Printer Friendly

THE GENETIC CHARACTERIZATION OF FAMILIAL HYPERCHOLESTEROLEMIA IN PAKISTAN.

Byline: Sobia Rafiq, Nuzhat Ahmed, Anne Soutar and Raheel Qamar

Abstract

Familial hypercholesterolemia (FH) is caused by mutations in the genes coding for the low-density lipoprotein receptor (LDLR), apolipoprotein B-lOO, or proprotein convertase subtilisin/kexin type 9 (PCSK9). In this study, a molecular analysis of LDLR gene and APOB gene was performed in a group of 17 unrelated patients from Pakistan. All patients were clinically diagnosed with definite or possible hypercholesterolemia according to a uniform protocol and internationally accepted WHO criteria. Mutational analysis included all exons, exon-intron boundaries and the promoter sequence of the LDLR, and fragments of exon 26 and exon 29 of APOB. In our study, SNPs within LDLR exon 12, rs688 and LDLR exon 13, rs5925 were identified. We identified associations between SNPs and increased levels of cholesterol in Pakistani population. We failed to detect polymorphisms in the APOB gene.

INTRODUCTION

Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the low-density lipoprotein receptor (LDLR) gene and defects in the apolipoprotein B-100 (apoB), the proprotein convertase subtilisinlkexin type 9 (PCSK9) gene or in other unidentified genes (Goldstein et al., 2001). However, the main causes of FH are the mutations in the LDLR gene. Mutations in the LDLR gene can lead to a partial or complete functional loss of the LDLR, which results in cholesterol distribution, utilization disorder, and finally, the formation of atherosclerosis. To date, over 1200 different LDLR mutations spanning the entire length of the gene have been reported (www.ucl.ac/ldlr).

LDLR is an excellent gene for candidate SNP studies because LDLR mutations are a primary case of familial hypercholesterolemia, suggesting that other gene products do not compensate effectively for reduced LDLR function (Pullinger et al., 2003; Anderson et al., 2003 and Hobbs et al., 1992). Although LDLR SNPs and their haplotypes have been associated with cholesterol levels in many studies (Boright et al., 1998; Knoblauch et al. 2002 and Knoblauch et al. 2004), SNPs that alter LDLR function have not been identified. Here we report two synonymous LDLR coding SNPs, rs688 located in exon 12, and rs5925 located in exon 13. We observed that these SNPs were associated with decreased LDLR splicing efficiency and increased levels of total and LDL-cholesterol.

MATERIALS & METHODS

Blood samples were collected from 17 unrelated patients from after overnight fasting of 12-14 hours. The diagnosis of FH was adapted from the Simon Broome Study Group (Simon Broome Register Group, 1991) and the study was approved by the Board of Advanced Studies and Research (BASR), University of Karachi. All patients had given informed consent to DNA-based diagnosis of their disorder.

The biochemical parameters including total cholesterol, HDL cholesterol and triglycerides, were determined for all subjects by an enzymatic colorimetric method using Roche Diagnostics Kit in Hitachi 911 analyzer (Boehringer Manneheim, Roche), following the manufacturers instructions. LDL cholesterol values were calculated using the Friedewald formula (Friedewald et al., 1972).

DNA samples from patients were amplified by polymerase Chain Reaction (PCR) with oligonucleotide primers (Table 1). Amplified fragments from genomic DNA comprising all exons of the LDLR gene were analyzed for mutations by PCR and automated sequencing. The PCR products were fractionated on an ABI DNA sequencer and were analyzed with the GeneScan Analysis Software Version 3.1.2. Only electropherograms that passed quality control were analyzed and peak heights were measured with Genotyper Software Version 2.5 (Applied Biosystems).

RESULTS

We observed 2 synonymous LDLR coding SNPs, rs688 located in exon 12 and rs5925 located in exon 13. We present the SNP identification number, position, their allele frequencies, and sequence information in (Table 2). The SNP, rs688 was detected in 9 (53%) patients and SNP, rs5925 was detected in 3 (18%) patients.

It was observed that these SNPs modulate splicing efficiency by altering exon splicing enhancers (ESEs), are increasingly recognized as functional genetic variants associated with clinically relevant phenotypes (Fairbrother et al., 2004; Zatkova et al., 2004; Pfarr et al., 2005 and Steiner et al., 2004). The splicesome identifies exons based on sequence elements at the introrilexon junction as well as enhancer and silencer elements in the adjoining exons and introns (Cartegni et al., 2002 and Black, 2003). ESEs were recognized by members of the splicing regulatory protein family, SRp40, that then attract splicing machinery. Within the past few years, algorithms have been developed that predict ESEs within a given RNA sequence (Cartegni et al., 2002; Liu et al., 2000; Liu et al., 1998 and Fairbrother et al., 2002). Recently, ESE alterations have been linked with altered splicing efficiency and disease.

It was observed that an exon 12 CIT SNP, rs688 was modulating two putative SRp40 binding sites, i.e. one ESE site is altered from the major allele TGTCAAC to the minor allele TGTCAAT (underline denotes SNP); this alteration decreases the SRp40 affinity score from 3.04 to 1.50, well below the SRp40 binding threshold of 2.67. An overlapping putative SRp40 binding site is altered from TCAACGG to the minor allele TCAATGG, and is predicted to maintain SRp40 binding. Since an LDLR isoform lacking exon 12 has been reported (Tveten et al., 2006), we interpreted these results as suggesting the rs688 and rs5925 may modulate the splicing efficiency of exon 12 and exon 13 of LDLR gene.

Since loss of a single LDLR allele cause as approximate doubling of LDL-cholesterol (Pullinger et al., 2003 and Hobbs et al., 1992), we hypothesized that these rs688 and rs5925 effects on splicing efficiency may be sufficient for rs688 and rs5925 to be associated with increased total and LDL-cholesterol.

All index patients were also screened for possible rare mutations in APOB gene. For APOB, codons 3431-3584 (in exon 26) and 4310-4396 (in exon 29) were amplified using set of primers (Table 3) and sequenced. In our study group, mutations as well as polymorphisms were not detected in the APOB gene.

Table 1. The oligonucleotide primers of 18 exons of LDLR gene

Primer###Forward primer sequence###Reverse primer sequence

LDLR-1###ACAAATCAAGTCGCCTGCCCT###GGAGACTTGTGGGGTAATGGC

LDLR-2###TCCCATACCCCAGAGAGTCCATAT###CTTTTTGATGATGGCGGCT

LDLR-3###GTGACGGAGTCTCACTCTGCCAC###AAGCCTCTTCCGCCCTTCAAA

LDLR-4###ATGAGGAAACTGAGGCACCGAGAG###GGACATGCAGTGATTTAGGTGCCGAA

LDLR-5###TTGGAACCACAGGCTGTACC###CTGGCCATCTGGTTTTCC

LDLR-6###CCGTGCCCGACGCGTTTTCTT###GGTTTTGGGAACTCCACTCTGC

LDLR-7###GAGTGACCAGTCTGCATCCC###CTGGGCCCCCTCTGCGCTTC

LDLR-8###GGATGACACCTGGCTGTTTCC###CACAGACTCATATCCCCTGACCG

LDLR-9,10###GGTCTTTTCCACCCTCTTTTTC###GGAGCTTCAGGAACTGGTTA

LDLR-11,12###GCCACATTTGGAGTTTGGGGTTCCCA###AGCCAAGATGAACGCAGAAAA

LDLR-13,14###CTAGTTGTGGAGAGA###AGTCGGGATAACCATACTTTC

LDLR-15###CCAAGGTCATTTGAGACTTTCGTC###CACTCCCTTGCTGACCTTCTCTC

LDLR-16###GTCCTCTGCCTGCTCCATTTCTTG###GCTAAGGGGTCAGATGGAGGAT

LDLR-17###GAGCT000TCTCTGUTCTCG###AGGRGAATGCTTCTUTGCGC

LDLR-18###GAGCGGTGGGAAGTGACTGAAT###ACACAACAGCAGATGGCACCA

Table 2. SNP characteristics including SNP identification system, localization, allele frequencies and nucleotide exchange

Gene###SNP Id.###Location###Allele frequency###Nucleotide exchange

LDLR###rs688###Exon 12###0.36###C/T

LDLR###rs5925###Exon 13###0.48###C/T

Table 3. The oligonucleotide primers of APOB gene

Primer###Forward primer sequence###Reverse primer sequence

APOB-26###GGAAACTGAGGCACCGAGAG###ACATGCAGTGATTTAGGTGCCGAA

APOB-29###TTGGAACCACAGGCTGTACC###ATCTCTGGCCATCTGGTTTTCC

DISCUSSION

Hypercholesterolemia is a widespread problem and a big challenge for healthcare professionals these days. Pakistan should have about 10,000 cases of this disease and more is still under-diagnosed. This is being the first representation of Pakistani data on Familial hypercholesterolemia. We established a study to screen out the incidence, prevalence and genetic basis of FH in Pakistan. We have collected samples from different hospitals, clinics and pathology labs of Karachi and Islamabad. We have investigated the genetic defect and found sequence polymorphism in the LDL receptor gene.

Single nucleotide polymorphisms (SNPs) were found in our population but unfortunately we failed to detect any mutation in LDLR and APOB gene. During various studies in which mutations were investigated in the LDL receptor (LDLR) gene or apolipoprotein B (APOB) gene showed that mutations in both these genes could not be detected in up to 15% of any group of definite heterozygous FH in patients in the UK (Isabella et al., 2007). The Portuguese FH study showed that it was not possible to identify a mutation in about 50% of the clinical FH patient studied (Bourbon et al., 2008). In the patients with an unidentified mutation it could be suggested that some defects in the LDL receptor gene remain undetected or that other genes may be involved (Isabella et al., 2007 and Bourbon et al., 2008).

Our findings show that SNPs, rs688 and rs5925 are associated with significant differences in LDLR splicing efficiency. These are the functional SNPs associated with increased total and LDL-cholesterol. Considered together, these findings provide mutually supporting evidence for the overall hypothesis that rs688 and rs5925 altered LDLR splicing efficiency, and thereby, cholesterol homeostasis in patients. Although LDLR mutations have been recognized as causing hypercholesterolemia, a common functional LDLR SNPs have been detected. As such, these results provide insight into the genetic basis of cholesterol homeostasis and may lead to insight in cholesterol-associated diseases.

As a common SNP within a well-studied gene, rs688 has been evaluated in prior association studies. Initially it was discovered by Leitersdorf and Hobbs (Leitersdorf et al., 1988) in 1988, this SNP has been referred to as C1773T or as the Hinc II LDLR restriction fragment length polymorphism. Rs688 is a common SNP within European

Caucasian, with minor allele carriers, i.e. CIT or TIT individuals 60-65% of the population (dbSNP, build 126). The frequency of rs688 carriers in other races varies from 0-17% in African population to 17-34% in different Asian populations (dbSNP, build 126). In prior reports, rs688 or tightly linked SNP like rs5925, which is 3279 bp away in exon 13, have been inconsistently associated with increased LDL-cholesterol. In an Alberta Hutterite population, rs688 was associated with increased LDLcholesterol in a gender-independent fashion (Boright et al., 1998). SNP, rs688 was also associated with increased LDL-cholesterol in a normotensive Japanese population, and with hypertension in Japanese (Fu et al., 2001). However, rs5925 was not associated with increased cholesterol in others (Boright et al., 1998; Knoblauch et al. 2002 and Knoblauch et al. 2004), which may reflect differences in age and gender of the study population.

The identification of rs688 as a functional SNP will hopefully encourage direct evaluation of the SNP in additional populations.

The clinical characteristics of Pakistani FH patients were compared with other Asian FH patients to determine phenotypic similarities. India is a neighboring country with shared ancestors and culture and the geographical and geological conditions are quite similar. The total mean cholesterol in the Asian-Indian population is significantly higher than in the Pakistanis, which is 7.8 mmolll versus 6.3 mmol/l (Soutar et al., 1991). The cholesterol level of FH patients in China, another close neighboring country, are very much similar to the ones found in western countries (Sun et al., 1994). The Pakistani patients were also compared to a group of English FH patients and significant difference observed with tendon xanthomas and higher level of total cholesterol in English FH patients (Isabella et al., 2007).

The comparison of the clinical character of Pakistani patients with patients from other countries may provide some insight about the underlying reason for the different severity of the phenotypes presented by FH patients.

Surprisingly, we did not observed xanthomas in our patients; either tendon xanthomas are not being well diagnosed in Pakistan or Pakistani FH patients are less susceptible to the development of tendon xanthomas for some environmental reasons.

In summary, the synonymous LDLR coding SNPs, rs688 and rs5925 are functional LDLR SNPs that modulates LDLR exon splicing efficiency. Overall, we anticipate these studies may prove useful to understanding the genetic aspects of cholesterol homeostasis and associated diseases, and as a model approach for evaluating genetic polymorphisms that modulate splicing efficiency.

REFERENCES

Anderson, RG., Goldstein J., and Brown, M. (2003). From cholesterol homeostasis to new paradigms in membrane biology. Trends Cell. Biol., 13, 534-539.

Black, D.L. (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem., 72, 291336.

Boright, A.P., Connelly, P.W., Brunt, J.H., Morgan, K. and Hegele, R.A.(1998) Association and linkage of LDLR gene variation with variation in plasma low density lipoprotein cholesterol. J. Hum. Genet., 43, 153-159.

Bourbon, M., Alves, AC., Medeiros, AM., Silva, S. and Soutar, AK. (2008). Familial hypercholesterolemia in Portugal. Atherosclerosis. 196 (2): 633-42.

Cartegni, L. and Kramer, A.R. (2002) Disruption of an SF2/ASF-dependent exonic splicing enhancer in SMN2 causes spinal muscular atrophy in the absence of SMN 1. Nat. Genet., 30, 377-384.

Fairbrother, W.G., Yeh, R.F., Sharp, P.A. and Burge, C.B. (2002) Predictive identification of exonic splicing enhancers in human genes. Science, 297, 1007-1013.

Friedewald, WT., Levy, RI., Fredrickson, DS. (1972). Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem, 18:499-502.

Fu, Y., Katsuya, T., Higaki, J., Asai, T., Fukuda, M., Takiuchi, S., Hatanaka, Y., Rakugi, H. and Ogihara, T. (2001) A common mutation of low-density lipoprotein receptor gene is associated with essential hypertension among Japanese. J. Hum. Hypertens., 15, 125-130.

Goldstein, J., Hobbs, H. and Brown, M. (2001). Familial hypercholesterolemia. In: Valle D, Scriver CR, Beaudet A, Sly WS, Childs B, Kinzler KW, Volgestein B, editors. The metabolic and molecular bases of inherited disease. New York: McGraw Hills; p. 2863-913.

Hobbs, H.H., Brown, M.S. and Goldstein, J.L. (1992) Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hum. Mutat., 1, 445-466.

Isabella, T., Paola, TL., Neuwirth, C., Naoumova, RP. and Soutar, AK. (2007). Genetic defects causing familial hypercholesterolemia: Identification of deletions and duplications in the LDL receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Atherosclerosis. 194: 102-111.

Knight, BL., Gavigan, SJP., Soutar, AK. and Patel, DD. (1989). Defective processing and binding of low density lipoprotein receptor in fibroblast form a familial hypercholesterolemia subject. Eur. J. Biochem. 179: 693698.

Knoblauch, H., Bauerfeind, A., Krahenbuhl, C., Daury, A., Rohde, K., Benjamin, S., Essioux, L., Schuster, H., Luft, F.C. and Reich, J.G. (2002) Common haplotypes in five genes influence genetic variance of LDL and HDL cholesterol in the general population. Hum. Mol. Genet., 11,1477-1485.

Knoblauch, H., Bauerfeind, A., Toliat, M.R., Becker, C., Luganskaja, T., Gunther, U.P., Rohde, K., Schuster, H., Junghans, C., Luft, F.C. (2004) Haplotypes and SNPs in 13 lipid-relevant genes explain most of the genetic variance in high-density lipoprotein and low-density lipoprotein cholesterol. Hum. Mol. Genet., 13, 993-1004.

Leitersdorf, E. and Hobbs, H.H. (1988) Human LDL receptor gene: Hincil polymorphism detected by gene amplification. Nucleic Acids Res., 16, 7215.

Liu, H.X., Chew, S.L., Cartegni, L., Zhang, M.Q. and Kramer, A.R.(2000) Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mo!. Cell. Biol., 20, 1063-1071.

Liu, H.X., Zhang, M. and Kramer, A.R. (1998) Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes. Dev., 12,1998-2012.

Pfarr, N., Prawitt, D., Kirschfink, M., Schroff, C., Knuf, M., Habermehi, P., Mannhardt, W., Zepp, F., Fairbrother, W., and Loos, M..(2005) Linking C5 deficiency to an exonic splicing enhancer mutation.J. Immunol., 174, 4172-4177.

Pullinger, C.R., Kane, J.P. and Malloy, M.J. (2003) Primary hypercholesterolemia: genetic causes and treatment of five monogenic disorders. Expert Rev. Cardiovasc. Ther., 11 107-119.

Scientific steering Committee on behalf of the Simon Broome Register Group. 1991. Risk of fatal coronary heart disease in familial hypercholesterolemia. BMJ. 303: 893-6.

Soutar, AK., McCarthy, SN., Seed M. and Knight, BL. (1991). Relationship between Apolipoprotein (a) phenotype, Lipoprotein (a) concentration in plasma and low density lipoprotein receptor function in a large kindred with familial hypercholesterolemia due to pro664-+leu mutation in the LDL receptor gene. J. Clin. Invest. 88: 483-492.

Steiner, B., Truninger, K., Sanz, J., Schaller, A. and Gallati, S. (2004) The role of common single-nucleotide polymorphisms on exon 9 and exon 12 skipping in nonmutated CFTR alleles. Hum. Mutat., 24, 120-129.

Sun, XM., Patel, DD, Webb, JC., Knight, BL., Fan, LM., HJ Cai, HJ., and AK Soutar, AK., (1994). Familial hypercholesterolemia in China. Identification of mutations in the LDL receptor gene that results in a receptor-negative phenotype. Arterioscler. Thromb. 14: 85-94.

Tveten, K., Ranheim, T., Berge, K.E., Leren, T.P. and Kulseth, M.A. (2006) Analysis of alternatively spliced isoforms of human LDL receptor mRNA. Clin. Chim. Acta., 373, 151-157.

Zatkova, A., Messiaen, L., Vandenbroucke, I., Wieser, R., Fonatsch, C., Kramer, A.R. and Wimnier, K. (2004) Disruption of exonic splicing enhancer elements is the principal cause of exon skipping associated with seven nonsense or missense alleles of NFl. Hum. Mutat., 24, 491-501.

Sobia Rafiq, Nuzhat Ahmed, Anne Soutar and Raheel Qamar 'Centre for Molecular Genetics, University of Karachi, Karachi, Pakistan lmperial College London, UK COMSATS Institute of Information Technology, Islamabad, Pakistan Corresponding author: E-mail: sobiarafiq@gmail.com
COPYRIGHT 2011 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Basic & Applied Sciences
Article Type:Report
Geographic Code:9PAKI
Date:Jun 30, 2011
Words:2725
Previous Article:ELECTROCOAGULATION FOR THE TREATMENT OF WASTEWATER FOR REUSE IN IRRIGATION AND PLANTATION.
Next Article:EXACT SOLUTIONS OF A SECOND-GRADE FLUID VIA INVERSE METHOD.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters