevation but significantly attenuated the attendant interstitial fibrosis. Val suppressed elevations of BP and left ventricular systolic pressure (LVSP) in 2K2C rats. Val and Tsn-H exerted comparable suppressive effects on the gene expression of MMP-9 and TIMP-1, while Val decreased the MMP-2 mRNA level without affecting the transcript levels of TIMP-2. Both Val and Tsn-H attenuated cardiac dysfunction, while Tsn-L showed slight improvement. These data demonstrate for the first time, that Tsn prevented cardiac fibrosis and improved cardiac function in a rat model of renovascular hypertensive independent of hypotensive effect. Tsn conferred its beneficial effects on the collagen metabolism probably through its regulation of transcript levels of the MMPs/TIMPs balance.

ARTICLE INFO

Keywords: Tanshinone II-A Salvia miltiorrhiza Renovascular hypertensive rat Left ventricular fibrosis Collagen Matrix metalloproteinases

[C] 2010 Elsevier GmbH. All rights reserved.

Introduction

Hypertension is a major health problem associated with structural and functional modifications of the vasculature. Recent experimental and clinical studies examined the role of matrix metalloproteinases (MMPs)/tissue inhibitor of MMPs (TIMPs) in vascular remodeling associated with hypertension (Derosa et al. 2006; Matsusaka et al. 2006; Castro et al. 2008), suggesting that abnormal extracellualar matrix (ECM) metabolism occurs in hypertension, in normal tissues, collagen synthesis by fibroblasts and degradation by MMPs occur in equilibrium. In the setting of hypertensive heart disease (HHD), this equilibrium is disrupted, leading to left ventricular (LV) collagen accumulation. However, this does not merely result from an alteration to one side of the equilibrium, but more from a complex interplay between deposition and degradation. The collagen degradation is promoted by MMPs and is inhibited by TIMPs (Moncrieff et al. 2004). Thus, the prevention or regression of LV fibrosis is one of targeted goals for the management of HHD (Yoshida et al. 2003).

Tanshinone II-A, the main active diterpene quinone extracted from the traditional herbal medicine, Salvia miltiorrhiza Bunge known as "Danshen", has multiple pharmacological activities, such as anti-oxidant (Ng et al. 2000; Zhang and Wang 2007; Li et al. 2008b; Yang et al. 2008), anti-inflammatory (Jang et al. 2003; Li et al. 2008b; Fan et al. 2009), anti-neoplastic effects (Zhou et al. 2008; Zhang et al. 2009). Sodium Tanshinone II-A Sulfonate (STS), a water-soluble derivative of Tanshinone II-A has been safely and effectively used in China for treating cardiovascular disorders, such as myocardial infarction or angina pectoris. The accounting benefits include increasing coronary blood flow, alleviating cardiac metabolic disorders and protecting the heart against ischemia-reperfusion injury (Wu et al. 1993; Zhou et al. 2003) and clinical demonstration of improved clinical symptoms and electrocardiogram parameters (Takahashi et al. 2002). Mechanistically, STS also markedly suppressed angiotensin II-induced enlargement of cultured cardiomyocytes (Takahashi et al. 2002). In parallel, Han et al. demonstrated that Tanshinone II-A can inhibit the development of left ventricular hypertrophy (LVH) in spontaneously hypertensive rats (SHR) (Han et al. 2002). Accumulating in vivo and in vitro studies have also demonstrated Tanshinone II-A has therapeutic effects on [CCl.sub.4]-induced liver fibrosis in rats and inhibits smooth muscle cell (SMC) proliferation and migration (Liu et al. 2002; Du et al. 2005; Wang et al. 2005; Jin et al. 2008; Li et al. 2008a; Pan et al. 2009). In addition, our recent studies and reports by others have shown that Tanshinone II-A inhibit apoptosis of neonatal rat ventricular cardiomyocytes induced by [H.sub.2][O.sub.2] and adriamycin in vitro and by ischemia/reperfusion injury in vivo (Fu et al. 2007; Gao et al. 2008; Yang et al. 2008). These findings collectively support the interpretation that Tanshinone II-A may be beneficial in protecting the myocardium against hypertrophy and vascular remodeling.

Accordingly, in the present study, we investigated whether Tanshinone II-A could attenuate LV fibrosis in two-kidney two-clip (2K2C) renovascular hypertensive rats (RHRs), a well-established experimental animal model of hypertension (Zeng et al. 1998). The effects of Tanshinone II-A on the collagen regulatory system (MMPs/TIMPs) were also investigated to gain mechanistic insight into its cardioprotective effects.

Materials and methods

Chemicals and reagents

Hydroxyproline kit was purchased from Jiancheng Biotechnology Institute (Nanjing, China). Trizol Reagent was obtained from Gibco (Rockville, MD, USA), and dNTP, MMLV reverse transcriptase, Oligo(dT)15, and Taq DNA polymerase were from TaKaRa (Dalian, China). Valsartan was purchased from Novartis (Beijing, China). Purified Tanshinone II-A were kindly provided by Professor Lian-Quan Gu (Laboratory of Medicinal Chemistry, Sun Yat-sen University).

Establishment of renovascular hypertensive rat model

All animal care and experimental protocols were in accordance with "Guide for the Care and Use of Laboratory Animals" (National Institutes of Health Publication, revised 1996, No.86-23. Bethesda, MD) and were approved by the Institutional Ethical Committee for Animal Research of Sun Yat-sen University. Renovascular hypertension was induced in rats by the 2-kidney-2-clip method as described previously (Zeng et al. 1998). Briefly, male Sprague-Dawley rats weighing 100[+ or -]10g (provided by the Experimental Animal Center of Sun Yat-sen University) were anaesthetized by intraperitoneal injection of sodium pentobarbital (Sigma, 30 mg/kg). The left and right renal artery were exposed by retroperitoneal flank incision and dissected free of the renal vein and connective tissue. One silver clip with an internal diameter of 0.30 mm was placed around the left and right renal artery respectively for partial occlusion; In sham-operated groups, the arteries were not clipped. Animals were maintained under specific pathogen-free condition (12-h dark/12-h light cycles in air-conditioned rooms, 22.5[+ or -]0.5[degrees]C, 50 [+ or -]5% humidity) and received food and tap water ad libitum throughout the experimental period.

Study design

Body weight and blood pressures (BP) were assessed weekly throughout the experimental period. The BP was measured by the tail-cuff method in conscious rats (ADInstruments, Castle Hill, NSW, Australia). After 4 weeks post-operation, rats were considered to be hypertensive when BP was higher than 160 mmHg and five groups of rats were randomly assigned: (1) sham-operated group, without 2K2C operation, treated for 6 weeks with 0.5% carboxymethyl cellulose sodium (CMC-Na) (n = 7); (2) 2K2C hypertension group, treated for 6 weeks with 0.5% CMC-Na (n = 7); (3) Tanshinone II-A high-dose group, Tsn-H group, 70 mg/kg/d (n = 7); (4) Tanshinone II-A low-dose group, Tsn-L group, 35 mg/kg/d (n = 7); (5) Valsartan group, 26.7 mg/kg/d) (n = 7). All the drugs were dissolved in 0.5% CMC-Na and given by gavage.

Echocardiographic and hemodynamic studies

Transthoracic M-mode echocardiographic studies were performed before termination of the experiment, as previously described in detail (Nakamura et al. 2003). In brief, rats were anesthetized with an overdose of sodium pentobarbital (30 mg/kg i.p.), and a commercially available echocardiographic machine equipped with a 7.5 MHz transducer (ESAOTE Technos MPX DU8, Italy) was used to record M-mode echocardiograms. M-mode tracings and the two-dimensional short-axis view of the left ventricle were recorded through the intraventricular septum and posterior LV walls at the papillary muscle level to measure fractional shortening, LV end-diastolic dimension, and LV ejection fraction. All Doppler spectra were recorded on paper at 100mm/s. Following the echocardiographic study, LV catheterization was performed by cannulation of the right carotid artery with a polyethylene Millar Pressure Catheter that was carefully advanced to the LV, then LV hemodynamics was assessed by BL-420 Physiological Signals Recording System (Chengdu, China).

Tissue preparation

After the hemodynamic studies, hearts were quickly harvested. The left ventricles were separated from the atrium and the right ventricle free wall. Then their weights were determined with a precision balance. Cardiac hypertrophy was assessed by the ratio of LV wet weight to total body weight (LVW/BW). Samples were immersed in ice-cold 4% neutrally buffered paraformaldehyde solution for 16-24h at 100 mmHg. The samples were always obtained from the middle part of the left ventricle to exclude possible differences in matrix protein content in different regions of the left ventricle. The other parts of the left ventricle, for measurement of the hydroxyproline content and the levels of mRNAs, were immediately placed in liquid nitrogen and stored at -80[degrees]C before use.

Collagen determination by VanGieson staining

The tissues immersed in 4% buffered paraformaldehyde solution were embedded in paraffin and cut into 5 [mu]m sections. Tissue sections were stained with VanGieson (VG) for morphological observations and assessment of interstitial collagen content. Sections were analyzed under the microscope (10x) and randomized selected fields were digitized to obtain images. From each of three nonconsecutive serial sections, 10 random high-power fields were recorded. The severity of fibrosis was evaluated with the use of a semiautomatic image analysis system (Kontron IBAS 2.5, Germany). Collagen volume fraction (CVF) was calculated as percent surface area occupied by collagen. Collagen content was estimated by subtracting the background from the intensity values obtained from each cross section. Interstitial collagen quantification (VG positive staining area) was performed with Image Pro-Plus software (Media-cybernetics). Two independent investigators blinded to the experimental groups performed the analysis.

Hydroxyproline assay

The collagen content in the LV myocardium was determined by hydroxyproline assay as described previously (Young et al. 1994). Hydroxyproline was measured using colorimetric assay with a commercially available kit. Data were expressed as micrograms of collagen per milligram wet weight, assuming that collagen contains an average of 13.5% hydroxyproline.

Semi-quantitative RT-PCR

RT-PCR analysis was performed as previously described (Zhang et al. 2007). PCR amplification was performed for [beta]-actin, MMP-2. MMP-9, TIMP-1, TIMP-2 mRNA detection (primer sets listed in Table 1). After background subtraction, identified signal intensities of specific product bands were quantified densitometrically and normalized with that of [beta]-actin and expressed as arbitrary units.

Statistical analysis
Table 1

Primer sets used for semi-quantitative RT-PCR.

Gene          GenBank accession no.  Primer sequence (5'-3')

[beta]-Actin  NM-031144.2            Forward: CACCCTGTGCTGCTCACCGAGGCC
                                     Reverse: CCACACAGATGACTTGCGCTCAGG

MMP-2         NM-031054.1            Forward: TTCTTCGCAGGGAATGAG
                                     Reverse: CTTCCAAACTTCACGCTC

MMP-9         NM-031055.1            Forward: GAGGGACGCTCCTATTTG
                                     Reverse: GCCTTGGGTCAGGTTTAG

TIMP-1        NM-053819.1            Forward: TCCTGGTTCCCTGGCATAATC
                                     Reverse: ATCTGATCTGTCCACAAGCAA
TIMP-2        NM-021989.2            Forward: CAAAGCAGTGAGCGAGAA
                                     Reverse: GTAGCATGGGATCATAGG


All values are expressed as means [+ or -] S.D. unless otherwise specified. Data were analyzed by 2-tailed unpaired Student's t-test between 2 groups and by one-way ANOVA followed by Bonferroni post hoc test for multiple comparison involved. The analyses were performed using GraphPad Prism Software (GraphPad Software Inc. La Jolla, CA, USA). A P value <0.05 were considered statistically significant.

Results

Characteristics of 2K2C hypertensive rats

The characteristics of renovascular hypertensive rats (RHR) and their corresponding controls at 4 weeks and 10 weeks after clipping the renal arteries or sham operation were shown in Table 2. There were no significant differences in body weight and heart rate between sham-operated and 2K2C hypertensive rats. The mean systolic BP rose to 179[+ or -]6 mmHg and 186[+ or -]7 mmHg at the end of 4 and 10 weeks of age. Compared with sham-operated rats, BP and the relative weight of left ventricle (LVW/BW) were increased significantly in 2K2C rats (Table 2).
Table 2

Blood Pressure, Heart Weight, Body Weight and the relative Heart Weight
in 2K2C RHRs.

           Sham 4 weeks     2K2C 4 weeks

BP (mmHg)  130 [+ or -] 4   179 [+ or -] 6 *
HR (bpm)   371 [+ or -] 87  382 [+ or -] 76
HW (g)     -                -
BW (g)     174 [+ or -] 8   169 [+ or -] 18
HW/BW (%)  -                -

           Sham 10 weeks       2K2C 10 weeks

BP (mmHg)   137 [+ or -] 5      186 [+ or -] 7 *
HR (bpm)    365 [+ or -] 78     379 [+ or -] 59
HW (g)     0.86 [+ or -] 0.13  1.26 [+ or -] 0.1 *
BW (g)      270 [+ or -] 31     281 [+ or -] 26
HW/BW (%)   3.2 [+ or -] 0.2    4.5 [+ or -] 0.1 *

Sham: Sham-operated group; 2K2C: 2K2C hypertensive group; BP: blood
pressure; HR: heart rate; HW: heart weight; BW: body weight. Data are
presented means [+ or -] S.D.
* P < 0.05 vs Sham-operated group at the corresponding weeks.


Effects of Tanshinone II-A on LVH and BP

As expected, at the end of the experiment, 2K2C was associated with a significant increase in systolic BP, left ventricular weight index (LVW/BW) in RHR, indicating the development of pressure-overload hypertrophy (Table 2). Long-term treatment of 2K2C rats with Tanshinone II-A at 70mg/kg and Valsartan at 26.7mg/kg/d for 6 weeks suppressed the increase in LVW/BW (Fig. 1). BP was significantly lowered by treatment with Valsartan at 26.7 mg/kg/d for 6 weeks (P < 0.05); however, it was not significantly affected by treatment with Tanshinone II-A at either 70 mg/kg/d or 35 mg/kg/d for 6 weeks (Fig. 2).

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Effects of Tanshinone II-A on hemodynamics and echocardiographical parameters

As shown in Table 3, the left ventricle systolic pressure (LVSP), left ventricle end-diastolic pressure (LVEDP), and maximum ascending and declining rate of left ventricular pressure ([+ or -]dp/[dt.sub.max]) are markedly elevated in 2K2C hypertensive rats, suggesting that both preload and afterload increased, contractility and diastolic compliance decreased, and obvious cardiac dysfunction developed. Valsartan suppressed left ventricular systolic pressure (LVSP) of 2K2C rats while Tanshinone II-A had minimal effect on LVSP. LVEDP increased significantly in 2K2C RHR, both Valsartan and Tanshinone II-A at high dose significantly decreased LVEDP and [+ or -]dp/[dt.sub.max], indicating that Tanshinone II-A and Valsartan decreased the cardiac overload, increased the compliance of myocardium and improved cardiac dysfunction induced by 2K2C hypertension.
Table 3

Effect of Tanshinone[alpha]-A and Valsartan on Echocardiographical
Parameters in 2K2C RHRs.

                            Sham (n = 6)         2K2C (n = 7)

IVSd (mm)                    1.53 [+ or -] 0.25   2.72 [+ or -] 0.13 *
LVDd (mm)                    4.89 [+ or -] 0.12   4.29 [+ or -] 0.16 *
EF%                         99.16 [+ or -] 0.26  87.17 [+ or -] 1.53 *
LVFS%                       77.68 [+ or -] 1.07  49.35 [+ or -] 2.45 *
Pwd (mm)                     1.58 [+ or -] 0.17   2.35 [+ or -] 0.11 *
IVSs (mm)                    2.13 [+ or -] 0.16   4.13 [+ or -] 0.13 *
LVDs (mm)                    1.02 [+ or -] 0.06   1.98 [+ or -] 0.13 *
Pws (mm)                     2.49 [+ or -] 0.14   4.16 [+ or -] 0.18 *
LVSP (mmHg)                   148 [+ or -] 10      187 [+ or -] 14 *
LVEDP (mmHg)                  5.3 [+ or -] 0.5     9.2 [+ or -] 0.9 *
+dp/[dt.sub.max] (mmHg/ms)   5.12 [+ or -] 0.26   9.75 [+ or -] 0.52 *
-dp/[dt.sub.max] (mmHg/ms)   4.41 [+ or -] 0.31   9.48 [+ or -] 0.51 *

                            Tsn-H (n = 6)          Tsn-L (n = 6)

IVSd (mm)                    1.95 [+ or -] 0.24 #   2.65 [+ or -] 0.17

LVDd (mm)                    4.62 [+ or -] 0.21 #   4.31 [+ or -] 0.19

EF%                         91.90 [+ or -] 0.91    94.08 [+ or -] 2.73
                                                   #

LVFS%                       58.45 [+ or -] 1.74    64.70 [+ or -] 4.90
                            #                      #

Pwd (mm)                     1.78 [+ or -] 0.09 #   1.91 [+ or -] 0.14
                                                   #

IVSs (mm)                    2.99 [+ or -] 0.13     3.42 [+ or -] 0.12
                            *, #                   *, #

LVDs (mm)                    1.52 [+ or -] 0.11     1.73 [+ or -] 0.15
                            *, #                   *

Pws (mm)                     3.04 [+ or -] 0.20     3.29 [+ or -] 0.22
                            *, #                   *, #

LVSP (mmHg)                   182 [+ or -] 15 *      186 [+ or -] 12 *

LVEDP (mmHg)                  6.4 [+ or -] 0.7 #     7.4 [+ or -] 0.8

+dp/[dt.sub.max] (mmHg/ms)   7.28 [+ or -] 0.46     8.87 [+ or -] 0.51
                            *, #                   *

-dp/[dt.sub.max] (mmHg/ms)   6.23 [+ or -] 0.31     7.20 [+ or -] 0.28
                            *, #                   *, #

                            Val (n = 6)

IVSd (mm)                    1.81 [+ or -] 0.16 #
LVDd (mm)                    4.58 [+ or -] 0.20 #
EF%                         91.50 [+ or -] 1.38
LVFS%                       55.35 [+ or -] 1.32 #
Pwd (mm)                     1.69 [+ or -] 0.12 #
IVSs (mm)                    2.62 [+ or -] 0.15 #
LVDs (mm)                    1.37 [+ or -] 0.19 *, #
Pws (mm)                     2.92 [+ or -] 0.17 *, #
LVSP (mmHg)                   150 [+ or -] 11 #
LVEDP (mmHg)                  6.2 [+ or -] 0.6 #
+dp/[dt.sub.max] (mmHg/ms)   5.27 [+ or -] 0.32 #
-dp/[dt.sub.max] (mmHg/ms)   6.20 [+ or -] 0.22 *, #

IVSd: interventricular septum end-diastolic thickness; LVDd: left
ventricular end-diastolic dimension; Pwd: left ventricular posterior
wall thickness at end-diastole; IVSs, interventricular septum
end-systolic thickness; LVDs, left ventricular end-systolic
dimension; LVSP: left ventricular systolic pressure; PWs, left
ventricular posterior wall end-systolic thickness; EF, ejection
fraction; FS, left ventricular fraction shortening. Data are
presented as means [+ or -] S.D.
* P < 0.05 vs Sham-operated group.
# P < 0.05 vs 2K2C hypertensive group.


IVSd, PWd, IVSs, LVDs and PWs, increased while others, including LVDd, EF% and FS% decreased significantly (P < 0.05) in 2K2C operation group compared with those in sham-operated group, indicating that the 2K2C rats had developed obvious concentric cardiac hypertrophy and that its cardiac function such as compliance of myocardium had deteriorated especially in diastolic phase. Both Valsartan and Tanshinone II-A at high dose significantly prevented the cardiac hypertrophy development and the deterioration of cardiac function estimated by the decreased parameters such as IVSd, PWd, IVSs, LVDs and PWs, and the increased LVDd, EF%, FS%, compared with untreated 2K2C rats.

Effects of Tanshinone II-A on collagen volume fraction

Pressure-overload hypertrophy was associated with left ventricular fibrosis, as reflected by a marked increase in cardiac collagen fraction (Fig. 3A and B). Histological examination showed that a diffuse interstitial and a marked perivascular fibrosis were evident in 2K2C hypertensive rats, which were also demonstrated by the much greater collagen volume fraction (CVF) (3.66 [+ or -]0.17% versus 1.3[+ or -]0.15%. P<0.01). Both Valsartan and Tanshinone II-A at high dose significantly prevented the cardiac fibrosis development evidenced by decreasing CVF to 2.92[+ or -]0.11 (P<0.01) and 2.94[+ or -]0.13% (P<0.01), respectively (as shown in Fig. 3C).

[FIGURE 3 OMITTED]

Effects of Tanshinone II-A on LV collagen content

LV collagen content, as estimated by hydroxyproline assay, was increased in the 2K2C untreated group compared with sham-operated group (3.27[+ or -]0.16 [mu]g/mg versus 2.15[+ or -]0.18 [mu]g/mg, P < 0.01). Tanshinone II-A at doses of 70 mg/kg and 35 mg/kg and Valsartan 26.7 mg/kg/d prevented the increase (Fig. 3D), reflected by the decreasing collagen content to 2.46[+ or -]0.17 [mu]g/mg(P < 0.01), 2.71[+ or -]0.19[mu]g/mg (P < 0.05) and 2.52[+ or -]0.16 [mu]g/mg (P < 0.01), respectively.

Effects of Tanshinone II-A on MMPs, TIMPs transcript levels

Gene expression of MMP-2, MMP-9, TIMP-1 and TIMP-2 were markedly enhanced in the 2K2C untreated rats (Fig. 4). Tanshinone II-A at 70 mg/kg decreased mRNA levels of MMP-9, TIMP-1 and TIMP-2 (P < 0.05) without affecting the MMP-2 mRNA level. The change of gene expression of MMP-9 and TIMP-1 were comparable between Tanshinone II-A high dose and Valsartan group. In contrast to chronic administration of Tanshinone II-A. Valsartan decreased the MMP-2 level without altering the levels of TIMP-2. Consequently, a higher ratio of MMP-2 mRNA level to TIMP-2 mRNA level was observed in 2K2C RHR treated with Tanshinone II-A at 70 mg/kg compared with that of rats treated with Valsartan (1.6-fold increase).

[FIGURE 4 OMITTED]

Discussion

Major structural alterations in the hypertensive heart disease consist of left ventricular (LV) hypertrophy and fibrosis. The present study demonstrates, for the first time, that a blood pressure-lowering independent cardioprotective effect of Tanshinone II-Aon cardiac interstitial fibrosis and cardiac dysfunction was comparable with angiotensin-II type-1 receptor antagonist - Valsartan. Tanshinone II-A exerted its beneficial effects on the collagen metabolism probably through its regulation of the MMPs/TIMPs mRNA levels. The results of the present study and clinical safety data of Tanshinone II-A suggest that it may be an promising drug candidate for further application in the treatment of human HHD, such as myocardial interstitial fibrosis and left ventricular hypertrophy.

In our study, the relative weight of LV was increased, the area of fibrosis, CVF and the collagen content of LV were more pronounced in the 2K2C rats than in the control rats. The echocardiographic and hemodynamic data indicated the presence of cardiac dysfunction especially diastolic dysfunction in the 2K2C untreated rats. Treatment with Tanshinone II-A at 70 mg/kg/d for 6 weeks prevented cardiac remodeling especially LV fibrosis, resulted in the improvement of cardiac dysfunction especially diastolic dysfunction. Other investigations have suggested that disruption of the extracellular matrix could interfere with compensatory cellular signaling processes that may occur naturally in LVH, ultimately affecting cardiac function (Kim et al. 2000). The accumulation of collagen and altered balance between MMPs and TIMPs represent targets of pharmacological intervention in heart failure (Weber 2000). Study in mice with viral myocarditis suggested that the activities of myocardial MMP-2 and MMP-9 increased significantly during the acute stage, and the total quantity of myocardial collagen increased by the time of recovery. These changes were associated with myocardial interstitial remodeling and cardiac dysfunction. Direct genetic evidence for a role of the MMP systems in pressure overload-induced LV hypertrophy and in heart failure suggest that the use of MMP-inhibitors might preserve cardiac pump function in LV pressure overloading (Heymans et al. 2005). In agreement with this concept, targeted disruption of MMP-2 ameliorates cardiac hypertrophy and myocardial remodeling in chronic pressure-overloaded mice (Matsusaka et al. 2006). Additionally, Castro et al. reported that anti-oxidant treatment reduced MMP-2 expression and attenuated vascular dysfunction and remodeling during 2K1C hypertension (Castro et al. 2008). In this study, effects of Tanshinone II-A and Valsartan on gene expression of MMP-9 and TIMP-1 were similar. However, Tanshinone II-A did not decrease the MMP-2 mRNA level, which was decreased by Valsartan; whereas Tanshinone II-A did decrease the TIMP-2 mRNA level, which was not affected by Valsartan, resulting in a higher MMP-2/TIMP-2 ratio in the rats treated with Tanshinone II-A at 70 mg/kg/d. In keeping with this result, Fang et al. reported that administration of Tanshinone II-A inhibit MMP-2 and MMP-9 expression/activity in rabbits fed a high-fat diet (Fang et al. 2007, 2008).

The mechanism underlying the attenuation of 2K2C-induced cardiac fibrosis by Tanshinone II-A remains an area of considerable interest. These preventive effects may be attributable to decreased collagen synthesis or inhibition of fibroblast proliferation. We recently demonstrated in another animal model of hypertension induced by abdominal aorta constriction (AAC), that Tanshinone II-A prevented the cardiac fibrosis in vitro and in vivo via inhibitory effects on connective tissue growth factor (CTGF), transforming growth factor-[beta] (TGF-[beta]), fibronectin (FN) and collagen I, collagen III expression (unpublished observations). Consistent with this observation, Yang et al. recently demonstrated that STS attenuates angiotensin II-induced collagen type I expression and collagen synthesis in cardiac fibroblasts by depressing the intracellular generation of reactive oxygen species and NADPH oxidase activity (Yang et al. 2009). In addition, Tanshinone II-A is considered to be an effective inhibitor of angiotensin-II, and [Ca]i (Takahashi et al. 2002). Taken together, all these distinctive signaling pathways may converge to mediate the anti-fibrotic effects of Tanshinone II-A.

Study limitation

In the present study, the effects of Tanshinone II-A on myocardial local angiotensin-II levels and calcium levels were not investigated. Also, due to samples insufficiencies, we did not explore the underlying mechanisms whereby Tanshinone II-A and Valsartan exert their inhibitory effects on cardiac fibrosis, especially the protein expression/activity of MMP-2 and MMP-9. Further work is underway in our lab to examine the mechanisms whereby Tanshinone II-A modulate collagen metabolism, such as myocardial oxidative stress, MAPK signaling cascade and alternations in myocardial inflammatory cell content.

Conclusions

In summary, our findings revealed that Tanshinone II-A prevented cardiac fibrosis, LV hypertrophy, and improved cardiac relaxation in 2K2C renovascular hypertensive rats independent of hypotensive effect. Tanshinone II-A conferred its beneficial effects on the collagen metabolism probably through its regulation of the MMPs/TIMPs mRNA level. Our findings are of clinical interest given the high prevalence of hypertensive heart disease and fibrosis, which has a prominent role in many forms of heart failure. It will be important to further elucidate these mechanisms and to explore the potential clinical utility of Tanshinone II-A in hypertensive patients.

Acknowledgements

This work was supported by research grants from National Natural Science Foundation of China (No. 30672459, No. 30772576); The Ministry of Science and Technology of China Major Special Project "Significant Creation of New Drugs" (No:2009ZX09102-152, 2009ZX09303-007). Key Project supported by Natural Science Foundation of Guangdong Province, China (No. 7117380). The authors greatly appreciate Jin-Ping Wang and Wei-Hua Liu for skillful technical assistance and other members of Dr. Pei-Qing Liu's Lab for helpful discussions.

References

Castro, M.M., Rizzi, E., Figueiredo-Lopes, L., et al., 2008. Metalloproteinase inhibition ameliorates hypertension and prevents vascular dysfunction and remodeling in renovascular hypertensive rats. Atherosclerosis 198, 320-331.

Derosa, G., D'Angelo, A., Ciccarelli, L., et al., 2006. Matrix metalloproteinase-2, -9, and tissue inhibitor of metalloproteinase-1 in patients with hypertension. Endothelium 13, 227-231.

Du, J.R., Li, X., Zhang,. R., Qian, Z.M., 2005. Tanshinone inhibits intimal hyperplasia in the ligated carotid artery in mice. Journal of Ethnopharmacology 98, 319-322.

Fan, G.W., Gao, X.M., Wang, H., et al., 2009. The anti-inflammatory activities of Tanshinone IIA, an active component of TCM, are mediated by estrogen receptor activation and inhibition of iNOS. The Journal of Steroid Biochemistry and Molecular Biology 113, 275-280.

Fang, Z.Y., Lin, R., Yuan, B.X., Liu, Y., Zhang, H., 2007. Tanshinone IIA inhibits atherosclerotic plaque formation by down-regulating MMP-2 and MMP-9 expression in rabbits fed a high-fat diet. Life Sciences 81, 1339-1345.

Fang, Z.Y., Lin, R., Yuan, B.X., Yang, G.D., Liu, Y., Zhang, H., 2008. Tanshinone IIA down-regulates the CD40 expression and decreases MMP-2 activity on atherosclerosis induced by high fatty diet in rabbit. Journal of Ethnopharmacology 115, 217-222.

Fu, J., Huang, H., Liu, J., Pi, R., Chen, J., Liu, P., 2007. Tanshinone IIA protects cardiac myocytes against oxidative stress-triggered damage and apoptosis. European Journal of Pharmacology 568, 213-221.

Gao, J., Yang, G., Pi, R., et al., 2008. Tanshinone IIA protects neonatal rat cardiomyocytes from adriamycin-induced apoptosis. Transl Res 151, 79-87.

Han, S., Zheng, Z., Ren, D., 2002. Effect of Salvia miltiorrhiza on left ventricular hypertrophy and cardiac aldosterone in spontaneously hypertensive rats. Journal of Huazhong University of Science and Technology. Medical Sciences 22, 302-304.

Heymans, S., Lupu, F., Terclavers, S., et al., 2005. Loss or inhibition of uPA or MMP-9 attenuates LV remodeling and dysfunction after acute pressure overload in mice. The American Journal of Pathology 166, 15-25.

Jang, S.I., Jeong, S.I., Kim, K.J., et al., 2003. Tanshinone IIA from Salvia miltiorrhiza inhibits inducible nitric oxide synthase expression and production of TNF-alpha, IL-1beta and IL-6 in activated RAW 264. 7 cells. Planta Medica 69, 1057-1059.

Jin, U.H., Suh, S.J., Chang, H.W., et al., 2008. Tanshinone IIA from Salvia miltiorrhiza BUNGE inhibits human aortic smooth muscle cell migration and MMP-9 activity through AKT signaling pathway. Journal of Cellular Biochemistry 104, 15-26.

Kim, H.E., Dalal, S.S., Young, E., et al., 2000. Disruption of the myocardial extracellular matrix leads to cardiac dysfunction. The Journal of Clinical Investigation 106, 857-866.

Li, Q., Wang, Y., Feng, N., Fan, Z., Sun, J., Nan, Y., 2008a. Novel polymeric nanoparticles containing tanshinone IIA for the treatment of hepatoma. Journal of Drug Targeting 16, 725-732.

Li, Y.I., Elmer, G., Leboeuf, R.C., 2008b. Tanshinone IIA reduces macrophage death induced by hydrogen peroxide by upregulating glutathione peroxidase. Life Sciences 83, 557-562.

Liu, Y., Chen, H., Jiang, Y., 2002. Effect of tanshinone IIA on CCl4-induced liver fibrosis in rats. Journal of Chinese Medicinal Materials 25, 31-33.

Matsusaka, H., Ide, T., Matsushima, S., Ikeuchi, M., Kubota, T., Sunagawa, K., Kinugawa, S., Tsutsui, H., 2006. Targeted deletion of matrix metalloproteinase 2 ameliorates myocardial remodeling in mice with chronic pressure overload. Hypertension 47, 711-717.

Moncrieff. J., Lindsay, M.M., Dunn, F.G., 2004. Hypertensive heart disease and fibrosis. Current Opinion in Cardiology 19, 326-331.

Nakamura, Y., Yoshiyama, M., Omura, T., Yoshida, K., Izumi, Y., Takeuchi, K., Kim, S., Iwao, H., Yoshikawa, J., 2003. Beneficial effects of combination of ACE inhibitor and angiotensin II type 1 receptor blocker on cardiac remodeling in rat myocardial infarction. Cardiovascular Research 57, 48-54.

Ng, T.B., Liu, F., Wang, Z.T., 2000. Antioxidative activity of natural products from plants. Life Sciences 66, 709-723.

Pan, Y.J., Li, X.Y., Yang, G.T., 2009. Effect of tanshinone II A on the calcineurin activity in proliferating vascular smooth muscle cells of rats. Chinese Journal of Integrated Traditional and Western Medicine 29, 133-135.

Takahashi, K., Ouyang, X., Komatsu, K., Nakamura, N., Hattori, M., Baba, A., Azuma, J., 2002. Sodium tanshinone IIA sulfonate derived from Danshen (Salvia miltiorrhiza) attenuates hypertrophy induced by angiotensin II in cultured neonatal rat cardiac cells. Biochemical Pharmacology 64, 745-749.

Wang, H., Gao, X., Zhang, B., 2005. Tanshinone: an inhibitor of proliferation of vascular smooth muscle cells. Journal of Ethnopharmacology 99, 93-98.

Weber, K.T., 2000. Targeting pathological remodeling: concepts of cardioprotection and reparation. Circulation 102, 1342-1345.

Wu, T.W., Zeng, L.H., Fung, K.P., Wu, J., Pang, H., Grey, A.A., Weisel, R.D., Wang, J.Y., 1993. Effect of sodium tanshinone IIA sulfonate in the rabbit myocardium and on human cardiomyocytes and vascular endothelial cells. Biochemical Pharmacology 46, 2327-2332.

Yang, L., Zou, X.J., Gao, X., Chen, H., Luo, J.L., Wang, Z.H., Liang, Q.S., Yang, G.T., 2009. Sodium tanshinone IIA sulfonate attenuates angiotensin II-induced collagen type I expression in cardiac fibroblasts in vitro. Experimental & Molecular Medicine 41, 508-516.

Yang, R., Liu, A., Ma, X., Li, L., Su, D., Liu, J., 2008. Sodium tanshinone IIA sulfonate protects cardiomyocytes against oxidative stress-mediated apoptosis through inhibiting JNK activation. Journal of Cardiovascular Pharmacology 51, 396-401.

Yoshida, J., Yamamoto, K., Mano, T., Sakata, Y., Nishikawa, N., Miwa, T., Hori, M., Masuyama, T., 2003. Angiotensin II type 1 and endothelin type A receptor antagonists modulate the extracellular matrix regulatory system differently in diastolic heart failure. Journal of Hypertension 21, 437-444.

Young, M., Fullerton, M., Dilley, R., Funder J., 1994. Mineralocorticoids, hypertension, and cardiac fibrosis. The Journal of Clinical Investigation 93, 2578-2583.

Zeng, J., Zhang, Y., Mo, J., Su, Z., Huang, R., 1998. Two-kidney, two clip renovascular hypertensive rats can be used as stroke-prone rats. Stroke 29, 1708-1713.

Zhang. H., Pi, R., Li. R., Wang, P., Tang, F., Zhou, S., Gao, J., Jiang, J., Chen, S., Liu, P., 2007. PPARbeta/delta activation inhibits angiotensin II-induced collagen type I expression in rat cardiac fibroblasts. Archives of Biochemistry and Biophysics 460, 25-32.

Zhang, H.S., Wang, S.Q., 2007. Nrf2 is involved in the effect of tanshinone IIA on intracellular redox status in human aortic smooth muscle cells. Biochemical Pharmacology 73, 1358-1366.

Zhang, Z., Gao, J., Wang, Y., Song, T., Zhang, J., Wu, G., Zhang, T., Du, G., 2009. Tanshinone IIA triggers p53 responses and apoptosis by RNA polymerase II upon DNA minor groove binding. Biochemical Pharmacology.

Zhou, G., Jiang, W., Zhao, Y., Ma, G., Xin, W., Yin, J., Zhao, B., 2003. Sodium tanshinone IIA sulfonate mediates electron transfer reaction in rat heart mitochondria. Biochemical Pharmacology 65, 51-57.

Zhou, L., Chan, W.K., Xu, N., Xiao, K., Luo, H., Luo, K.Q., Chang, D.C., 2008. Tanshinone IIA, an isolated compound from Salvia miltiorrhiza Bunge, induces apoptosis in HeLa cells through mitotic arrest. Life Sciences 83, 394-403.

Jian Fang (a), (b), (1), Suo-Wen Xu (a), (1) Ping Wang (a), Fu-Tian Tang (a), (c), Si-Gui Zhou (a), (c), Jie Gaoa, Jian-Wen Chen (a), He-Qing Huang (a), Pei-Qing Liu (a), *

(a) Department of Pharmacology and Toxicology. School of Pharmaceutical Sciences, Sun Yat-sen University. Higher Education Mega Center, Guaiuuhou 510006, PR China

(b) Department of Pharmacy. People's Hospital of Hua-du District, Guangzhou, PR China

(c) Department of Pharmacology, Guangdong Pharmaceutical University. Guangzhou, PR China

* Corresponding author at: Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-sen University (Higher Education Mega Center), 132 East Wai-huan Rd., Guangzhou 510006, PR China. Tel.: +86 20 39943116; fax: +86 20 39943026.

E-mail address: liupq@mail.sysu.edu.cn (P.-Q, Liu).

(1) These authors contributed equally to this work.
COPYRIGHT 2010 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Short communication
Author:Fang, Jian; Xu, Suo-Wen; Wang, Ping; Tang, Fu-Tian; Zhou, Si-Gui; Gao, Jie; Chen, Jian-Wen; Huang, H
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Dec 15, 2010
Words:5403
Previous Article:Cardioprotective activity of Cladosiphon okamuranus fucoidan against isoproterenol induced myocardial infarction in rats.
Next Article:S-allylcysteine reduces the MPTP-induced striatal cell damage via inhibition of pro-inflammatory cytokine tumor necrosis factor-[alpha] and inducible...
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters