Printer Friendly

Systematics of North Pacific sand lances of the genus Ammodytes based on molecular and morphological evidence, with the description of a new species from Japan.

Abstract--The systematic status of North Pacific sand lances (genus Ammodytes) was assessed from mitochondrial DNA (cytochrome oxidase c subunit 1) sequence data and morphological data to identify the number of species in the North Pacific Ocean and its fringing seas. Although only 2 species, Ammodytes hexapterus and A. personatus, have been considered valid in the region, haplotype networks and trees constructed with maximum parsimony and genetic distance (neighbor-joining) methods revealed 4 highly divergent monophyletic clades that clearly represent 4 species of Ammodytes in the North Pacific region. On the basis of our material and comparisons with sequence data reported in online databases, A. personatus is found throughout the eastern North Pacific Ocean, Gulf of Alaska, Aleutian Islands, and the eastern Bering Sea where it co-occurs with a northwestern Arctic species, A. hexapterus, that is found throughout the North American Arctic from Hudson Bay, Canada, in the east, through the Beaufort and Chukchi seas, into the northern and western Bering Sea, and to the southern Sea of Okhotsk in the Soya Strait off Hokkaido, Japan. Two other species reside in waters around Japan: A. japonicus throughout the Sea of Japan and the Seto Inland Sea and a new species in the Sea of Japan and the North Pacific Ocean off northern Honshu. We designate neotypes for A. hexapterus and A. personatus because of the absence of type material and the close similarity of these 2 species. Ammodytes aleutensis is a junior synonym of A. japonicus, and A. alascanus is a junior synonym of A. personatus.

**********

Sand lances of the genus Ammodytes (family Ammodytidae) are small silvery fishes that inhabit marine and adjacent brackish waters of the Northern Hemisphere. They reside primarily over sandy substrates, where they are able to quickly bury themselves to avoid predators, but are found also over bedrock, eelgrass, and kelp. Species of Ammodytes are cornerstone prey items for more than 100 species of marine mammals, birds, and other fishes in the region of the North Pacific Ocean (Field, 1988; Willson et al. (1)). Despite their tremendous importance in ecosystems and as targets in fisheries off Japan (Hamada, 1985; Han et al., 2012) and in the North Sea (Sherman et al., 1981; Furness, 2002), little is known about their distribution or life history.

The family Ammodytidae comprises about 31 species in 7 genera and 2 subfamilies found in the Arctic, Atlantic, Indian, and Pacific oceans (Nelson, 2006; Randall and Heemstra, 2008; Shibukawa and Ida, 2013; Randall and Ida, 2014). Placed within the subfamily Ammodytinae, which also includes the genera Gymnammodytes and Hyperoplus, Ammodytes is diagnosed by the presence of scales deeply embedded in dermal plicae below the lateral line, a highly protrusible upper jaw (Pietsch, 1984), and non-expanded neural and haemal spines on the caudal vertebrae (Ida et al., 1994). Six species currently are recognized in the genus Ammodytes: 2 in the eastern North Atlantic Ocean (A. tobianus Linnaeus, 1758, and A. marinus Raitt, 1934), 2 in the western North Atlantic Ocean (A. americanus DeKay, 1842, and A. dubius Reinhardt, 1837), and 2 in the North Pacific Ocean (A. hexapterus Pallas, 1814, and A. personatus Girard, 1856). All are very similar morphologically, having an elongate body up to 280 mm in total length, scales aligned in dermal plicae for the length of the body, long dorsal and anal fins, and no pelvic fins. Species generally are distinguished by meristic characters and relative body depth. We focus primarily on the sand lances of the North Pacific Ocean and adjacent seas for the purpose of clarifying their systematic status.

The first species recognized in this genus was collected from Sweden to the Mediterranean and described by Linnaeus (1758) as A. tobianus. Of 2 other names published in this genus in the early 1800s, A. alliciens Lacepede, 1800, was designated an unneeded replacement name for A. tobianus, and A. cicerelus Rafinesque, 1810, was allocated to Gymnammodytes as a valid species (Eschmeyer, 2013). In the North Pacific region, the first species described was A. hexapterus, from material collected or observed from off the Kamchatka Peninsula and Kuril Islands in Russia, the islands "between Asia and North America," and the coast of North America (Pallas, 1814; Lindberg, 1937). Pallas (1814) compared it with the Atlantic species A. tobianus as described by Artedi (1738; Walbaum 1792), noting that A. hexapterus had more numerous vertebrae.

In his work on fishes collected during the Pacific railroad surveys of the early 1800s, Girard (1856) described A. personatus from Cape Flattery, Washington. In 1873, Cope described A. alascanus from Sitka, Alaska, without comparing it with previously described species. Jordan (1906) referred all Ammodytes of the North Pacific region to Ammodytes personatus, including populations from Alaska to Monterey, California, and from Siberia to the Inland Sea of Japan. He made no comments on A. hexapterus and was uncertain about the status of A. alascanus, as well as of the northernmost populations of Ammodytes, suggesting that they may be referable to a circumboreal A. tobianus. Lindberg (1937) recognized differences between Ammodytes off the coast of Japan and species from more northern areas, referring these populations in Japan to A. personatus, although much later he and Krasyukova (Lindberg and Krasyukova, 1975) synonymized all nominal North Pacific species of Ammodytes under A. hexapterus.

The last 2 species to be described from the North Pacific region were Ammodytes aleutensis and A. ja ponicus of Duncker and Mohr (1939). They recognized A. aleutensis to be widely distributed from Unalaska in the eastern Aleutian Islands to Hokkaido in northern Japan and Nagasaki in southern Japan and A. japonicus to be only from the type locality of Otaru (="Otaka"), Hokkaido, that also is included among the type localities of A. aleutensis. Duncker and Mohr (1939) distinguished A. japonicus from A. aleutensis on the basis of its fewer dorsal-fin rays and higher number of dermal plicae. In addition, they observed that, in their specimens of A. japonicus, the origin of the dorsal fin was farther posterior (posterior half versus middle of pectoral fin) and the ventrolateral fold was shorter (extending to mid-anal fin versus the posterior third of the anal fin and beyond). Although Andriashev (1954) noted the presence of significant variation among more southern forms and the need for additional taxonomic work, he recognized 2 species of Ammodytes across northern seas: A. tobianus in the Atlantic Ocean and A. hexapterus from the Barents Sea to the Baltic Sea. Within A. hexapterus, he recognized the subspecies A. hexapterus marinus from the Barents Sea to the Baltic Sea and A. hexapterus hexapterus in the North Pacific region.

The number of species of Ammodytes in waters off Japan has been in question for the last century. Ohshima (1950) examined the numbers of vertebrae in Ammodytes from 7 locations around Japan--in the Seto Inland Sea, southern and northern Japan on the Pacific Ocean side, the northern tip of Honshu, and the northcentral Kuril Islands--and found differences in vertebral numbers. Lindberg and Krasyukova (1975) noted confusion in use of the names A. hexapterus and A. personatus, as well as the uncertain status of A. aleutensis and A. japonicus, and proposed the synonymy of all northern Ammodytes within A. hexapterus, including those species in the western North Pacific region around Japan. Kitaguchi (1979) also examined meristic data and found that 2 species, which he identified as A. personatus and A. hexapterus, occurred together in the area around Wakkanai in the Soya Strait off northeastern Hokkaido. In their study of the life history characteristics of Ammodytes, Hashimoto and Kawasaki (1981) concluded that 2 populations were included in "A. personatus" collected from the Pacific Ocean coast of northern Japan (Tohoku district) on the basis of meristic and allozyme analyses. Later, Hashimoto (1984) expanded his study of meristics within Ammodytes, examining material from several localities around Japan, and concluded that 3 genetically independent but geographically overlapping subspecies were likely present around Japan.

No comprehensive genetic studies of sand lances of the North Pacific Ocean and surrounding seas have been conducted; however, several regional studies have been published. An allozyme study compared populations around Japan with one sample from Kodiak Island, Alaska, and described 3 non-interbreeding groups that were living sympatrically around Japan; none of these groups were genetically similar to the Kodiak population (Okamoto, 1989). In recent studies where the mitochondrial DNA (mtDNA) control region and 16s ribosomal RNA (rRNA) were examined (Kim et al., 2006) and where mtDNA cytochrome oxidase c subunit 1 (COI) was used to identify larvae, Kim et al. (2006, 2008, 2010) proposed that at least 2 species of sand lances were present in material from around Korea and Japan. Han et al. (2012) examined the population structure of Ammodytes in waters off Japan and determined that 2 lineages resulted from the past isolation of the Sea of Japan from neighboring seas--a separation that was facilitated by current flows and temperature barriers. Mecklenburg et al. (2011) used evidence from COI to suggest that 2 species were among specimens collected in Alaska: 1 species (A. hexapterus) in the Bering and Chukchi seas and 1 species in the Gulf of Alaska ("likely ... A. personatus"). Most recently, Turanov and Kartavtsev (2014) combined sequence data from 7 specimens collected in the Bering and Okhotsk seas with 34 samples taken from the online data source GenBank (www.ncbi.nlm.nih.gov) and concluded that 4 species are present in the North Pacific region.

Two names are now considered valid in the region of the North Pacific Ocean, with A. hexapterus applied to populations in the eastern North Pacific Ocean, Bering Sea, Chukchi Sea, Sea of Okhotsk, and Sea of Japan (Miller and Lea, 1972; Hart, 1973; Mecklenburg et al., 2002; Hatooka, 2013) and A. personatus recognized in the western North Pacific Ocean, southern Sea of Okhotsk, and Sea of Japan (e.g. Ida, 1984; Hatooka, 2000, 2002, 2013). As a result of this study, we revise the genus Ammodytes in the North Pacific region, on the basis of an examination of genetic variation at the COI gene and morphological variation in specimens collected throughout nearly the entire range of the genus in the North Pacific region: from California to Puget Sound, the Gulf of Alaska, the Bering and Chukchi seas, Sea of Okhotsk, Sea of Japan, Seto Inland Sea, and the Pacific coast of Japan.

Materials and methods

Whole samples of Ammodytes were obtained from archival collections and collected over the 13 years from 2000 to 2013, from the eastern and western coastlines of the North Pacific Ocean and its fringing seas from latitudes of 40[degrees]N to 70[degrees]N (Table 1; Fig. 1; Appdx. 1). Additional samples of Atlantic species were obtained from the eastern and western North Atlantic Ocean for comparison. Specimens with known preservation histories from archival collections had been fixed in 10% formalin and preserved in 70% ethanol or 45% isopropanol. For freshly collected specimens obtained for genetic analyses, tissues were fixed and preserved in 95% ethanol, and whole specimens were then fixed in 10% formalin and preserved in 70% ethanol. Institutional abbreviations are listed in Leviton et al. (1985).

Genetics

DNA was extracted and purified from more than 498 tissue samples with a Qiagen2 (Valencia, CA) DNeasy Blood & Tissue Kit. Primers were developed for the flanking regions of the COI gene of the mitochondrial DNA from a consensus of 21 DNA sequences obtained from GenBank (FJ666901-FJ666921). Primers used to sequence DNA were F: 5'CTCCTGCAGGGTCAAAGAAG and R: 5'GGCACCCTTTATCTAGTATT, resulting in a 638 base-pair (bp) fragment of the COI region. The fragment was amplified by polymerase chain reaction (PCR) in a 50-[micro]L reaction volume containing IX GoTaq Buffer (Promega Corp., Madison, WI), 2.5 mM Mg[Cl.sub.2], 0.2 mM of each dNTP, 0.2 pM each of forward and reverse primer, 1 unit of GoTaq, 10 ng DNA, and deionized water. Thermal cycling conditions were as follows: 95[degrees]C for 2 min; 30 cycles of 95[degrees]C for 40 s, 55[degrees]C for 40 s, and 72[degrees]C for 1 min; 72[degrees]C for 7 min; and 4[degrees]C indefinitely. Forward sequences were obtained from the PCR product by the Sanger sequencing method. Sequences were aligned and edited with the software program CodonCode Aligner, vers. 3.7.1 (CodonCode Corp., Dedham, MA). Ambiguous end regions, particularly on the 3' end of the sequences, were aggressively trimmed to 560 bp in length to achieve the maximum number of high-quality sequences.

The following genetic indices were calculated in Arlequin, vers. 3.5 (Excoffier and Lischer, 2010): number of haplotypes (H), number of polymorphic sites (S), haplotype diversity (h), and average nucleotide diversity (ji). For the purpose of examining phylogenetic relationships within the genus Ammodytes, the data were supplemented with 15 samples representing 4 species of Ammodytes from the Atlantic Ocean and a DNA sequence from Uranoscopus oligolepis from GenBank (FJ237962) to use as an out-group for phylogenetic analysis.

The number of nucleotide differences between sequences was visually represented by a haplotype network (minimum spanning tree) created with the program Sneato, vers. 2 (Wooding, 2004; http://user.xmission.com/~wooding/Sneato/). Phylogenetic relationships among unique mtDNA haplotypes were evaluated with the program MEGA 6 (Tamura et al., 2013), wherein trees were constructed with maximum parsimony (MP) (Nei and Kumar, 2000), maximum likelihood (ML) (Tamura and Nei, 1993), and neighbor-joining (NJ) methods (Saitou and Nei, 1987; by using the distance algorithm of Tamura and Nei, 1993). Support for nodes of the 3 trees was evaluated with 1000 bootstrap replicates (Felsenstein, 1985). Branches with >95% bootstrap support were collapsed into consensus sequences, which were used to create summary trees.

Analyses of the number of substitutions per site between all unique sequences were examined with the Tamura-Nei model (1993) and included mean divergence and range of divergence between each species pair, as well as ranges of divergence within each species. Because divergences between the sequences were large, all sequences, including those of the Atlantic specimens and the Uranoscopus sequence, were analyzed for substitution saturation of the mitochondrial COI sequence by using Xia's method (Xia et al., 2003) in DAMBE, vers. 5.3.109 (Xia, 2013).

Morphology

Counts of median-fin rays and internal features were taken from radiographs; other counts were taken from the left side and supplemented with right-side counts when the left side was damaged. Counts of dorsal-fin rays were made according to the method of Nizinski et al. (1990) and began with the first visible ray and excluded the 1 or 2 anterior rayless pterygiophores, and these counts included the last 2 rays that were each supported by a pterygiophore. Counts of anal-fin rays included all visible rays, the last 2 rays each supported by a pterygiophore. Anterior anal-fin pterygiophores were anterior to the first pterygiophore supported by the first haemal spine and did not include the anteriormost 1 or 2 rayless pterygiophores. Pectoral-fin ray counts did not include the rudimentary ventralmost ray. Pigmented pectoral-fin rays were the dorsalmost rays with evident melanophores and, because pigment appears consistently with development, counts of these rays are presented for specimens larger than 100 mm in standard length (SL) only. Gill rakers of the lower arch included the raker at the junction between upper and lower parts of the arch. Dermal plicae included those anterior and posterior to the lateral-line pores. When these plicae were incomplete or not aligned in parallel rows, counts were supplemented from the right side. The first caudal vertebra was defined as the first centrum with a long haemal spine, and the centrum fused to the hypural plate was counted as the last vertebra.

Unless indicated otherwise, SL was used throughout this study, always measured from the tip of the snout. Measurements were taken according to the methods of Hubbs and Lagler (1958), with these additions: the length of the prepectoral process (a flap-like axillary process at the dorsal base of the pectoral fin) was measured from the dorsal base of the pectoral fin to the tip of the process, and prepectoral length was measured from the same point on the pectoral-fin base to the snout tip. Measurements and counts are presented in species descriptions as the range for all material examined, followed by the value for the holotype, lectotype, or neotype in parentheses, when intraspecific variation is indicated. Statistical analyses were performed with Statgraphics Centurion XV, vers. 15.2 (StatPoint Tech nologies Inc., Warrenton, VA), Spotfire S+ 8.2 (TIBCO Software Inc., Palo Alto, CA), and SPSS 11.5.1 (IBM, Armonk, NY). Using the Bonferroni method to adjust for multiple comparisons, we considered differences significant at P<0.05.

More than 600 specimens were examined morphologically for meristic and morphometric data or for meristic data only. For all specimens identified genetically or by geographic range, meristic frequency distributions are presented. A reduced data set of 214 genetically identified specimens that had a complete suite of meristic and morphometric character data was used to conduct both univariate and multivariate analyses. Arcsine-transformed morphometric ratios (with SL as denominator) were tested to meet the assumptions of normality and equality of variance required for analysis of covariance (ANCOVA). A Kruskal-Wallis nonparametric test was used to test for differences in all characters with heterogenetic variances. Differences were considered significant at P<0.001. A stepwise discriminant function analysis was conducted with morphometric and meristic data to establish the relative significance of characters in distinguishing the species and to identify specimens preserved in formalin without tissues available for genetic identification. Morphometric data were standardized by dividing values by SL. The robustness of the discriminant function analysis was tested with a leave-one-out cross-validation procedure conducted in SPSS 11.5.1. Allometry was evaluated by plotting each measurement divided by head length (HL) against SL.

Results

Genetics

In the 560-bp COI sequences, 152 haplotypes were identified at 176 polymorphic sites, with no insertions or deletions. Seven monophyletic clades emerged from the sequence analysis of Pacific and Atlantic specimens. Each clade included many singleton haplotypes and up to 4-bp differences radiating from a common haplotype (Fig. 2).

Four clades within the North Pacific region were represented in the haplotype network of Ammodytes (Fig. 2). We refer to these clades as A. personatus (range: throughout the eastern North Pacific Ocean from California to the Aleutian Islands and the southeastern Bering Sea), A. hexapterus (range: Chukchi Sea, northern and western Bering Sea, and Sea of Okhotsk), A. japonicus (range: Sea of Japan and Seto Inland Sea), and a new species (range: Pacific Ocean side of northern Japan and Soya Strait) (Fig. 1). Only 3 clades of Atlantic species emerged from the analyses; specimens identified morphologically as A. dubius or A. americanus as defined by Nizinski et al. (1990) were homogenous at the COI gene (as also noted by McCusker et al., 2013). Ammodytes marinus was closely related to A. hexapterus, differing by up to 10 bp. At 8 of these sites, however, A. marinus appeared to be heteroplastic or otherwise ambiguous. These results indicate that further investigation of Ammodytes of the North Atlantic Ocean is warranted.

Differentiation between clades within the North Pacific region ranged from 15 to 32 nucleotide polymorphisms. Ammodytes personatus differed from A. hexapterus by a minimum of 2.7% (15 of 560 bp), from A. japonicus by 5.7%, and from the new species by 4.3%. Percent divergence between A. hexapterus and A. japonicus was 6.4% and between A. hexapterus and the new species, 4.8%. The percent divergence between the 2 species in Japan, A. japonicus and the new species, was 6.4%. Sequence divergences, corrected for saturation, between each species pair were similar and are reported in Table 2. The index of substitution saturation was significantly below both the symmetrical and asymmetrical critical values (P=0.000) for all tests, indicating little evidence for substitution saturation within the COI DNA sequences among Ammodytes or between out-groups.

In all genetic analyses, 4 monophyletic and highly divergent groupings among Pacific specimens were observed, representing 4 distinct species in the region of the North Pacific Ocean. Bootstrap support of the phylogenetic results was high (95-99%) for all species clades (Fig. 3). Summaries of the variation in the groupings within the phylogenetic trees, by method, are represented by trees of consensus sequences of each highly supported species clade (Fig. 4). These phylogenetic resolutions differed only in the position of A. personatus as sister of the A. dubius and A. americanus clade or sister of the A. hexapterus and A. marinus clade. The low bootstrap values indicate that neither of these resolutions is well supported by these data. Intraspecific variation differed within the 4 clades (Table 3). The 2 clades representing A. japonicus and the new species displayed the highest levels of gene diversity (0.50 and 0.53), followed by a high level of diversity within A. personatus (0.31), which exhibited 3 secondary nodes of haplotypes. Specimens within these secondary branches were not geographically related (Fig. 3). Ammodytes hexapterus was nearly monomorphic, with a low level of genetic diversity (0.04): only 6 single transitions were detected in 143 individuals.

All COI sequences reported in GenBank and the Barcode of Life Database (BOLD) for Ammodytes of the North Pacific region were aligned in CodonCode Aligner. Each sequence clearly corresponded with 1 of the 4 species described in this article (Table 4).

Morphology

Meristic characters Among meristic characters of specimens identified genetically and with a complete suite of morphological characters, only counts of total gill rakers, lateral-line pores, dermal plicae, and pectoralfin rays met variance assumptions necessary to conduct an ANCOVA (Table 5). Counts of gill rakers differed between A. japonicus, A. hexapterus, and A. personatus; counts in the new species and A. personatus did not differ significantly from each other, but each had significantly higher counts than either A. japonicus or A. hexapterus. Counts of lateral-line pores differed significantly among all species: A. personatus had the lowest counts, followed by A. hexapterus, A. japonicus, and the new species with higher counts. Pectoral-fin rays differed significantly only in the new species, which had significantly higher counts than all other species. All other meristic characters violated the equality of variance assumption required for ANOVA and were tested by using the nonparametric Kruskal-Wallis test. With the exception of gill rakers of the lower arch and caudal-fin rays, all characters were significantly different between 2 or more species (Table 5). Importantly, the new species exhibited higher counts of anal-fin rays and anterior anal-fin pterygiophores. Meristic character frequencies are presented in Tables 6-8.

Morphometric characters Among morphometric characters of specimens identified genetically and with a complete suite of morphological characters, only caudal peduncle depth, caudal peduncle length, preanal length, and anal-fin base length met variance assumptions necessary to conduct an ANCOVA (Table 5). The caudal peduncle was significantly deeper in A. personatus than in A. hexapterus and the new species (which were not significantly different from each other), as well as in A. japonicus, in which this character was significantly more slender than it was in all other species. The caudal peduncle was also longer in A. hexapterus and A. personatus (which were not significantly different from each other) than in the new species and A. japonicus, in which it was shorter than it was in all other species. The preanal length was significantly longer in A. personatus and was significantly shorter in the new species than in all other species. The anal-fin base was significantly longer in A. japonicus, followed by the new species, A. hexapterus, and A. personatus. Other characters were tested with the Kruskal-Wallis test and, with the exception of gill raker length, all differed significantly between 2 or more species (Table 5). Most significantly, the new species had a smaller orbit, wider interorbital space, and longer prepectoral process than all other species, and A. personatus had a shorter preanal length than all other species (Table 5). All species exhibited ontogenetic allometry in orbit size and pectoral-fin length: the orbit was proportionately longer and deeper and the pectoral fin was longer in smaller individuals. In A. japonicus alone, gill rakers were proportionally longer in smaller individuals.

Discriminant function analysis All 3 discriminant functions obtained in this analysis were significant (Wilks's lambda; P<0.0001). All specimens of the 2 species of Ammodytes of the eastern and northern parts of the North Pacific Ocean (A. personatus and A. hexapterus) were distinguished from specimens of the 2 species of Ammodytes found only in waters off Japan (A. japonicus and the new species) on the first discriminant axis (Fig. 5). Scores were calculated from the following first discriminant function equation:

[D.sub.1] = -0.991 (od) - 0.413 (iow) + 0.465 (pb) + 0.379 (pl) + 0.914 (cpvl) + 0.048 (pdl) + 0.423 (ppl) + 0.230 (gr) - 0.192 (llp) + 0.146 (dp) - 0.270 (ap) + 0.875 (pcv) + 0.445 (cv) - 62.266,

where D1=the first discriminant score of an individual; od=orbit depth divided by HL; iou)=interorbital width divided by HL; pfi=pectoral-fin base depth divided by HL; pZ=pectoral fin length divided by HL; cpuZ=caudal peduncle ventral length divided by HL; p<iZ=predorsal length divided by HL; ppZ=prepectoral length divided by HL; gr=the number of gill rakers on the entire gill arch; llp=ihe number of lateral-line pores; dp=the number of dermal plicae; ap=the number of anal-fin pterygiophores anterior to the first haemal spine; pco=the number of precaudal vertebrae; and cu=the number of caudal vertebrae.

A specimen with a score above 0 was identified as an individual of an eastern or northern Pacific species (either A. personatus or A. hexapterus)', scores below 0 indicated the specimen was a species of Japan (either A. japonicus or the new species).

On the second discriminant axis, all but 3 specimens of A. japonicus and the new species were distinguished from each other (95.0%; Fig. 5). Three specimens identified genetically as A. japonicus were misclassified as the new species (Fig. 5). Among individuals identified as A. personatus or A. hexapterus, 98.6% were distinguished from each other, the exceptions being a specimen genetically identified as A. personatus and misclassified as A. hexapterus and 2 specimens genetically identified as A. hexapterus but misclassified as A. personatus. Scores on the second discriminant axis were calculated with the second discriminant function equation:

[D.sub.2] = -0.334 (od) - 0.578 (iow) - 2.674 (pb) + 0.818 (pl) + 0.958 (cpvl) + 0.446 (pdl) - 0.765 (ppl) + 0.031 (gr) + 0.027 (lip) - 0.007 (dp) - 0.675 (ap) - 0.265 (pcv) + 0.170 (cv) - 2.458,

where D2=the first discriminant score of an individual; oc?=orbit depth divided by HL; iom=interorbital width divided by HL; p6=pectoral-fin base depth divided by HL; p/=pectoral fin length divided by HL; cpuZ=caudal peduncle ventral length divided by HL; pdl=predorsal length divided by HL; ppZ=prepectoral length divided by HL; gr=the number of gill rakers on the entire gill arch; llp=the number of lateral-line pores; dp=the number of dermal plicae; ap=the number of anal-fin pterygiophores anterior to the first haemal spine; pcv=the number of precaudal vertebrae; and cv=the number of caudal vertebrae.

Most specimens with a score above 0 were identified as either A. hexapterus or A. japonicus', scores below 0 identified most specimens as either A. personatus or the new species.

The cross-validation procedure correctly classified 95.3% of the specimens. Of 76 specimens of A. japonicus and the new species, 3 specimens of A. japonicus were misidentified as the new species. Of 136 specimens of A. hexapterus or A. personatus, 4 specimens of A. hexapterus were misidentified as A. personatus.

Systematics

Ammodytes Linnaeus, 1758

Ammodytes (Artedi) Linnaeus, 1758:247 (type A. tobianus Linnaeus).

Argyrotaenia Gill, 1861:40 (type A. vittatus DeKay, 1842).

Diagnosis

Body elongate, covered with small cycloid scales situated at right angles along oblique dermal plicae below lateral line. Lateral line incomplete, straight, unbranched, 3-4 scale rows below the dorsal-fin base. Ventrolateral dermal fold extends from isthmus along edge of belly and above anal fin. Median ventral fold present, extending from isthmus to vent. Premaxilla protractile, with well-developed ascending process. Anterior ends of maxillae not broadened and not touching each other but connected by tendon. Teeth absent. Dorsal fin long, origin anterior to posterior tip of pectoral fin, anterior 1-3 pterygiophores inserted between neural spines 6-7, 7-8, 8-9, or 9-10. Pectoral fin pointed, rays 6-7 longest, rays 3-10 bifurcate, other rays simple. Pelvic fins absent. Vertebrae 59-78.

Description

Body elongate, slender, depth about 10-15 times into SL. Body anterior to vent longer than posterior portion, distance from snout to anal-fin origin about 60-70% SL. Head elongate, with long pointed snout. Mouth large, superior: upper jaw protractile, with elaborate cartilages supporting premaxilla (Pietsch, 1984); lower jaw projecting, mandible with strong and sharp symphyseal process. Orbit moderately large, length 5 to 6 times into HL. Gill membranes separate, free from isthmus. Gill rakers long and slender, 20-31 on first arch.

Body covered with small cycloid scales: scales below lateral line situated along 106-198 oblique dermal plicae, fading to scale rows on caudal peduncle, scales above lateral line 3-4, and scales on belly between median ridge and ventrolateral fold 3-4. Head naked. Lateral line straight, unbranched, incomplete, extending from above operculum to posterior portion of anal fin. Pored lateral line scales 106-185.

Dorsal-fin rays 49-69, simple except for few posterior-most. Dorsal fin long, with origin anterior to tip of pectoral fin. Anal-fin rays 24-36, simple except for few posterior-most. Anal fin about half the length of dorsal fin, with origin at 66% of body. Pectoral-fin rays 11-17, rays 7-9 longest. Pelvic fins absent. Caudal fin forked. Total vertebrae 59-78, precaudal vertebrae 33-49, caudal vertebrae 21-28.

Ammodytes hexapterus Pallas, 1814 Arctic sand lance [Japanese name: Kita-ikanago] Figures 6A and 7A; Tables 5-7

Ammodytes hexapterus Pallas, 1814:226 (original description; types lost; circumboreal, Kamchatka, Kuril and Aleutian islands, American coast, Baltic Sea).

Ammodytes tobianus personatus Popov, 1931:145 (Nagaeva Bay, northern Sea of Okhotsk).

Ammodytes hexapterus hexapterus Lindberg, 1937:87 (Commander Islands, Avachinskaya Bay, Ayan Bay, Shantar Islands, Terpenia Bay, Gulf of Tartary).

Neotype

UAM 2813, 126.5 mm, Russia, Chukchi Sea, 67.4093[degrees]N, 173.5757[degrees]W, RUSALCA 2012, station CLIO, PSBT, haul 16, 13 September 2012 (GenBank Accession KJ137280), herein designated.

Diagnosis

A species of Ammodytes distinguished from A. japonicus by significantly more total vertebrae (65-72 vs. 59-66) and precaudal vertebrae (40-47 vs. 36-43), fewer pored lateral-line scales (121-152 vs. 132-163) and dermal plicae (143-172 vs. 144-182), more dorsal-fin rays (56-63 vs. 50-60), and fewer pigmented pectoralfin rays (2-6 vs. 4-11). It is further distinguished from the new species by its significantly larger orbit (12-21% HL vs. 11-15% HL), more total vertebrae (65-72 vs. 63-67) and precaudal vertebrae (40-47 vs. 39-43), fewer pored lateral line scales (121-152 vs. 142-185) and dermal plicae (143-172 vs. 156-198), and fewer pigmented pectoral fin rays (2-6 vs. 4-10). This species is distinguished from A. personatus and all other species of the North Pacific region by a unique COI haplotype (GenBank Accession KJ137280; Appdx. 2).

Description

Body elongate, slender, depth at dorsal-fin origin 27.5- 56.9% HL (43.6% HL), depth at anal-fin origin 28.0-55.4% HL (39.3% HL), depth at caudal peduncle 9.5- 15.3% HL (12.0% HL). Head long, 18.7-22.2% SL (21.7% SL). Snout long, 23.0-30.0% HL (26.9% HL). Mouth large: upper jaw 27.0-36.0% HL (30.9% HL); lower jaw 36.0-50.0% HL (43.3% HL). Orbit moderately large, 12.0-21.0% HL (18.2% HL). Gill rakers long, slender, 4-6 (5) on upper part of arch, 20-25 (23) on lower part, 25-30 (28) total, longest raker length 7.4-12.7% HL (11.3% HL). Pseudobranchs 9-16 (11).

Pored lateral-line scales 121-152 (125). Scales below lateral line situated along 143-172 (149) oblique dermal plicae.

Dorsal-fin rays 56-63 (59). Anal-fin rays 27-33 (30), 7-14 (9) pterygiophores anterior to first caudal vertebra. Pectoral-fin rays 13-16 (15), rays 2-6 (4) pigmented. Total vertebrae 65-72 (68), precaudal vertebrae 40-47 (44), caudal vertebrae 21-27 (24).

Distribution

On the basis of material examined, we determined that Ammodytes hexapterus ranges from the Soya Strait off Wakkanai, Hokkaido, Japan, through the Sea of Okhotsk, the western and northeastern Bering Sea, and into the Chukchi Sea (Fig. 1). In the eastern Bering Sea, its range overlaps with that of A. personatus south to Norton Sound, the Pribilof Islands, Kuskokwim Bay, and Unimak Pass (Fig. 1). Published sequences in GenBank indicate A. hexapterus is also distributed in the Beaufort Sea and Hudson Bay, Canada (Table 4).

Etymology

The specific name hexapterus is derived from hex meaning "six" and aptera literally meaning "without wings," likely referring to the lack of pelvic fins in this species. We propose the common name "Arctic sand lance," replacing the name "Pacific sand lance," which we assign to A. personatus, to more properly reflect its distribution.

Remarks

No type material is extant for Ammodytes hexapterus (Svetovidov, 1978, 1981). Because of the close morphological similarity but distinct genetic signature of species of Ammodytes, we, therefore, designate UAM 2813 from the Chukchi Sea as the neotype. Among species of Ammodytes, only A. hexapterus is known from the Chukchi Sea. The species was described originally from material obtained at uncertain locations during Russian expeditions into the Bering and Chukchi seas.

Duncker and Mohr (1939) uncertainly synonymized A. hexapterus under A. dubius, despite the priority by date of A. hexapterus. Following Nizinski et al. (1990), we identified A. dubius morphologically and found COI sequence data to support the species-level separation of A. hexapterus and A. dubius, although A. dubius itself was genetically indistinguishable from A. americanus in the COI region.

Ammoytes personatus Girard, 1856

Pacific sand lance

Figures 6B and 7B; Tables 5-7

Ammodytes personatus Girard, 1856:137 (original description; no types known; possibly USNM 612, 3 specimens, the lot is missing; Cape Flattery, Washington).

Ammodytes alascanus Cope, 1873:30 (original description; syntypes ANSP 8956-57, 2 specimens; Sitka, Alaska).

Ammodytes aleutensis Duncker and Mohr, 1939:20 (in part; original description; paralectotypes ZMB 14235, 5 specimens, 87.0-114.5 mm, Unalaska, Alaska, Albatross, 16 June 1890).

Neotype

UW 152354, 124.0 mm, Washington, Strait of Juan de Fuca, off Miller Peninsula, 48.4[degrees]N, 122.9[degrees]W, 25 April 2013, A. Kagley (GenBank Accession KJ137281), herein designated.

Diagnosis

A species of Ammodytes distinguished from A. japonicus by having significantly more total vertebrae (65-73 vs. 59-66) and precaudal vertebrae (41-49 vs. 36-43), more dorsal-fin rays (56-66 vs. 50-60), and fewer pigmented pectoral-fin rays (3-7 vs. 4-11). It is further distinguished from the new species by its narrower body (depth at dorsal-fin origin 24-53% HL vs. 33-57% HL; depth at anal-fin origin 33-52% HL vs. 27-55% HL), larger orbit (12-18% HL vs. 11-15% HL), fewer pored lateral-line scales (114-170 vs. 142-185) and dermal plicae (139-193 vs. 156-198), more total vertebrae (65-73 vs. 63-67) and precaudal vertebrae (41-49 vs. 39-43), and fewer pigmented pectoral-fin rays (3-7 vs. 4-10). It is distinguished from A. hexapterus and all other species of the North Pacific region by a unique COI haplotype (GenBank Accession KJ137281; Appdx. 2).

Description

Body elongate, slender, depth at dorsal-fin origin 27.2-53.5% HL (45.2% HL), depth at anal-fin origin 25.8-52.2% HL (42.1% HL), depth at caudal peduncle 10.0-15.0% HL (13.9% HL). Head long, 18.8-25.4% SL (20.3% SL). Snout long, 23.1-29.9% HL (27.8% HL). Mouth large: upper jaw 29.8-35.8% HL (30.2% HL); lower jaw 40.5-48.0% HL (41.7% HL). Orbit moderately large, 11.5-18.8% HL (14.7% HL). Gill rakers 22-30 (28), long, 8.2-12.4% HL (9.5% HL), slender, 4-6 (4) on upper part of arch, 18-26 (24) on lower part. Pseudobranchs 8-19 (10).

Pored lateral-line scales 114-170 (126). Scales below lateral line situated along 139-193 (150) oblique dermal plicae.

Dorsal-fin rays 56-66 (58). Anal-fin rays 25-33 (27), 7-13 (9) pterygiophores anterior to first caudal vertebrae. Pectoral-fin rays 13-16 (14), rays 3-7 (3) pigmented. Total vertebrae 65-73 (69), precaudal vertebrae 40-47 (44), caudal vertebrae 21-27 (25).

Distribution

On the basis of material examined, we determined that Ammodytes personatus ranges from California to the Gulf of Alaska, west to Attu Island in the Aleutian Islands, and north to Norton Sound in the northeastern Bering Sea (Fig. 1). In the eastern Bering Sea, its range overlaps with that of A. hexapterus in Norton Sound, the Pribilof Islands, Kuskokwim Bay, and Unimak Pass (Fig. 1). Ammodytes personatus (as A. hexapterus) has been reported also from as far south as Balboa Island in Southern California (Love et al., 2005). Unpublished sequence data of Turanov and Kartavtsev (2014) suggest that A personatus may range from Bering Island into the Sea of Okhotsk, a conclusion that will require further analysis of specimens from these areas.

Etymology

The specific name personatus is derived from the Latin personata meaning "masked," perhaps referring to a dark area on the head found in a few specimens. The author's intent is uncertain, as the derivation of the name was not specified in the original description and type material is missing. Because most specimens do not have a masked appearance, we chose the common name of "Pacific sand lance." Although this common name has been assigned previously to A. hexapterus (Nelson et al., 2004; Page et al., 2013), and the name has been applied to all eastern populations of the North Pacific region, A. hexapterus as now recognized is known in the Pacific Ocean only around the Kuril Islands, unlike A. personatus, which is found in the Pacific Ocean from the western Aleutian Islands to California.

Remarks

No type material is extant for Ammodytes personatus. Girard (1856) described the species from material collected by Lieutenant Trowbridge at Cape Flattery, Washington. Listed with the same collector and locality, USNM 612 likely composed at least part of the material used for the original description but is now missing and presumed lost (Williams (3)). Because of the close morphological similarity but distinct genetic signature of species of Ammodytes, we designate UW 116044 from the Strait of Juan de Fuca in the Salish Sea as the neotype. The locality is about 130 km east of the original type locality, and no other species of Ammodytes is known from the eastern North Pacific Ocean or Salish Sea.

Ammodytes japonicus Duncker and Mohr, 1939 Western sand lance [Japanese name: Ikanago] Figures 6C and 7C; Tables 5-7

Ammodytes personatus: Jordan, 1906:717, fig. 2 (in part; revision, all Ammodytes of the North Pacific region referred to A. personatus); Hashimoto and Kawasaki, 1981 (in part, "type N"); Han et al., 2012 (in part, "lineage B").

Ammodytes japonicus Duncker and Mohr, 1939:20 (in part; original description; lectotype ZMH H142, 88.5 mm, Hokkaido, Japan; paralectotypes ZMH H143, 51 specimens, 6 of 51 examined, 64.0-86.7 mm, Otaru [="Otaka"], Hokkaido, Japan).

Ammodytes aleutensis Duncker and Mohr, 1939:20 (original description; lectotype ZMH H139, 1 specimen, 81.0 mm, Otaru, Hokkaido, Japan; paralectotypes: ZMH H140, 1 specimen, 86.3 mm, Otaru [="Otaka"], Hokkaido, Japan; ZMH H141, 6 specimens, 62.0-73.2 mm, Kobe fish market, Japan; ZMB 14235, 5 specimens, 87-114.5 mm, Unalaska, Alaska).

Diagnosis

A species of Ammodytes distinguished from A. hexapterus by its significantly fewer total vertebrae (59-66 vs. 65-72) and precaudal vertebrae (36-43 vs. 40-47), more pored lateral-line scales (132-166 vs. 121-152) and dermal plicae (144-182 vs. 143-172), fewer dorsalfin rays (50-60 vs. 56-63), and more pigmented pectoral-fin rays (4-11 vs. 2-6); from A. personatus by significantly fewer total vertebrae (59-66 vs. 65-73) and precaudal vertebrae (36-43 vs. 41-49), fewer dorsal-fin rays (50-60 vs. 56-66), and more pigmented pectoralfin rays (4-11 vs. 3-7); and from the new species by its narrower body anteriorly (depth at dorsal-fin origin 32-53% HL vs. 33-57% HL), longer upper jaw (30-39% HL vs. 29-34% HL), larger orbit (12-20% HL vs. 1115% HL), fewer pored lateral-line scales (132-163 vs. 142-185), and fewer dermal plicae (144-182 vs. 156198). It is further distinguished from all other species of the North Pacific region by a unique COI haplotype (GenBank Accession KJ137283; Appdx 2).

Description

Body elongate, slender, depth at dorsal-fin origin 32.0- 53.0% HL (38.4% HL), depth at anal-fin origin 33.0- 57.0% HL (42.4% HL), depth at caudal peduncle 10.0- 16.0% HL (11.3% HL). Head long, 17.6-24.5% SL. Snout long, 25.0-30.0% HL (28.8% HL). Mouth large: upper jaw 30.0-39.0% HL (32.8% HL); lower jaw 35.050.0% HL (43.5% HL). Orbit moderately large, 12.020.0% HL (15.8% HL). Gill rakers long, 7.5-13.4% HL, slender, 20-29 (31), 3-6 on upper part of arch, 16-26 on lower part. Pseudobranchs 7-14.

Pored lateral-line scales 132-163 (132). Scales below lateral-line situated along 144-182 (144) oblique dermal plicae.

Dorsal-fin rays 50-60 (51). Anal-fin rays 26-33 (30), 7-12 (9) pterygiophores anterior to first caudal vertebra. Pectoral-fin rays 13-17 (15), rays 4-11 pigmented. Total vertebrae 59-66 (63), precaudal vertebrae 36-43 (39), caudal vertebrae 21-28 (24).

Distribution

On the basis of material examined, we determined that Ammodytes japonicus ranges from the southern Sea of Okhotsk through the Sea of Japan into the Seto Inland Sea and the Pacific Ocean off the southern part of Japan (Fig. 1). In the southern Sea of Okhotsk, its range overlaps with that of A. hexapterus and the new species in the Soya Strait off Wakkanai, Hokkaido (Fig. 1). Data of Okamoto (1989), Kim et al. (2006, 2008, 2010), Han et al. (2012), and published sequences in GenBank indicate that A. japonicus also ranges to Kyushu, the East China Sea, the Yellow Sea, and the Pacific Ocean side of northern Japan, where its range overlaps with that of the new species (Table 4).

Etymology

The specific name japonicus is the Latinized adjectival form of Japan, meaning "of Japan."

Remarks

We consider Ammodytes aleutensis to be a junior synonym of A. japonicus. In their original description, Duncker and Mohr (1939) included material from Unalaska Island, concluding erroneously that the species ranged throughout the Aleutian Islands. Meristic characters serve to identify those specimens as either A. personatus or A. hexapterus, and only A. personatus is recorded from the Aleutian Islands. Otherwise, all characters of the lectotype and other paralectotypes were well within the range of our genetically identified material for A. japonicus. Duncker and Mohr (1939) distinguished A. japonicus from A. aleutensis on the basis of meristic characters, as well as the position of the dorsal-fin origin (posterior to the center of the pectoral fin in A. aleutensis versus at the posterior end of the pectoral fin in A. japonicus), the posterior extension of the ventrolateral ridge (posterior to the second third of the anal fin and becoming reduced farther posterior versus extending posterior to the center of the anal fin). We find no differences among these morphometric characters in our material or in the pertinent type material examined.

The lectotype and 1 paralectoype of A. aleutensis and 1 lot of paralectoypes of A. japonicus (designated by Ladiges et al., 1958) were collected from "Otaka," according to Duncker and Mohr (1939). We were unable to find a place with that name in Japan. However, in examining material at ZMH, we found that the original label for ZMH 143 (originally 13708) had been misinterpreted and should have been recorded as "Otaru," a town on the western coast of Hokkaido.

Ammodytes heian Orr, Wildes, and Kai, new species Peaceful sand lance [New Japanese name: Oh-ikanago] Figures 6D and 7D; Tables 5-7

Ammodytes personatus-. Kawamura, 1940 (in part; cited in Ohshima, 1950; Onagawa and Moura bays); Hashimoto and Kawasaki, 1981 (in part, "type A"); Hashimoto, 1984 (in part, "group II"); Okamoto, 1989 (in part; off Rishiri Island, Wakkanai, Ryogoku Bay); Kim et al., 2010 (in part; specimens Ell and E30, table 1 and fig. 2); Han et al., 2012 (in part, "lineage A").

Holotype

FAKU 130770,184.8 mm, Japan, Iwate Prefecture, Pacific coast ofTohoku District, Ohfunato, 3 May 2008, Y. Kai.

Paratypes

FAKU 131506, 131507, 131795, 3 specimens, 148165.9 mm, Japan, Fukushima Prefecture, Pacific coast of Tohoku District, Soma, 3 May 2008, Y. Kai; FAKU 130767-130769, 130771-131774, 7 specimens, 184.8218.6 mm, Japan, Iwate Prefecture, Pacific coast of Tohoku District, Ohfunato, 3 May 2008, Y. Kai; UW 152685, 9 specimens, 202.9-225.9 mm, Japan, Hokkaido, off Wakkanai, 45.4492[degrees]N, 141.6446[degrees]E, Y. Kai.

Diagnosis

A species of Ammodytes distinguished from A. hexapterus by its significantly smaller orbit (11-15% HL vs. 12-21% HL), fewer total vertebrae (63-67 vs. 6572), fewer precaudal vertebrae (39-43 vs. 40-47), more pored lateral-line scales (142-185 vs. 121-152), more dermal plicae (156-198 vs. 143-172), and more pigmented pectoral-fin rays (4-10 vs. 2-6). It is further distinguished from A. personatus by its deeper body (depth at dorsal-fin origin 40-57% HL vs. 24-53% HL; greater depth at anal-fin origin 39-55% HL vs. 33-52% HL), smaller orbit (11-15% HL vs. 12-18% HL), more pored lateral-line scales (142-185 vs. 114170) and dermal plicae (156-198 vs. 139-193), fewer total vertebrae (63-67 vs. 65-73) and fewer precaudal vertebrae (39-43 vs. 41-49), and more pigmented pectoral-fin rays (4-10 vs. 3-7). It is further distinguished from A. japonicus by its deeper body anteriorly (depth at dorsal-fin origin 40-57% HL vs. 32-53% HL), shorter upper jaw (29-32% HL vs. 30-39% HL), smaller orbit (11-15% HL vs. 12-20% HL), more pored lateral-line scales (142-185 vs. 132-166) and more dermal plicae (156-198 vs. 144-182). It is further distinguished from all species of the North Pacific region by a unique COI haplotype (GenBank Accession KJ137282; Appdx. 2).

Description

Body elongate, slender, depth at dorsal-fin origin 40.1- 57.6% HL (48.1% HL), depth at anal-fin origin 39.3-55.4% HL (48.1% HL), depth at caudal peduncle 11.2- 14.0% HL (12.0% HL). Head long, 18.8-22.1% SL (20.1% SL). Snout long, 27.1-29.2% HL (28.5% HL). Mouth large: upper jaw 29.0-32.6% HL (32.2% HL); lower jaw 40.9-45.9% HL (43.7% HL). Orbit moderately sized, 11.1-15.2% HL (12.9% HL). Gill rakers 23-30 (27), long, 8.5-12.8% HL (11.0% HL), slender, 4-5 (4) on upper part of arch, 19-25 (23) on lower part. Pseudobranchs 10-17 (12).

Pored lateral-line scales 142-185 (158). Scales below lateral line situated along 156-198 (172) oblique dermal plicae.

Dorsal-fin rays 55-60 (56). Anal-fin rays 30-33 (31), 10-13 (12) pterygiophores anterior to first caudal vertebra. Pectoral-fin rays 14-17 (15), rays 4-10 (7) pigmented. Total vertebrae 63-67 (64), precaudal vertebrae 39-43 (42), caudal vertebrae 22-25 (22).

Distribution

On the basis of material examined, we determined that Ammodytes heian n. sp. ranges from the southern Sea of Okhotsk to the Pacific Ocean off the northern part of Japan (Fig. 1). In the southern Sea of Okhotsk, its range overlaps with that of A. hexapterus and A. japonicus in the Soya Strait off Wakkanai, Hokkaido (Fig. 1). Published sequences in GenBank (FJ666915, FJ666916) indicate that A. heian n. sp. also is found in the Sea of Japan (Table 4).

Etymology

The specific name heian is a transliteration of the Japanese word for "peace." The holotype and paratypes were collected from waters off Fukushima and Iwate prefectures, before the earthquake and tsunami of March 2011.

Remarks

Early surveys of vertebral counts in Ammodytes by Kawamura (1940), Ohshima (1950), and Hashimoto and Kawasaki (1981) around Japan revealed significant variation in different regions. Populations from off Onagawa on the northeastern Pacific coast and in Moura Bay at the northern tip of Honshu (Ohshima, 1950, table 6, 61-66) are clearly different from populations in the Sea of Japan and farther south along the Pacific coast and match our data for A. heian n. sp. (Tables 5 and 7). Two populations examined by Hashimoto and Kawasaki (1981) had significantly different vertebral counts, as well as differences in life history characteristics. In a more comprehensive work, Hashimoto (1984) surveyed additional meristic characters, classifying populations around Japan into 3 groups: a northern group ("I";=A. hexapterus) found in Japan only in Soya Strait; a northcentral group ("II";=A. heian n. sp.) found on the northeastern Pacific Ocean side of Honshu and in the Sea of Japan from Tottori to the Soya Strait; and a southcentral group ("III";=A. japonicus) found in the southern Sea of Japan, on the southcentral side of Honshu in the Pacific Ocean, and in the Seto Inland Sea.

Genetic research has consistently shown strong heterogeneity among populations around Japan (all originally identified as A. personatus), whether they are strictly considered as one species or potentially as more than one. Distributions of allozyme genotypes presented by Okamoto (1989) revealed 3 genetically isolated groups in Japan concordant with our results: a northern Japan group (likely representing A. heian n. sp., on the basis of the distribution of our material), a southern Japan group (=A. japonicus), a Kushiro and Wakkanai group (=A. hexapterus); also shown was a fourth group from Kodiak, Alaska (-A. personatus). Later work by Kim et al. (2006, 2008, 2010) with mtDNA also revealed genetic differences among populations around Korea. Through comparisons between our sequence data and data in GenBank and BOLD, we identified 2 individuals of A. heian n. sp. from the Sea of Japan in the material of Kim et al. (2006, 2008, 2010; Table 4); all other individuals were identified by us as A. japonicus. Most recently, Han et al. (2012) found 2 lineages around Japan and in the Yellow Sea on the basis of analysis of the mitochondrial control region, concluding that further study with nuclear DNA markers is needed to clarify their taxonomic status. However, the morphological and COI sequence differences disclosed here as well as the isozyme analysis of Hashimoto and Kawasaki (1981) strongly support the conclusion that the lineages represent 2 species. Lineage A appears to represent A. heian n. sp., and Lineage B, A. japonicus.

Discussion

Our primary objective was to taxonomically revise the genus Ammodytes in the North Pacific Ocean and its fringing seas by examining morphological and mtDNA variation. Morphological and genetic analyses show that the genus Ammodytes comprises 4 species in the North Pacific region: Ammodytes personatus, ranging from California to the Aleutian Islands and eastern Bering Sea; A. hexapterus, ranging from the Hudson Bay in the east, through the Chukchi and Bering seas, to the western Pacific region in the Sea of Okhotsk and to Soya Strait between Hokkaido and Sakhalin islands; A. japonicus, found in the Sea of Japan, the Seto Inland Sea, the Pacific Ocean side of southern Honshu, and the Yellow Sea; and a new species, A. heian, herein described and found on the Pacific Ocean side of northern Honshu, in the Soya Strait, and in the Sea of Japan.

Although clearly distinct genetically, some species are morphologically similar to one another and, despite significant differences found among several characters, only combinations of morphometric and meristic characters serve to distinguish the species from one another. The species of the eastern or northern areas of the North Pacific region (A. personatus and A. hexapterus), together, can readily be distinguished from the species of the western North Pacific region (A. japonicus and A. heian n. sp.) on the basis of vertebral counts, but species within these pairs are nearly indistinguishable morphologically. To add to the challenge of species identification, ranges of A. personatus and A. hexapterus overlap in the northern Bering Sea, and A. japonicus and A. heian n. sp. were found together in our Soya Strait material; data from other authors strongly indicate that the latter 2 species are also found together in the Sea of Japan (Hashimoto, 1984; Kim et al., 2006, 2008, 2010; Han et al., 2012).

The distribution of each species generally corresponds well with general zoogeographic regions (Fig. 1). Ammodytes personatus exhibits an Aleutian-Oregonian distribution (Allen and Smith, 1988; Briggs, 1995; Logerwell et al., 2005) and is found in the eastern North Pacific Ocean from California to the Gulf of Alaska, the Aleutian Islands, and into the eastern Bering Sea, where to the north it is found sympatrically with A. hexapterus. Ammodytes hexapterus exhibits an Arctic-Kuril distribution (Allen and Smith, 1988; Briggs, 1995; Logerwell et al., 2005), extending from the southern Sea of Okhotsk in the Soya Strait to the western Bering Sea, the northeastern Bering Sea, and into the Chukchi Sea. It may be a circum-Arctic species; sequence data in GenBank indicates that its range extends at least to the Beaufort Sea and Hudson Bay (Table 4). Ammodytes japonicus exhibits a distribution that encompasses the Sea of Japan and the Central Kuroshio Current area (Spalding et al., 2007), and this species is found on both coasts of Japan, in the Soya Strait, in the Sea of Japan, in the Seto Inland Sea, in the Yellow and East China seas (Kim et al., 2006, 2008, 2010), and on the southern Pacific coast of Japan. Ammodytes heian exhibits a distribution that consists of the northern Sea of Japan and northeastern Honshu (Spalding et al., 2007), having been found in the Soya Strait and on the northeastern Pacific coast of Japan.

A collection in the Soya Strait at Wakkanai, Japan, contained 3 species: A. hexapterus A. japonicus, and A. heian n. sp. This distributional pattern is similar to the one based on allozyme data of Okamoto (1989), who found 3 "genetically distinct" groups around Japan, including 2 in the Soya Strait: a southern species ranging from Kyushu and the Seto Inland Sea to Sendai Bay (=A. japonicus), a more northern species from Iwate Prefecture to the northern Sea of Japan and Soya Strait (=A. heian n. sp.), and a third species on the Pacific Ocean side of Hokkaido off Kushiro and Soya Strait (=A. hexapterus). This strong geographic pattern may indicate that present-day, large-scale movement of sand lances is limited.

The genetic information presented in this article is meant to support the morphological data and describe the species of Ammodytes in the North Pacific region. It is not meant to provide a complete phylogenetic reconstruction of the genus Ammodytes. A productive look at phylogeny will require a more detailed study of Ammodytes of the Atlantic Ocean, as well as other members of the group. Although each clade of species is robust, the relationships among the Atlantic species are weak, as indicated by the low bootstrap branch support and alternative positions of A. personatus among Atlantic species in phylogenetic trees (Figs. 3 and 4). Additionally, Tajima D values (Tajima, 1989) indicate that the COI gene is likely under selection in Ammodytes.

Because selection can obscure phylogenetic patterns and because no literature is available to suggest a mutation rate in species of Ammodytes, we are reluctant to provide estimates of times of divergence between these species. Ammodytes hexapterus is nearly homogenous at COI and, because bottlenecks decrease molecular diversity, was likely derived from a founder population followed by rapid expansion, as indicated by the broad range over which it is homogenous. The lack of genetic divergence across haplotypes is typical for marine fishes that have experienced fluctuations in population size (Grant and Bowen, 1998). More information about the Atlantic species, and members of other genera, may allow for a more robust examination of phylogeny in Ammodytes.

Our taxonomic revision of the sand lances of the genus Ammodytes in the North Pacific region resulted in the recognition of 4 species: A. hexapterus, A. personatus, A. japonicus, and the new species A. heian. Only 2 species, with a confused nomenclature, have been recognized as valid for the past several decades. Without a clear knowledge of the number of species present in the area, each with its unique life history and biology, the contributions of this genus to the ecosystem will be inadequately understood and successful management of these species will be impossible.

This study underscores the importance of increasing our knowledge of forage species. As scientists move to manage marine resources with an ecosystem-based approach, species at the base of the food web should be examined at least as rigorously as species of commercial interest. In this study, we uncovered aspects of the evolutionary history of the genus Ammodytes and its current-day isolation into 4 species in the ecosystem of the North Pacific Ocean and surrounding seas. Ecosystem models would benefit from further studies of the population structure within each species, as well as studies of the unusual life history of these sand- and water-dwelling species.

Appendix 1

This appendix provides number and length of specimens, location, depth, and other details on the materials examined for this taxonomic revision of North Pacific sand lances of the genus Ammodytes: A. hexapterus, A. personatus, A. japonicus, and A. heian new species. Lengths are given in standard length.

Material examined

Ammodytes hexapterus 165 specimens (53.0-160.3 mm) examined, including the neotype listed in the species description in the main text. Bering Sea: UW 152677, 4 (70-75 mm), 72.0257[degrees]N, 162.2469[degrees]W, 28 m depth, FV Alaska Knight, cruise 201202, haul 98, 11 September 2012; UW 12728, 2 (142.0-170.7 mm), St. Lawrence Island, 63.6667[degrees]N, 167.4667[degrees]W, 22-40 m depth, RV Deep Sea, field numbers 49-10 to 49-14, 27 June 1949, H. Hildebrand; UW 150610, 150733, 151476, 16 (97.6-120.0 mm), 64.316[degrees]N, 163.0007[degrees]W, 12 m depth, FV Vesteraalen, cruise 201002, haul 74, 8 August 2010; UW 26820, 1 (93 mm), 63.5[degrees]N, 166.333[degrees]W, 27 m depth, RV Deep Sea, Area III. Sea of Okhotsk: ABL 11-0006, 50 (53-61 mm), 51.57[degrees]N, 144.24[degrees] E, 14 September 2009, O. Katugin; ABL 11-0007, 46 (117.0-160.3 mm), 52.54[degrees]N, 144.12[degrees]E, field number AhOS30, O. Katugin. Chukchi Sea: UAM 1255, 19 (83.0-159.0 mm), Alaska, 67.4093[degrees]N, 173.5757[degrees]W, RUSALCA 2012, station CLIO, PSBT, haul 16, 13 September 2012; UW 150611, 8 (113.0-129.5 mm), Alaska, 69.6674[degrees]N, 164.2905[degrees]W, surface, field number AkCh Oil OT5; UW 16914, 5 (82-87 mm), Alaska, Cape Thompson area, Chariot site, 68.1[degrees]N, 166[degrees]W. Japan: UW 116840, 13 (217.4-257.3 mm), off Wakkanai, Hokkaido, 45.4492[degrees]N, 141.6446[degrees]E, Y. Kai.

Ammodytes personatus 451 specimens (40.0-273.6 mm) examined, including the types listed in the species description in the main text. Bering Sea: UW 152678, 1 (75.0 mm), 58.01135[degrees]N, 160.2173[degrees]W, 49 m depth, FV Aldebaran, cruise 201101, haul 7, 6 June 2011; UW 110990, 2 (77-78 mm), 56.5667[degrees]N, 163.3833[degrees]W, 27 m depth, RV Discoverer, cruise 197701, station 89, haul 48, 27 August 1977; UW 110994, 2 (61-80 mm), 56.9167[degrees]N, 162.6[degrees]W, 27 m depth, RV Discoverer, cruise 197701, station 72, haul 31, 22 August 1977; UW 110997, 1 (72 mm), southern Bering Sea, 55.1022[degrees]N, 166.1181[degrees]W, 18 August 1977; UW 111017, 3 (55-68 mm), 56.23333[degrees]N, 163.3667[degrees]W, 27 m depth, RV Discoverer, cruise 197701, haul 30, 29 August 1977; UW 111027, 1 (74 mm), 55.4333[degrees]N, 164.9833[degrees]W, 27 m depth, RV Discoverer, cruise 197701, station 93, haul 52, 28 August 1977; UW 111043, 1 (83 mm), 56.3167[degrees]N, 162.85[degrees]W, 27 m depth, RV Discoverer, cruise 197701, haul 47, 27 August 1977; UW 111211, 1 (91 mm), 58.6667[degrees]N, 162.7167[degrees]W, 24 m depth, RV Miller Freeman, cruise 197501, haul 181, 8 October 1975; UW 112579, 1 (115 mm), 58.5134[degrees]N, 159.5233[degrees]W, 20 m depth, FV Arcturus, cruise 200001, haul 15, 26 May 2000, G. R. Hoff; UW 116094, 1 (242.0 mm), southeastern Bering Sea; UW 116096, 1 (94.6 mm), southeastern Bering Sea; UW 1361, 8 (82.7-106.9 mm) of 12, Alaska Peninsula, Big Lake near Kvichak River weir, 58.6667[degrees]N, 157.5667[degrees]W, 22 May 1929, C. Flock; UW 151465-151469, 5 (108.1-120.3 mm), 58.6538[degrees]N, 163.3465[degrees]W, 29 m depth, FV Arcturus, cruise 200901, haul 43, 10 June 2009; UW 151470-151472, 151490, 4 (140.0-174.5 mm), 57.0137[degrees]N, 159.1401[degrees]W, 32 m depth, FV Alaska Knight, cruise 201001, haul 5, 7 June 2010; UW 151473, 2 (80.0-169.8 mm), 57.9840[degrees]N, 158.3283[degrees]W, 33 m depth, FV Aldebaran, cruise 201001, haul 4, 7 June 2010; UW 151474, 3 (70.0-121.7 mm), 57.5001[degrees]N, 169.3437[degrees]W, 68 m depth, FV Aldebaran, cruise 201001, haul 104, 2 July 2010; UW 151475, 1 (102 mm), 58.3275[degrees]N, 162.0278[degrees]W, 45 m depth, FV Aldebaran, cruise 201001, haul 20, 10 June 2010; UW 151477, 1 (105.4 mm), 59.3179[degrees]N, 165.9568[degrees]W, 23 m depth, FV Aldebaran, cruise 201001, haul 72, 22 June 2010; UW 151478, 1 (105.6 mm), 57.9741[degrees]N, 162.1324[degrees]W, 34 m depth, FV Alaska Knight, cruise 201001, haul 20, 10 June 2010; UW 151479, 1 (79.4 mm), 57.6559[degrees]N, 160.8843[degrees]W, 56 m depth, FV Aldebaran, cruise 201001, haul 16, 10 June 2010; UW 151480, 1 (140.1 mm), Bering Sea, 57.9882[degrees]N, 158.9351[degrees] W, 38 m depth, FV Aldebaran, cruise 201001, haul 5, 7 June 2010; UW 151481, 1 (142.6 mm), 57.3101[degrees]N, 159.0668[degrees] W, 46 m depth, FV Alaska Knight, cruise 201001, haul 6, 7 June 2010; UW 151482,1 (150.0 mm), 57.6559[degrees]N, 158.3651[degrees]W, 35 m depth, FV Aldebaran, cruise 201001, haul 3, 7 June 2010; UW 151483, 1 (78.0 mm), Bering Sea, 58.0087[degrees]N, 160.1893[degrees]W, 49 m depth, FV Alaska Knight, cruise 201001, haul 9, 8 June 2010; UW 151484, 1 (120.0 mm), 58.3435[degrees]N, 159.5522[degrees]W, 23 m depth, FV Aldebaran, cruise 201001, haul 6, 8 June 2010; UW 151485, 1 (120.0 mm), 57.67421[degrees]N, 159.6345[degrees]W, 48 m depth, FV Arcturus, cruise 200901, haul 7, 3 June 2009; UW 151486, 1 (112 mm), 59.6669[degrees]N, 166.609[degrees]W, 26 m depth, FV Aldebaran, cruise 201001, haul 75, 22 June 2010; UW 151488, 1 (73 mm), 59.3175[degrees]N, 164.0119[degrees]W, 21 m depth, FV Arcturus, cruise 200901, haul 46, 10 June 2009; UW 151489, 1 (147 mm), 58.3534[degrees]N, 162.7112[degrees]W, 30 m depth, FV Alaska Knight, cruise 201001, haul 24, 11 June 2010; UW 151492, 3 (65-120 mm), 58.2819[degrees]N, 159.9693[degrees]W, 39 m depth, FV Alaska Knight, cruise 201001, haul 8, 8 June 2010; UW 151493, 2 (70-110 mm), 58.6372[degrees]N, 162.707[degrees]W, 23 m depth, FV Arcturus, cruise 200901, haul 42, 9 June 2009; UW 17273, 1 (70.1 mm), 55.25[degrees] N, 166.1167[degrees] W, 29 August 1957, McCrery et al.; UW 22201, 1 (114 mm), Bering Sea, Bristol Bay, 58.4833[degrees]N, 159.3667[degrees]W, 14 m depth, FV Mineshima Maru, cruise 347, haul 629, 27 May 1988, Renko and Moore; UW 26830, 1 (131.6 mm), 57.75[degrees]N, 159.5333[degrees]W, FV Silver Charlie, 1 May 1981; UW 26836, 1 (198.3 mm), Bristol Bay, 57[degrees]N, 164[degrees]W, 1 October 1975; UW 29512, 4 (25-62 mm) of 7, 56.0028[degrees]N, 163.847[degrees]W, 91 m depth, cruise 77-1, tow 16/58, M. W. Brown; UW 45766, 1 (140.7 mm), 58.002[degrees]N, 159.6508[degrees]W, 39 m depth, FV Arcturus, cruise 199801, haul 7, 10 June 1998; UW 45884, 2 (209.3-212.0 mm), 54.7[degrees]N, 165.35[degrees]W, 150 m depth, FV Arcturus, cruise 199702, haul 310, G. R. Hoff; UW 46838, 1 (115 mm), 58.0109[degrees]N, 159.603[degrees]W, 38 m depth, FV Aldebaran, cruise 199901, haul 9, 24 May 1999, D. Nichol; UW 46853, 1 (105 mm), Kuskokwim Bay, 58.9790[degrees]N, 163.3502[degrees]W, 20 m depth, FV Aldebaran, cruise 199901, haul 25, 28 May 1999, D. Nichol. Aleutian Islands: UW 26835, 1 (129.5 mm), Amchitka Island, St. Makarins Bay, 51.37[degrees]N, 179.245[degrees]E, 25 June 1971, Palmisano; UW 154476, 2 (210 mm), off Amchitka Island, 51.9573[degrees]N, 178.2761[degrees] E, 74 m depth, FV Ocean Explorer, cruise 201201, haul 150, 14 July 2012, J. W. Orr; UW 152109, 2 (195-280 mm), off Tanaga Island, 51.6337[degrees]N, 178.0881[degrees]W, 62 m depth, FV Ocean Explorer, cruise 201201, haul 118, 6 July 2012, J. W. Orr; UW 112021, 1 (259 mm), off Yunaska Island, 53.1164[degrees]N, 170.92[degrees]E, 100 m depth, FV Vesteraalen, cruise 200001, haul 221, 16 July 2000, E. S. Brown; UW 116092, 1 (218.1 mm), 52.96829[degrees]N, 173.2401[degrees]E, 81 m depth, FV Sea Storm, cruise 200601, haul 136, 9 July 2006; UW 116093, 1 (225.2 mm), 52.96829[degrees]N, 173.2401[degrees]E, 81 m depth, FV Sea Storm, cruise 200601, haul 136, 9 July 2006; UW 116097-116207, 11 (223.4273.6 mm), 52.5781[degrees]N, 174.3485[degrees]E, 89 m depth, FV Sea Storm, cruise 200601, haul 153, 14 July 2006, K. Dodd; UW 150280, 19 (226.6-259.5 mm), 52.6011[degrees]N, 174.2742[degrees]E, 86 m depth, FV Sea Storm, cruise 201001, haul 192, 1 August 2010, K. Maslenikov; UW 17252, 1 (65.0 mm), 52.65[degrees]N, 176.43[degrees]E, Allen and McCrery; UW 1728, 1 (87.0 mm), English Bay, Unalaska Island, 53.934[degrees]N, 166.25[degrees]W, MS Dorothy, 3 June 1930; UW 26846, 1 (148.0 mm), Amchitka Island, 51.5[degrees]N, 179[degrees]E, 4 October 1971; UW 48923, 6 (105-117 mm), Unalaska Island, 53.6733[degrees]N, 166.6483[degrees]W, 5 August 1962, Burdick and MacAllister; UW 48929, 16 (40-60 mm), Sedanka Island, Udamat Bay, 53.8036[degrees]N, 166.226[degrees]W, 15 August 1962; UW 48939, 4 (95-133 mm), Unalaska Island, Unalaska Bay, 53.9333[degrees]N, 166.517[degrees]W, station 3, 29 May 1962; UW 48950, 7 (103.0-124.1 mm), Unalaska Island, 53.6733[degrees]N, 166.6483[degrees]W, 5 August 1962, Burdick; UW 49045, 5 (50-72 mm), Alaska, Akun Island, Akun Bay, 55.25[degrees]N, 165.5[degrees]W, FV Harmony #7, 3 October 1962; UW 116091, 1 (233.1 mm), western Aleutian Islands. Gulf of Alaska: UW 152353, 2 (105-110 mm), 58.2917[degrees]N, 153.1155[degrees]W, 65 m depth, FV Sea Storm, cruise 200701, haul 159, 4 July 2007; UW 152352, 1 (128 mm), 59.4256[degrees]N, 152.4063[degrees]W, 67 m depth, FV Sea Storm, cruise 200701, haul 185, 7 July 2007; UW 152349, 9 (139.3-183.6 mm), Kodiak Island, Deadman Bay, 57.0667[degrees]N, 153.9378[degrees]W; UW 118906, 1 (155.0 mm), 57.0662[degrees]N, 153.6049[degrees]W, 79 m depth, FV Pacific Explorer, cruise 200901, haul 148, 26 June 2009, J. W. Orr; UW 119211, 1 (120 mm), 57.2218[degrees]N, 151.9528[degrees]W, 64 m depth, FV Pacific Explorer, cruise 200901, haul 156, 27 June 2009, J. W. Orr; UW 151487, 1 (148 mm), 54.8279[degrees]N, 159.8582[degrees]W, 49 m depth, FV Sea Storm, cruise 200901, haul 51, 5 June 2009; UW 14422, n=5, Squaw Harbor, Unga Island, Shumagin Islands, 55.3[degrees]N, 160.5[degrees]W, 30 August 1956, R. J. Mynre; UW 15497, 4 (70-105 mm), Gulf of Alaska, Uyak Bay, Kodiak Island, 57.6[degrees]N, 154[degrees]W, 10 July 1941, A. C. DeLacy et al.; UW 15610, 3 (90-123 mm), Alexander Archipelago, Shelikof Bay, Kruzof Island, 57.15[degrees]N, 135.8[degrees]W, 1 July 1960, Dryfoos; UW 16464, 4 (145-152 mm), 57.4167[degrees]N, 150.75[degrees]W, 4 June 1958; UW 20642, 8 (72-85 mm), Kodiak Island, Ugak Bay, 57.4517[degrees]N, 152.7019[degrees]W, U2-301-117, 20 June 1976, C. Harris and M. Hunter; UW 243, 1 (75 mm), Kodiak Island, Alitak, 56.9[degrees]N, 154.16[degrees]W, Crawford; UW 26825, 1 (95 mm), Kodiak Island, Ugak Bay, 57.4517[degrees]N, 152.701[degrees]W, 4 August 1923; UW 4002, 3 (70-90 mm), Kodiak Island, Lazy Bay, 56.9[degrees]N, 154.26[degrees]W, 8 May 1932; UW 4202, 4 (85-90 mm), Wide Bay, 57.4[degrees]N, 156.46[degrees]W, 31 May 1932; UW 45961, 1 (91 mm), 57.515[degrees]N, 151.5496[degrees]W, 147 m depth, FV Vesteraalen, cruise 200101, haul 177, 28 June 2001, J. W. Orr; UW 5301, 8 (112.0-120.2 mm), Prince of Wales Island, Tranquil Point in the Alexander Archipelago, 55[degrees]N, 133[degrees]W, 22 July 1939, Franett. British Columbia: UW 1734, 1 (83 mm), Hecate Strait, middle of Hecate Strait between Gander Island and Danger Rocks, 52.5[degrees]N, 129.5[degrees]W, 1 September 1931. Washington: UW 11329, 8 (66.1-107.1 mm), Puget Sound, Meadow Point, Seattle, 47.6[degrees]N, 122.3[degrees]W, 29 April 1955, A. DeLacy and class; UW 116044-116054, 11 (61.2-87.1 mm), Puget Sound, 48.7042[degrees]N, 123.014[degrees]W, 60-80 m depth, RV Centennial, site 10, sample V5, 6 November 2006, D. Gunderson and J. Blaine; UW 116055-116064, 10 (65.6-75.2 mm), Puget Sound, 48.69[degrees]N, 123.0161[degrees]W, 60-80 m depth, RV Centennial, site 28, sample V18, 6 November 2006, D. Gunderson and J. Blaine; UW 116065-116075, 11 (65.0-75.2 mm), Puget Sound, 48.5325[degrees]N, 123.0214[degrees]W, 60-80 m depth, RV Centennial, site 26, sample V16, 6 November 2006, D. Gunderson and J. Blaine; UW 116076-116090, 14 (63.6-79.8 mm), Puget Sound, 48.7136[degrees]N, 123.0161[degrees]W, 60-80 m depth, RV Centennial, site 31, sample V21, 6 November 2006, D. Gunderson and J. Blaine; UW 118502, 23 (68-83 mm), Salish Sea, San Juan Channel, south of Turn Island, 48.52[degrees]N, 122.95[degrees]W, 73-77 m depth, 24 April 2007, L. L. Britt; UW 118503, 8 (68.0-85.0 mm), Salish Sea, San Juan Channel, Jackson Beach, 48.52[degrees]N, 123[degrees]W, beach seine, 24 April 2007, L. L. Britt; UW 16754, 1 (125 mm), Puget Sound, Golden Gardens, 47.7[degrees]N, 122.4[degrees]W, 1 January 1963, R. B. Grinols; UW 26833, 11 (102.6-121.6 mm), Salish Sea, San Juan Island, Eagle Cove, 48.5[degrees]N, 123[degrees]W, Friday Harbor Lab 75-03-02, 20 June 1975, Fish 454a class. California: HSU 4802, 34 (77-108 mm), Humboldt Bay, 40.7621[degrees]N, 124.2152[degrees]W, 1 October 2009, A. Kinziger; UW 152676, 104 (60-77 mm), Hum boldt Bay, north jetty, 40.7621[degrees]N, 124.2152[degrees]W, 1 October 2009, A. Kinziger.

Ammodytes japonicus 138 specimens (30.0-160.9 mm) examined, including the types listed in the species description in the main text. FAKU 130765, 1 (104.8 mm), Japan, Nohara, Maizuru, Kyoto, 35.5[degrees]N, 135.4[degrees]E; FAKU 130979-131008, 30 (131.2-160.9 mm), Japan, Inland Sea, off Akashi, Hyogo, 34.5[degrees]N, 135[degrees]E, Y. Kai; FAKU 131055-131091, 28 (86.0-108.8 mm), Japan, off Shiroko, Aichi, Ise Bay, 34.734[degrees]N, 136.68[degrees]E, Y. Kai; FAKU W856, W914, W915, 125465, 130765, 5 (103.7-167.0 mm), Japan, Sea of Japan, Kyoto, Wakasa Bay, 35.8[degrees]N, 135.5[degrees]E, 1977; UW 153060, 17 (30.0-45.0 mm), Japan, Maizuru, 35.5[degrees]N, 135.4[degrees]E; UW 153061, 31 (30-32 mm), Japan, Ise Bay, 34.7[degrees]N, 136.8[degrees]E, 2006; UW 152684, 3 (208.0-218.9 mm), Japan, off Wakkanai, Hokkaido, 45.4492[degrees]N, 141.6446[degrees]E, 2007, Y. Kai; UW 16457, 5 (118.5-146.8 mm), Japan, Shizuoka Province, Suruga Bay, 35[degrees]N, 138.75[degrees]E, 15 May 1950, F. Wilke.

Ammodytes dubius 11 specimens (87.0-125.0 mm) examined. UW 152011, 10 (87-125 mm), western North Atlantic Ocean, Massachusetts, 41.7637[degrees]N, 69.8956[degrees]W; UW 4799, 1 (115 mm), Woods Hole, Massachusetts, 2 October 2012.

Ammodytes americanus 3 specimens (73.0-142.0 mm) examined. VIMS 12840, 1 (142 mm), western North Atlantic Ocean, Rhode Island Sound, 41.2355[degrees]N, 71.5519[degrees]W, 29 m depth, FV Darana R, cruise NM20100401, station 150, 6 May 2010; VIMS 12843, 1 (138 mm), western North Atlantic Ocean, Rhode Island Sound, 41.1764[degrees]N, 71.4936[degrees]W, 29 m depth, FV Darana R, cruise NM20100401, station 139, 5 May 2010; VIMS 12844, 1 (73 mm), western North Atlantic Ocean, Rhode Island Sound, 41.2937[degrees]N, 71.8408[degrees]W, 31 m depth, FV Darana R, cruise NM20100401, station 126, 11 May 2010.

Ammodytes marinus 2 specimens (133.0-155.0 mm) examined. ZMUC P61825-P61826, 2 (133-155 mm), Denmark, North Sea, Horns Rev, 55.47[degrees]N, 8.43[degrees]E, 2 July 2009.

Ammodytes tobianus 2 specimens (105.0-106.0 mm) examined. ZMUC P61815-P61816, 2 (105-106 mm), Denmark, Langeland, off Hjortholm, 55.9[degrees]N, 10.6[degrees]E, 1 May 2010.

Appendix 2

This appendix provides diagnostic mitochondrial DNA sequence data for North Pacific sand lances of the genus Ammodytes, including data for neotypes of A. hexapterus and A. personatus and for the holotype of A. heinan new species. The sequences are a partial (560-base-pair) fragment from the cytochrome oxidase c subunit 1 region of the mitochondria.

Cytochrome oxidase c subunit 1 sequences

Ammodytes hexapterus

UAM 2813, neotype, GenBank Accession KJ137280.

COI sequence: tgtaatgccg gcggcaagga cgggcaggga aaggaggaga aggacggctg taatcagcac agctcacaca aataagggtg tctgatactg ggaaatagcg ggaggtttca tattaataat tgtggtgatg aagttgattg ctccaagaat tgaagaaatc ccggctaaat gcagagagaa gattgttaag tcaacagatg cacctgcgtg ggctagattt ccggccaggg gtgggtatac agttcaaccg gtaccagctc cagcttctac gcctgaagag gctaggagaa gaaggaggga gggtgggagg agtcaaaagc tcatgttatt tattcgaggg aatgctatgt caggggcgcc aatcattagg gggattagtc agtttccgaa accaccgatc ataattggta ttactataaa gaaaatcatt acgaatgcat gagcggtaac aattacgtta tagatttggt cgtctcctag gagggcgccg ggttggctaa gttctgctcg gatgagcagg ctcagggctg tccccaccat agcggctcaa gcaccaaata

Ammodytes personatus

UW 152354, neotype, GenBank Accession KJ137281.

COI sequence: tgtaatgccg gcagcaagga cggggaggga gaggaggaga aggacggctg taatcagcac agctcacaca aataagggtg tctgatactg agagatagcg ggaggtttca tgttaataat tgtggtgatg aagttgattg ctccaagaat cgaggagatc ccggctaaat gcagagagaa gattgttaag tcaacagatg cacctgcgtg ggctagattt ccggccaggg gagggtatac agttcaaccg gtaccagctc cagcttctac gcctgaagag gctaggagaa gaaggaggga gggtgggagg agtcaaaagc tcatgttatt tattcgaggg aatgctatat caggggcacc aatcattagg gggattagtc agtttccgaa accaccaatc ataattggta ttactataaa gaaaatcatt acgaatgcat gagcggtaac aattacgtta tagatttgat catctcctag gagggcgccg ggttggctaa gttctgctcg gatgagcagg cttagagccg tccccaccat agcggctcaa gcaccaaata

Ammodytes japonicus

FAKU 130988, GenBank Accession KJ137283.

COI sequence: tgtaatgccg gcagcaagaa cagggaggga gaggagaaga aggacggctg taatcagtac ggctcacaca aataaaggtg tttgatactg ggagatagcg ggaggcttca tgttaataat tgtggtgatg aagttgattg ctccaagaat tgaagaaatt ccggctaaat gcagggagaa gattgttaaa tcaacagatg cacctgcgtg ggccagattt ccggccaaag gggggtatac agttcaaccg gtaccggccc cagcctctac gcctgaagag gctaagagaa gaagaaggga gggtggaaga agtcaaaagc ttatgttatt tattcgggga aatgctatat caggggcgcc aatcattagg gggattagtc agtttccaaa accaccaatc ataattggta ttactataaa gaaaatcatt acgaatgcat gagcggtaac aattacgtta tagatttggt catctccgag gagggcgccg ggttggctaa gttccgctcg aatgagcagg cttagggccg tccccaccat agcggctcaa gcaccaaata

Ammodytes heian

FAKU 130770, holotype, GenBank Accession KJ137282.

COI sequence: tgtaatgccg gcagcaagaa cagggaggga gaggagaaga aggacggctg taatcagtac ggctcacaca aataaaggtg tttgatactg ggagatagcg ggaggcttca tgttaataat tgtggtgatg aagttgattg ctccaagaat tgaagaaatt ccggctaaat gcagggagaa gattgttaaa tcaacagatg cacctgcgtg ggccagattt ccggccaaag gggggtatac agttcaaccg gtaccggccc cagcctctac gcctgaagag gctaagagaa gaagaaggga gggtggaaga agtcaaaagc ttatgttatt tattcgggga aatgctatat caggggcgcc aatcattagg gggattagtc agtttccaaa accaccaatc ataattggta ttactataaa gaaaatcatt acgaatgcat gagcggtaac aattacgtta tagatttggt catctccgag gagggcgccg ggttggctaa gttccgctcg aatgagcagg cttagggccg tccccaccat agcggctcaa gcaccaaata

Acknowledgments

We thank B. Armstrong for the initial inspiration to conduct this project, and P. Mpller and T. Menne (University of Copenhagen); A. Abookire, R. Armstrong, E. Brown, C. Kondzela, C. Munk, D. Nichol, S. Paine, M. Paquin, J. Thedinga, S. Johnson, and L. Britt (Alaska Fisheries Science Center); J. Blaine, D. Gunderson, and K. Maslenikov (University of Washington); A. Kinziger (Humboldt State University); A. Lopez (University of Alaska Fairbanks); E. Hilton (Virginia Institute of Marine Sciences); A. Kagley (Northwest Fisheries Science Center), and the Northeast Fisheries Science Center Ecosystems Surveys Branch for samples. We also thank T. Pietsch and K. Maslenikov (University of Washington Fish Collection) for providing access to collections, archiving new specimens, and facilitating loans from other institutions; P. Bartsch, C. Lamour (Museum fur Naturkunde), and R. Thiel (Zoological Museum Hamburg) for access to type material; and L. Park, P. Schwenke, A. Elz, S. Howard, and J. Hemplemann (Northwest Fisheries Science Center) for assistance with assays. D. Stevenson (Alaska Fisheries Science Center) and W. Grant (Alaska Department of Fish and Game) provided critical reviews at the manuscript stage.

Literature cited

Allen, M., and Smith, G. 1988. Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p.

Andriashev, A. P. 1954. Fishes of the northern seas of the U.S.S.R. Izdatel'stvo Akademii Nauk S.S.S.R., Moscow and Leningrad, 566 p. [In Russian; English translation 1964, Israel Program for Scientific Translations, Jerusalem.]

Artedi, P. 1738. Ichthyologia sive opera omnia de Piscibus, 118 p. Apud C. Wishoff, Leiden, Netherlands.

Briggs, J. C. 1995. Global biogeography, 452 p. Elsevier Science BV, Amsterdam.

Cope, E. D. 1873. A contribution to the ichthyology of Alaska. Proc. Am. Philos. Soc. 13:24-32. Article

De Kay, J. E. 1842. Zoology of New-York, or the New-York fauna; comprising detailed descriptions of all the animals hitherto observed within the state of New-York, with brief notices of those occasionally found near its borders, and accompanied by appropriate illustrations. Part IV: fishes, 415 p. W. & A. White & J. Visscher, Albany, NY.

Duncker, G., and E. Mohr. 1939. Revision der Ammodytidae. Mitt. Zool. Mus. Berl. 24(11:8-31.

Eschmeyer, W. N. (ed.). 2013. Catalog of fishes. [Available from http://research. calacademy.org/research/ichthyology/catalog/fishcatmain.asp, accessed 12 August 2013.]

Excoffier, L. and H. E. L. Lischer 2010. Arlequin suite, ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 10:564-567. Article

Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791. Article

Field, L. J. 1988. Pacific sand lance, Ammodytes hexapterus, with notes on related Ammodytes species. In Species synopses: life histories of selected fish and shellfish of the northeast Pacific and Bering Sea (N. Wilimovsky, I. C.

Incze, and S. J. Westrheim, eds.), p. 15-33. University of Washington, Washington Sea Grant Program and Fisheries Research Institute, Seattle, WA.

Furness, R. W. 2002. Management implications of interactions between fisheries and sandeel-dependent seabirds and seals in the North Sea. ICES J. Mar. Sci. 59:261-269. Article

Gill, T. N. 1861. Catalogue of the fishes of the eastern coast of North America, from Greenland to Georgia. Proc. Acad. Nat. Sci. Philad. 13 (suppl.):l-63.

Girard, C. F. 1856. Contributions to the ichthyology of the western coast of the United States, from specimens in the Museum of the Smithsonian Institution. Proc. Acad. Nat. Sci. Philad. 8:131-137.

Grant, W. S., and B. W. Bowen. 1998. Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines and anchovies and lessons for conservation. J. Heredity 89(51:415-426. Article

Hamada, T. 1985. Fishery biology of the sand-lance (Ammodytes personatus Girard) in Japan, 26 p. Japan Fisheries Resource Conservation Association, Tokyo.

Han Z., T. Yanagimoto, Y. Zhang, and T. Gao. 2012. Phylogeography study of Ammodytes personatus in northwestern Pacific: Pleistocene isolation, temperature and current conducted secondary contact. PLoS ONE 7(5): e37425. Article

Hart, J. L. 1973. Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180, xii + 740 p. [reprinted 1975, 1980, 1988].

Hashimoto, H. 1984. Population structure of the sandeel around Japan. Bull. Japan. Soc. Sci. Fish. 50(81:1357-1365.

Hashimoto, H., and T. Kawasaki. 1981. Population studies of the sandeel, Ammodytes personatus (Girard), in Sendai Bay, and its neighborhood. Tohoku J. Agric. Res. 31(4): 173-197. Article

Hatooka, K. 2000. Ammodytidae. In Fishes of Japan with pictorial keys to the species, 2nd edition (T. Nakabo, ed.), p. 1074, 1599. Tokai Univ. Press, Tokai. [In Japanese.]

Hatooka, K. 2002. Ammodytidae. In Fishes of Japan with pictorial keys to the species, English edition (T. Nakabo, ed.), p. 1074, 1590. Tokai Univ. Press, Tokai.

Hatooka, K. 2013. Ammodytidae. In Fishes of Japan with pictorial keys to the species, 3rd edition (T. Nakabo, ed.), p. 1276, 2095-2096. Tokai Univ. Press, Tokai. [In Japanese.]

Hubbs, C. L., and K. F. Lagler. 1958. Fishes of the Great Lakes region, revised ed., 213 p. Cranbrook Inst. Sci., Bull. 26.

Ida, H., P. Sirimontaporn, and S. Monkolprasit. 1994. Comparative morphology of the fishes of the family Ammodytidae, with a description of two new genera and two new species. Zool. Stud. 33:251-277.

Ida, H. 1984. Ammodytidae. In Fishes of the Japanese Archipelago (H. Masuda, K. Amaoka, C. Araga, T. Uyeno, T. Yoshimo, and K. Muzik, eds.), p. 222, pi. 217. Tokyo Univ. Press, Tokyo.

Jordan, D. S. 1906. A review of sand lance or Ammodytidae of the waters of Japan. Proc. U. S. Natl. Mus. 30:715-719. Article

Kawamura, T. 1940. On the local difference of the number of vertebrae in Ammodytes personatus Girard. Suisangaku-Zasshi (J. Fish.) 46:80-83, figs. 1-3. [In Japanese.]

Kim, J. K., J. Y. Park, and Y. S. Kim. 2006. Genetic diversity, relationships and demographic history of three geographic populations of Ammodytes personatus (Ammodytidae) from Korea inferred from mitochondrial DNA Control region and 16s rRNA sequence data. Korean J. Gen. 28(4):343-351.

Kim, J. K., J. H. Park, Y. S. Kim, Y. H. Kim, H. J. Hwang, S. J. Hwang, S. I. Lee, and T. I. Kim. 2008. Geographic variations in Pacific sand eels Ammodytes personatus (Ammodytidae) from Korea and Japan using multivariate morphometric analysis. J. Ichthyol. 48:904-910. Article

Kim, J. K., W. Watson, J. Hyde, N. Lo, J. Y. Kim, S. Kim, and Y. S. Kim. 2010. Molecular identification of Ammodytes (Pisces, Ammodytidae) larvae, with ontogenetic evidence on separating populations. Gen. Genom. 32:437-445. Article

Kitaguchi, T.

1979. A taxonomic study of sand lances (genus Ammodytes) in the waters of northern coast of Hokkaido, Japan. Sci. Rep. Hokk. Fish. Exp. Sta. 54(31:17-30.

Lacepede, B. G. E.

1800. Histoire naturelle des poissons, vol. 2, 632 p. Plassan, Paris.

Ladiges, W., G. von Wahlert, and E. Mohr.

1958. Die Typen und Typoide der Fischsammlung des Hamburgischen Zoologischen Staatsinstituts und Zoologischen Museums. Mitt. Hamburg. Zoolog. Inst. 56:155-167.

Leviton, A. E., R. H. Gibbs Jr., E. Heal, and C. E. Dawson.

1985. Standards in herpetology and ichthyology: part I. Standard symbolic codes for institutional resource collections in herpetology and ichthyology. Copeia 1985:802-832.

Lindberg, G. U.

1937. On the classification and distribution of sandlances genus Ammodytes (Pisces). Bull. Far East. Br. Acad. Sci. USSR 27:85-93. [In Russian; English summary.]

Lindberg, G. U., and Z. V. Krasyukova.

1975. Fishes of the Sea of Japan and the adjacent areas of the Sea of Okhotsk and the Yellow Sea. Keys to the Fauna of the USSR 108, 602 p. Nauka, Leningrad. [In Russian; English translation, 1989, Smithsonian Institution Libraries, National Science Foundation, Amerind Publishing Co., New Delhi, India.]

Linnaeus, C.

1758. Systema naturae, ed. X. (Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.), 824 p. Impensis Direct. Laurentii Salvii, Stockholm, Sweden.

Logerwell, E. A., K. Aydin, S. Barbeaux, E. Brown, M. E. Conners, S. Lowe, J. W. Orr, I. Ortiz, R. Reuter, L. Schaufler, and P. Spencer.

2005. Geographic patterns in the demersal ichthyofauna of the Aleutian Islands shelf. Fish. Oceanogr. 14(suppl. 11:1-20.

Love, M., C. W. Mecklenburg, T. A. Mecklenburg, and L. K. Thorsteinson.

2005. Resource inventory of marine and estuarine fishes of the West Coast and Alaska, 288 p. US Geological Survey, Biological Resources Division. OCS Study MMS 2005-030 and USGS/NBII 2005-001.

McCusker, M. R., D. Denti, L.Van Guelpen, E. Kenchington, and P. Bentzen.

2013. Barcoding Atlantic Canada's commonly encountered marine fishes. Mol. Ecol. Res. 13:177-188. Article

Mecklenburg, C. W., T. A. Mecklenburg, and L. K. Thorsteinson.

2002. Fishes of Alaska, xxxvii + 1037 p. Am. Fish. Soc., Bethesda, MD.

Mecklenburg, C. W., P. R. Moller, and D. Steinke.

2011. Biodiversity of Arctic marine fishes: taxonomy and zoogeography. Mar. Biodiv. 41:19-140. Article

Miller, D. J., and R. N. Lea.

1972. Guide to the coastal marine fishes of California, 235 p. Calif. Dep. Fish Game, Sacramento, Fish Bull., vol. 5, 157.

Nei, M., and S. Kumar.

2000. Molecular evolution and phylogenetics, 333 p. Oxford Univ. Press, New York.

Nelson, J. S.

2006. Fishes of the World, 4th ed., 601 p. Wiley & Sons, Hoboken, NJ.

Nelson, J. S, E. J. Crossman, H. Espinosa-Perez, L. T. Findley, C. R. Gilbert, R. N. Lea, and J. D. Williams.

2004. Common and scientific names of fishes from the United States, Canada, and Mexico, 6th ed., 386 p. Am. Fish. Soc., Bethesda, MD. Article

Nizinski, M. S., B. B. Collette, and B. B. Washington.

1990. Separation of two species of sand lances, Ammodytes americanus and A. dubius, in the western North Atlantic. Fish. Bull. 88:241-255.

Okamoto, H.

1989. A genetic comparison of sympatric populations of sand lance (genus Ammodytes) from the region east of Cape Soya, Japan. Can. J. Fish. Aquat. Sci. 46:1945-1951.

Ohshima, Y.

1950. Biological notes on the sand-eel Ammodytes personatus Girard. Bull. Japan. Soc. Sci. Fish. 16(3): 99-107. Article

Page, L. M., H. Espinosa-Perez, L. T. Findley, C. R. Gilbert, R. N.

Lea, N. E. Mandrak, R. L. Mayden, and J. S. Nelson.

2013. Common and scientific names of fishes from the United States, Canada, and Mexico, 7th ed., 243 p. Am. Fish. Soc., Bethesda, MD.

Pallas, P. S.

1814. Zoographia Rosso-Asiatica, sistens omnium animalium in extenso Imperio Rossico et adjacentibus maribus observatorum recensionem, domicilia, mores et descriptiones anatomen atque icones plurimorum. 3 vols. [1811-1814]., V. 3: i-vii + 1-428 + index (I-CXXV), Pis. 1, 13, 14, 15, 20 and 21. Academie Scientiarum Impress, St. Petersburg, Russia.

Pietsch, T. W.

1984. Enlarged cartilages in the protrusible upper jaws of teleost fishes: phylogenetic and functional implications. Copeia 1984:1011-1015. Article

Popov, A. M.

1931. Contribution to the study of the ichthyofauna of the Okhotsk Sea. Issled. Morey SSSR, Leningrad No. 14: 121-154. [In Russian; German summary.]

Rafinesque, C. S.

1810. Caratteri di alcuni nuovi generi e nuove specie di animali e piante della Sicilia, con varie osservazioni sopra i medisimi, 106 p. Sanfilippo, Palermo, Italy.

Raitt, D. S.

1934. A preliminary account of the sandeels of Scottish waters. J. Conseil Int. Expl. Mer 9:365-372.

Randall, J. E., and P. C. Heemstra.

2008. Ammodytoides xanthops, a new species of sandlance (Perciformes: Ammodytidae) from Mozambique. Smithiana, Publ. Aquat. Biodiv., Bull. 9:21-25.

Randall, J. E., and H. Ida.

2014. Three new species of sand lances (Perciformes: Ammodytidae) from the southwest Indian Ocean. J. Ocean Sci. Found. 12:1-11.

Reinhardt, J. C. H.

1837. Ichthyologiske bidrag til den Gronlandske fauna. Indledning, indeholdende tillaeg og forandringer i den fabriciske fortegnelse paa Gronlandske hvirveldyr. Det Kongelige Danske videnskabernes selskabs naturvidenskabelige og mathematiske afhandlinger 7:83-196

Saitou, N. and M. Nei.

1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.

Sherman, K, C. Jones, L. Sullivan, W. Smith, P. Berrien, and L. Ejsymont.

1981. Congruent shifts in sandeel abundance in western and eastern North Atlantic ecosystems. Nature 291:486-489.

Shibukawa, K., and H. Ida.

2013. Ammodytoides kanazawai, a new species of sand lance (Perciformes: Ammodytidae) from the Ogasawara Islands, Japan. Bull. Natl. Mus. Nat. Sci., ser. A, suppl. 7:25-30.

Spalding, M. D., H. E. Fox, G. R. Allen, N. Davidson, Z. A. Ferdana, M. Finlayson, B. S. Halpern, M. A. Jorge, A. Lombana, S. A. Lourie, K. D. Martin, E. Mcmanus, J. Molnar, C. A. Recchia, and J. Robertson.

2007. Marine ecoregions of the World: a bioregionalization of coastal and shelf areas. BioScience 57(71:573-583. Article

Svetovidov, A. N.

1978. The types of the fish species described by P. S. Pallas in "Zoographia Rosso-Asiatic" (with a historical account of publication of this book). Nauka, Leningrad, 32 p. [In Russian.]

1981. The Pallas fish collection and the Zoographia Rosso-Asiatica: an historical account. Arch. Nat. Hist. 10(11:45-64.

Tajima, F.

1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123(3): 585-595.

Tamura, K., and M. Nei.

1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Bio. Evol. 10:512-526.

Tamura, K., G. Stecher, D. Peterson, A. Filipski, and S. Kumar.

2013. MEGA6: Molecular evolutionary gnetics analysis version 6.0. Mol. Biol. Evol. 30:2725-2729. Article

Turanov, S. V., and Yu. Ph. Kartavtsev.

2014. The taxonomic composition and distribution of sand lances from the genus Ammodytes (Perciformes: Ammodytidae) in the North Pacific. Russ. J. Mar. Biol. 40:447-454.

Walbaum, J. J.

1792. Petri Artedi Sueci Genera piscium in quibus systema totum ichthyologiae proponitur cum classibus, ordinibus, generum characteribus, speeierum differentiis, observationibus plurimis. Redactis speciebus 242 ad genera 52. Ichthyologiae, Pars III. Emendata et aucta a lohanne lulio Walbaum, 723 p., 3 pis. Impensis Ant. Ferdin. Roese, Grypeswaldiae.

Wooding, S.

2004. Natural selection: sign, sign, everywhere a sign. Curr. Biol. 4:R700-R701. Article

Xia, X.

2013. DAMBE5: a comprehensive software package for data analysis in molecular biology and evolution. Mol. Biol. Evol. 30:1720-1728. Article

Xia, X., Z. Xie, M. Salemi, L. Chen, and Y. Wang. 2003. An index of substitution saturation and its application. Mol. Phylogenet. Evol. 26:1-7. Article

James W. Orr (contact author) [1]

Sharon Wildes [2]

Yoshiaki Kai [3]

Nate Raring [1]

T. Nakabo [4]

Oleg Katugin [5]

Jeff Guyon [2]

Email address for contact author: james.orr@noaa.gov

[1] Resource Assessment and Conservation Engineering Division Alaska Fisheries Science Center National Marine Fisheries Service, NOAA 7600 Sand Point Way NE Seattle, Washington 98115-6349

[2] Auke Bay Laboratories Alaska Fisheries Science Center National Marine Fisheries Service, NOAA 17109 Point Lena Loop Road Juneau, Alaska 99801-8344

[3] Maizuru Fisheries Research Station Field Science Education and Research Center Kyoto University Nagahama, Maizuru Kyoto 625-0086, Japan

[4] The Kyoto University Museum Kyoto University Yoshida, Sakyo Kyoto 606-8501, Japan

[5] Pacific Research Institute of Fisheries and Oceanography (TINRO-Center) 4 Shevchenko Alley

Manuscript submitted 6 February 2014.

Manuscript accepted 30 January 2015.

Fish. Bull. 113:129-156 (2015). Electronic publication date: 10 March 2015.

doi: 10.7755/FB.113.2.3

http://zoobank.org/References/29FEAF578178-45DB-8A23-76BE33BB2B0D

The views and opinions expressed or implied in this article are those of the author (or authors) and do not necessarily reflect the position of the National Marine Fisheries Service, NOAA.

(1) Willson, M. F., R. H. Armstrong, M. D. Robards, and J. F. Piatt. 1999. Sand lance as cornerstone prey for predator populations. In Sand lance: a review of biology and predator relations and annotated bibliography (M. D. Robards, M. F. Willson, R. H. Armstrong, and J. F. Piatt, eds.), p. 17-44. Research Paper PNWRP-521. U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. Portland OR. [http:// www.fs.fed.us/pnw/pubs/rp_521a.pdf]

(2) Mention of trade names or commercial companies is for identification purposes only and does not imply endorsement by the National Marine Fisheries Service, NOAA.

(3) Williams, J. 2013. Personal commun. Department of Vertebrate Biology, National Museum of Natural History, Smithsonian Institution, Suitland, MD 20746. Vladivostok, Primorsky Kray, Russia, 690950

Table 1

Geographic area of collections and other details about the
collections of tissues that were used in molecular analysis of
species of Ammodytes in the region of the North Pacific Ocean.
per=A. personatus; hex=A. hexapterus; ja=A. japonicus; and hn=A.
heian new species, uncat.=uncataloged.

Area of collection                Latitude   Longitude   Number

Eastern North Pacific Ocean
  Humboldt Bay, CA                 40.75      -124.23      10
  San Juan Islands, WA             48.69      -123.02      9

  San Juan Islands, WA             48.57      -123.05      12

Gulf of Alaska
  Red Bluff Bay                    56.51      -134.45      10
  Gastineau Channel, off Juneau    58.22      -134.35      10
  Yakutat Bay                      60.02      -142.26      9
  Prince William Sound             60.51      -147.62      9
  Resurrection Bay, Kenai
    Peninsula                      59.97      -149.38      10
  Deadman Bay                      57.02      -153.59      9

Eastern Bering Sea
  Cold Bay (haul 4)                55.51      -163.02      6
  Bristol Bay                       56.6      -159.7       1
  Bristol Bay                      58.29      -160.8       1
  Bristol Bay                       58.6      -163.3       1
  Kuskokwim Bay (haul 33)          58.99      -165.06      48
  Kuskokwim Bay (hauls 15, 16,
    18,19,41)                      58.67      -165.02      52
  Kuskokwim Bay                     59.3      -166.6       2
  Nunivak Island (haul 64)         59.49      -166.96      10
  Norton Sound (haul 58)            64.2      -165.14      14
  Norton Sound                     64.02      -164.01      1

Aleutian Islands
  Unalaska, Summer Bay             53.54      -166.28      10
  Attu Island                        53         174        18

Eastern Chukchi Sea
  Chukchi Sea                      70.05      -167.81      44
  Chukchi Sea                      70.05      -167.81      8
  Chukchi Sea                      67.404    -173.604      19
  Chukchi Sea                      70.049    -167.861      16

Russia
  Western Bering Sea, sample A       62         177        10
  Western Bering Sea, sample B     64.54      179.32       10
  Sea of Okhotsk, off Sakhalin
      Island                       51.57      144.24       10
  Sea of Okhotsk, off Sakhalin
    Island                         52.54      144.12       10

Japan
  Soya Strait, offWakkanai,
    Hokkaido                       45.55      142.23       25
  Seto Inland Sea, Akashi,
    Hyogo                          34.38        135        30

  Nohara Maizuru, Kyoto            35.45       135.3       12
  Ise Bay                          34.73      136.68       50
  Ofunato, Iwate                    38.5       141.8       6

Area of collection                     Species         Catalog number

Eastern North Pacific Ocean
  Humboldt Bay, CA                       per             UW 152676
  San Juan Islands, WA                   per           UW 116044-45,
                                                         116047-53
  San Juan Islands, WA                   per           UW 116055-60,
                                                         116066-71
Gulf of Alaska
  Red Bluff Bay                          per            ABL 13-0001
  Gastineau Channel, off Juneau          per            ABL 13-0002
  Yakutat Bay                            per            ABL 13-0003
  Prince William Sound                   per            ABL 13-0004
  Resurrection Bay, Kenai
    Peninsula                            per            ABL 13-0005
  Deadman Bay                            per             UW 152349

Eastern Bering Sea
  Cold Bay (haul 4)                      per             ABL uncat.
  Bristol Bay                            per             UW 116220
  Bristol Bay                            per             UW 116219
  Bristol Bay                            per             UW 116221
  Kuskokwim Bay (haul 33)           per=43, hex=5        ABL uncat.
  Kuskokwim Bay (hauls 15, 16,
    18,19,41)                       per=50, hex=2        ABL uncat.
  Kuskokwim Bay                          hex            UW 116222-23
  Nunivak Island (haul 64)               per             ABL uncat.
  Norton Sound (haul 58)            per=l, hex=13        ABL uncat.
  Norton Sound                           hex             UW 150610

Aleutian Islands
  Unalaska, Summer Bay                   per             ABL uncat.
  Attu Island                            per           UW 116092-99,
                                                         116200-207

Eastern Chukchi Sea
  Chukchi Sea                            hex             UW 150610
  Chukchi Sea                            hex             UW 150611
  Chukchi Sea                            hex           UAM 1255, 2813
  Chukchi Sea                            hex             ABL uncat.

Russia
  Western Bering Sea, sample A           hex            ABL 11-0005
  Western Bering Sea, sample B           hex            ABL 11-0004
  Sea of Okhotsk, off Sakhalin
      Island                             hex            ABL 11-0007
  Sea of Okhotsk, off Sakhalin
    Island                               hex            ABL 11-0006

Japan
  Soya Strait, offWakkanai,
    Hokkaido                      hex=13, ja=3, hn=9     UW 116840
  Seto Inland Sea, Akashi,
    Hyogo                                 ja                FAKU
                                                       130979-131008
  Nohara Maizuru, Kyoto                   ja             UW 153060
  Ise Bay                                 ja             UW 153061
  Ofunato, Iwate                          hn            FAKU 130767-
                                                           130774

Table 2

Genetic distance calculated in MEGA 6 (Tamura et al., 2013) with the
Tamura and Nei (1993) model for species of Ammodytes.  On the
diagonal, which is indicated with a gray background, is the range of
distances among haplotypes within each species. Mean distance
between each species pair is below the diagonal. Above the diagonal
is the range of distances among all haplotypes between each species
pair. Ammodytes dubius and A. americanus are reported together
because the samples exhibited identical sequence patterns.

                      hexapterus    personatus     japonicus

hexapterus             0-0.004     0.029-0.043    0.059-0.074
personatus              0.031        0-0.013      0.056-0.077
japonicus               0.065         0.065         0-0.013
heian                   0.047         0.049          0.068
marinus                 0.005         0.027          0.063
dubius / americanus      0.04         0.043          0.068
tobianus                0.048         0.058          0.079
Uranoscopus             0.276         0.282          0.277

                                                      dubius/
                         heian         marinus       americanus

hexapterus            0.044-0.052    0.004-0.005    0.033-0.047
personatus            0.043-0.056    0.022-0.032    0.034-0.049
japonicus             0.063-0.076    0.059-0.070    0.059-0.082
heian                   0-0.007      0.040-0.046    0.051-0.063
marinus                  0.042            0         0.032-0.041
dubius / americanus      0.057          0.036         0-0.009
tobianus                 0.062          0.044          0.055
Uranoscopus              0.268          0.282          0.286

                        tobianus     Uranoscopus

hexapterus            0.044-0.051    0.274-0.280
personatus            0.052-0.066    0.276-0.290
japonicus             0.070-0.087    0.274-0.282
heian                 0.057-0.068    0.265-0.273
marinus               0.042-0.045       0.282
dubius / americanus   0.049-0.059    0.281-0.289
tobianus                 0.004       0.276-0.282
Uranoscopus              0.279            0

Table 3

Genetic indices for the 4 species of Ammodytes of the North Pacific
region. n=sample size; H=number of haplotypes; S=number of
polymorphic sites; h=haplotype diversity; [pi]=average nucleotide
diversity; and SE=standard error.

                   n    H    S       h (SE)         [phi] (SE)

A. hexapterus     143   6    5    0.1500 (0.39)   0.0002 (0.0003)
A. personatus     229   75   64   0.8100 (0.02)   0.0030 (0.0020)
A. japonicus      95    47   47   0.8471 (0.36)   0.0049 (0.0029)
A. heian n. sp.   15    8    8    0.8476 (0.08)   0.0027 (0.0019)

Table 4

Cytochrome oxidase c subunit 1 sequences of Ammodytes of the North
Pacific region mined from GenBank (www.ncbi.nlm.nih.gov) and
Barcode of Life Database (BOLD; www.boldsystems.org) with GenBank
accession number, BOLD sequence identification (ID), general
location of collection, current name assigned to the sequence data
in GenBank and BOLD (Current ID), and "revised" name (Revised ID),
which refers to the species in this study with which the sequence
aligned.

GenBank         BOLD          Location         Current ID   Revised ID
accession       sequence ID

A. hexapterus
  HQ712266      DSFAL117-07   Chukchi Sea      hexapterus   hexapterus
  HQ712267      DSFAL118-07   Chukchi Sea      hexapterus   hexapterus
  HQ712268      DSFAL157-07   Chukchi Sea      hexapterus   hexapterus
  HQ712269      DSFAL282-07   N. Bering Sea    hexapterus   hexapterus
  HQ704752                    N. Bering Sea    hexapterus   hexapterus
  HQ704753                    N. Bering Sea    hexapterus   hexapterus
  HQ704754                    N. Bering Sea    hexapterus   hexapterus
  HM421764      DSFAL626-09   Chukchi Sea      hexapterus   hexapterus
  HM421765      DSFAL627-09   Chukchi Sea      hexapterus   hexapterus
                DSFIB095-11   Arctic Ocean     hexapterus   hexapterus
                DSFAL703-11   Arctic Ocean     hexapterus   hexapterus
                DSFAL709-11   Arctic Ocean     hexapterus   hexapterus
                DSFAL712-11   Arctic Ocean     hexapterus   hexapterus
                DSFIB090-11   Arctic Ocean     hexapterus   hexapterus
                TZAIC156-05   Hudson Bay       hexapterus   hexapterus
                TZAIC160-05   Hudson Bay       hexapterus   hexapterus
                TZAIC 176-05  Hudson Bay       hexapterus   hexapterus
A. personatus
  FJ666917      GBGC9217-09   Bering Sea       hexapterus   personatus
  FJ666918      GBGC9216-09   Bering Sea       hexapterus   personatus
  FJ666919      GBGC9215-09   Bering Sea       hexapterus   personatus
  FJ666920      GBGC9214-09   Bering Sea       hexapterus   personatus
  FJ666921      GBGC9213-09   Bering Sea       hexapterus   personatus
  HQ712264      DSFAL019-07   Kodiak Island    cf.          personatus
                                               personatus
  HQ712265      DSFAL257-07   Kodiak Island    cf.          personatus
                                               personatus
                FMV428-09     Vancouver        hexapterus   personatus
                              Island, BC
                FMV429-09     Vancouver        hexapterus   personatus
                              Island, BC
A. japonicus
  FJ666901      GBGC9212-09   Yellow Sea       personatus   japonicus
  FJ666902      GBGC9211-09   Yellow Sea       personatus   japonicus
  FJ666903      GBGC9210-09   Yellow Sea       personatus   japonicus
  FJ666904      GBGC9209-09   Yellow Sea       personatus   japonicus
  FJ666905      GBGC9208-09   Yellow Sea       personatus   japonicus
  FJ666906      GBGC9207-09   Yellow Sea       personatus   japonicus
  FJ666907      GBGC9206-09   Yellow Sea       personatus   japonicus
  FJ666908      GBGC9219-09   East China Sea   personatus   japonicus
  FJ666909      GBGC9218-09   East China Sea   personatus   japonicus
  FJ666910      GBGC9205-09   Sea of Japan     personatus   japonicus
                              (=East Sea)
  FJ666911      GBGC9204-09   Sea of Japan     personatus   japonicus
                              (=East Sea)
  FJ666912      GBGC9203-09   Sea of Japan     personatus   japonicus
                              (=East Sea)
  FJ666913      GBGC9202-09   Sea of Japan     personatus   japonicus
                              (=East Sea)
  FJ666914      GBGC9201-09   Sea of Japan     personatus   japonicus
                              (=East Sea)
  EU266366      GBGC7790-09   no location      personatus   japonicus
                              noted
  HQ711864      ANGBF1790-12  Shandong, China  personatus   japonicus
  JQ738429      ANGBF2227-12  no location      personatus   japonicus
                              noted
  JQ738549      ANGBF2283-12  no location      personatus   japonicus
                              noted
  JQ738551      ANGBF2284-12  no location      personatus   japonicus
                              noted
  JQ738553      ANGBF2285-12  no location      personatus   japonicus
                              noted
  JQ738552      ANGBF4508-12  no location      personatus   japonicus
                              noted
  JQ738550      ANGBF4509-12  no location      personatus   japonicus
                              noted
  JQ738428      ANGBF4565-12  no location      personatus   japonicus
                              noted
A. heian n.
    sp.
  FJ666915      GBGC9200-09   Sea of Japan     personatus   heian
                              (=East Sea)
  FJ666916      GBGC9199-09   Sea of Japan     personatus   heian
                              (=East Sea)

Table 5

Proportional morphometric and meristic characters of species of
Ammodytes of the North Pacific region, based on genetically
identified specimens for which all of both types of data were
collected. Standard length (SL) and head length are given in
millimeters. Morphometric data are given in percent SL and
presented as the range, followed by the mean and standard deviation
(SD). Species listed in superscript are statistically different
from the species in ordinary type, as determined by analysis of
covariance or Kruskal-Wallis (KW) tests as appropriate. pr=A.
personatus; hx=A. hexapterus', ja=A. japonicus; hn=A. heian new
species (n. sp.); and NS=nonsignificant.

                             A. hexapterus          A. personatus

                               Range                  Range
                          n    (Mean [SD])       n    (Mean [SD])

Standard length          63    89.0-257.3       73    61.2-273.6
                               (149.6 [46.2])         (148.9 [85.2])
Head length              63    18.7-23.3        73    18.8-25.4
                               (20.7 [1.1])           (22 [2.2])

Morphometries
Orbit length             63    2.3-4.0          73    2.3-5.1
                               (3.1 [0.5])            (3.6 [0.9])

Orbit depth              63    2.5-4.0          73    2.3-4.8
                               (3.2 [0.4])            (3.5 [0.8])

Depth at dorsal-         63    6.1-10.7         73    6.7-11.6
  fin origin                   (8.6 [1.1])            (8.8 [1.2])
Depth at anal-           63    6.0-10.3         73    6.7-11.1
  fin origin                   (8.2 [1.1])            (8.6 [0.9])

Snout length             63    4.7-6.9          73    5.1-7.0
                               (5.7 [0.4])            (5.9 [0.5])

Interorbital width       63    1.9-3.5          73    2.6-3.7
                               (2.7 [0.4])            (3.2 [0.2])
Upper jaw length         63    5.8-7.8          73    4.8-8.9
                               (6.6 [0.5])            (7.2 [1])

Lower jaw length         63    8.2-10.3         73    7.5-11.5
                               (9.0 [0.5])            (9.6 [1.2])


Gill raker length        63    1.6-2.9          73    1.5-3.0
                               (2.1 [0.2])            (2.2 [0.3])
Prepectoral process      63    1.2-3.7          73    1.0-3.0
  length                       (2.0 [0.4])            (2.0 [0.4])
Pectoral-fin base        63    1.9-2.7          73    2.1-3.3
  depth                        (2.3 [0.2])            (2.6 [0.3])

Pectoral fin length      63    8.5-11.8         73    8.2-13.4
                               (10.1 [0.7])           (10.5 [1.6])

Caudal fin length        63    8.0-10.9         73    8.0-11.4
                               (9.4 [0.6])            (9.6 [1.1])
Caudal peduncle          63    2.1-3.1          73    2.3-3.0
  depth                        (2.6 [0.2])            (2.7 [0.2])

Caudal peduncle          63    4.2-5.7          73    3.9-5.9
  length                       (5.1 [0.3])            (4.9 [0.4])

Predorsal length         63    24.9-29.8        73    23.1-30.8
                               (27.2 [1.3])            (27.2 [2.1])

Preanal length           63    60.3-67.4        73    61.8-69.1
                               (64.3 [1.6])            (65.5 [1.4])

Dorsal-fin base length   63    63.8-71.4        73    63.2-74.0
                               (68 [1.5])             (68.3 [3.1])

Anal-fin base length     63    27.6-32.6        73    26.8-32.4
                               (30.2 [1])             (29.6 [1.1])
Prepectoral length       63    17.7-22.5        73    17.9-24.5
                               (19.6 [1.2])           (21.0 [1.8])

Meristics
Dorsal-fin rays          63    56-63            73    56-65
                               (58.9 [1.5])           (60.4 [2.8])

Anal-fin rays            63    27-33            73    27-33
                               (30.1 [1.3])           (29.5 [1.5])

Anterior anal-fin        63    8-14             73    7-13
  pterygiophores               (10.8 [1.6])           (9.8 [1.3])

Pectoral-fin rays        63    13-16            73    13-16
                               (14.5 [0.6])           (14.3 [0.8])
Pigmented pectoral-      58    2-6              34    3-7
  fin rays                     (4.2 [0.9])            (5.3 [0.9])

Gill rakers (total)      63    24-29            73    24-30
                               (26.7 [1.1])           (27.3 [1.5])

Gill rakers              63    4-6              73    4-6
  (upper arch)                 (4.5 [0.6])            (4.9 [0.4])

Gill rakers              63    20-24            73    19-26
  (lower arch)                 (22.2 [1])             (22.5 [1.5])
Pseudobranchs            19    8-16             37    9-19
                               (10.5 [1.9])           (12.1 [2.6])

Lateral line pores       63    121-152          73    114-158
                               (137.2 [7.9])          (132.2 [8.4])
Dermal plicae            63    143-172          73    139-179
                               (159.5 [8.0])          (155.3 [8.2])

Precaudal vertebrae      63    42-47            73    42-49
                               (44.1 [1.2])           (44.8 [1.7])
Caudal vertebrae         63    21-27            73    23-26
                               (24.2 [1.3])           (24.4 [0.9])

Total vertebrae          63    66-71            73    66-73
                               (68.4 [1.1])           (69.1 [2])
Principal caudal-        63    14-17            68    13-18
  fin rays                     (15.2 [0.5])           (15.3 [0.8])

                              A. japonicus         A. heian n. sp.

                              Range                 Range
                         n    (Mean [SD])      n    (Mean [SD])

Standard length          60   86.0-162.3       17   119.6-225.9
                              (122.5 [27.5])        (204.7 [23.1])
Head length              60   17.6-22.2        17   18.8-22.1
                              (20.0 [1.4])          (19.7 [0.8])

Morphometries
Orbit length             60   2.3-3.8          17   2.1-3.4
                              (3.0 [0.4])           (2.5 [0.3])

Orbit depth              60   2.4-4.3          17   2.1-3.2
                              (3.3 [0.5])           (2.6 [0.2])

Depth at dorsal-         60   5.8-10.5         17   8.8-10.9
  fin origin                  (8.8 [1.0])           (9.8 [0.6])
Depth at anal-           73   6.7-11.1         17   8.7-10.9
  fin origin                  (8.9 [1.2])           (9.7 [0.6])

Snout length             60   4.8-6.4          17   5.1-6.2
                              (5.5 [0.4])           (5.5 [0.2])

Interorbital width       60   2.6-3.8          17   3.1-3.7
                              (3.1 [0.3])           (3.4 [0.2])
Upper jaw length         60   5.3-7.7          17   5.5-7.2
                              (6.4 [0.6])           (6.2 [0.4])

Lower jaw length         60   7.7-10.9         17   7.7-9.0
                              (8.9 [0.8])           (8.5 [0.3])

Gill raker length        60   1.4-3.0          17   1.7-2.6
                              (2.1 [0.4])           (2.1 [0.2])
Prepectoral process      60   1.3-2.7          17   1.5-3.0
  length                      (2.0 [0.3])           (2.4 [0.3])
Pectoral-fin base        60   2.0-3.0          17   2.0-2.7
  depth                       (2.5 [0.3])           (2.4 [0.2])

Pectoral fin length      60   7.6-10.7         17   7.7-10.5
                              (9.4 [0.7])           (8.8 [0.6])

Caudal fin length        60   7.2-11.9         17   8.6-10.1
                              (9.3 [0.8])           (9.2 [0.4])
Caudal peduncle          60   2.1-3.5          17   2.4-2.8
  depth                       (2.5 [0.2])           (2.5 [0.1])

Caudal peduncle          60   2.8-5.4          17   3.7-5.1
  length                      (3.9 [0.4])           (4.6 [0.4])

Predorsal length         60   22.6-27.8        17   23.5-27.3
                              (25.2 [1.4])          (25.7 [1.0])

Preanal length           60   60.8-69.9        17   60.7-66.2
                              (64 [1.3])            (63.5 [1.6])

Dorsal-fin base length   60   67.6-77.3        17   69.2-72.0
                              (71.2 [1.9])          (70.7 [0.9])

Anal-fin base length     60   30.0-34.8        17   28.9-34.6
                              (32.5 [0.9])          (32.1 [1.3])
Prepectoral length       60   16.5-21.3        17   17.3-20.4
                              (18.7 [1.3])          (18.5 [0.7])

Meristics
Dorsal-fin rays          60   53-60            17   55-60
                              (56.2 [1.5])          (57.9 [1.5])

Anal-fin rays            60   27-31            17   30-33
                              (29.2 [0.9])          (31.9 [1.0])

Anterior anal-fin        60   8-12             17   10-13
  pterygiophores              (10.0 [0.8])          (11.8 [0.8])

Pectoral-fin rays        60   13-17            17   14-17
                              (14.3 [0.7])          (15.0 [0.8])
Pigmented pectoral-      56   4-11             20   4-10
  fin rays                    (6.9 [1.5])           (5.9 [1.0])

Gill rakers (total)      60   21-29            17   26-30
                              (24.1 [1.6])          (27.9 [1.0])

Gill rakers              60   4-5              17   4-5
  (upper arch)                (4.6 [0.5])           (4.9 [0.4])

Gill rakers              60   17-24            17   21-25
  (lower arch)                (19.5 [1.4])          (23.1 [0.9])
Pseudobranchs            31   9-14             13   12-17
                              (10.4 [1.3])          (14.2 [1.9])

Lateral line pores       60   134-160          17   146-185
                              (147.3 [5.6])         (159.6 [9.0])
Dermal plicae            60   147-174          17   157-198
                              (160.2 [6.1])         (174.5 [8.6])

Precaudal vertebrae      60   37-43            17   39-43
                              (40.1 [1.1])          (41.8 [1.3])
Caudal vertebrae         60   21-25            17   22-25
                              (22.6 [0.8])          (23.6 [0.8])

Total vertebrae          60   60-66            17   63-67
                              (62.8 [1.2])          (65.3 [1.2])
Principal caudal-        60   15-18            17   15-17
  fin rays                    (15.4 [0.7])          (15.3 [0.7])

                                      Significance

Standard length

Head length              KW: <0.001   [hx.sup.Pr,ja,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.hx,pr]; [hn.sup.hx,pr]
Morphometries
Orbit length             KW: <0.001   [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.hx,pr,ja]
Orbit depth              KW: <0.001   [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.hx,pr,ja]
Depth at dorsal-         KW: <0.001   [hx.sup.hn]; [pr.sup.hn];
  fin origin                          [ja.sup.hn]; [hn.sup.hx,pr,ja]
Depth at anal-           KW: <0.001   [hx.sup.pr,ja,hn];
  fin origin                          [pr.sup.hx,hn];
                                      [ja.sup.hx,hn];
                                      [hn.sup.hx,pr,ja]
Snout length             KW: <0.001   [hx.sup.pr,ja];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.hx,pr]; [hn.sup.pr]
Interorbital width       KW: <0.001   All

Upper jaw length         KW: <0.001   [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr]; [hn.sup.hx,pr]
Lower jaw length         KW: <0.001   [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.pr,hx,ja]
Gill raker length        KW: <0.001   [hx.sup.pr]; [pr.sup.hx,ja];
                                      [ja.sup.pr]; hn
Prepectoral process      KW: <0.001   [hx.sup.hn]; [pr.sup.hn];
  length                              [ja.sup.hn]; [hn.sup.hx,prja]
Pectoral-fin base        KW: <0.001   [hx.sup.pr,ja,hn];
  depth                               [pr.sup.hx,ja,hn];
                                      [ja.sup.hx,hn]; [hn.sup.pr,hx]
Pectoral fin length      KW: <0.001   [hx.sup.ja,hn];
                                      [pr.sup.ja,hn];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.hx,pr,ja]
Caudal fin length        NS

Caudal peduncle          <0.001       [hx.sup.pr];
  depth                               [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn]; [hn.sup.pr,ja]
Caudal peduncle          <0.001       [hx.sup.ja,hn];
  length                              [pr.sup.ja,hn];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.hx,pr,ja]
Predorsal length         KW: <0.001   [hx.sup.ja]; [pr.sup.ja,hn];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.pr,ja]
Preanal length           <0.001       [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.hx,pr,ja]
Dorsal-fin base length   KW: <0.001   [hx.sup.ja,hn];
                                      [pr.sup.ja,hn];
                                      [ja.sup.hx,pr]; [hn.sup.hx,pr]
Anal-fin base length     <0.001       All

Prepectoral length       KW: <0.001   [hx.sup.ja,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.hx,pr]; [hn.sup.hx,pr]

Meristics
Dorsal-fin rays          KW: <0.001   [hx.sup.pr,ja];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hx,hn];
                                      [hn.sup.pr,ja]
Anal-fin rays            KW: <0.001   [hx.sup.pr,ja,hn];
                                      [pr.sup.hx,hn];
                                      [ja.sup.hx,hn];
                                      [hn.sup.pr,hx,ja]
Anterior anal-fin        KW: <0.001   [hx.sup.pr,ja,hn];
  pterygiophores                      [pr.sup.hx,hn];
                                      [ja.sup.hx,hn];
                                      [hn.sup.hx,pr,ja]
Pectoral-fin rays        <0.005       [hx.sup.hn]; [pr.sup.hn];
                                      [ja.sup.hn]; [hn.sup.hx,pr,ja]
Pigmented pectoral-      KW: <0.001   [hx.sup.pr,ja];
  fin rays                            [pr.sup.hx,ja];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.hx,ja]
Gill rakers (total)      <0.001       [hx.sup.pr,ja,hn];
                                      [pr.sup.hx,ja];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.hx,ja]
Gill rakers              KW: <0.001   [hx.sup.pr,hn];
  (upper arch)                        [pr.sup.hx,ja];
                                      [ja.sup.pr,hn]; [hn.sup.hx,ja]
Gill rakers              KW: <0.001   [hx.sup.ja,hn]; [pr.sup.ja];
  (lower arch)                        [ja.sup.pr,hx,hn]; [hn.sup.ja]
Pseudobranchs            <0.001       [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.hx,pr,ja]
Lateral line pores       <0.001       All

Dermal plicae            <0.001       [hx.sup.pr,hn];
                                      [pr.sup.hx,ja,hn];
                                      [ja.sup.pr,hn];
                                      [hn.sup.pr,hx,hn]
Precaudal vertebrae      KW: <0.001   All

Caudal vertebrae         KW: <0.001   [hx.sup.ja,hn];
                                      [pr.sup.ja,hn];
                                      [ja.sup.hx,pr,hn];
                                      [hn.sup.hx,pr,ja]
Total vertebrae          KW: <0.001   All

Principal caudal-        NS
  fin rays

Table 6

Counts of dorsal-fin rays, anal-fin rays, anterior anal-fin
pterygiophores, pectoral-fin rays, pigmented pectoral-fin rays, and
caudal-fin rays in species of Ammodytes of the North Pacific region.
Pigmented pectoral-fin rays are reported only for specimens  larger
than 100 mm in standard length.

                                    Dorsal-fin rays

                   50    51    52    53    54    55    56    57    58

A hexapterus                                            9    20    28
A. personatus                                     4    19    41    39
A. japonicus        1     5     4     6    12    21    20    12     7
A. heian n. sp.                                   2     2     3     6

                                     Dorsal-fin rays

                   59    60    61    62    63    64    65    66    n

A hexapterus       26    15    10     2     2                     113
A. personatus      56    50    40    18    17     8     1         293
A. japonicus        5     2                                        95
A. heian n. sp.     8     2                                        23

                         Anal-fin rays

                   25    26    27    28    29

A hexapterus                    2    18    22
A. personatus       1     1    15    44    65
A. japonicus              1     2    14    37
A. heian n. sp.

                          Anal-fin rays

                   30    31    32    33    n

A hexapterus       49    26    10     2   130
A. personatus     106    40    19     2   292
A. japonicus       24     8     3     1    90
A. heian n. sp.     3     7     5     8    23

                            Anterior anal-fin pterygiophores

                   7     8     9     10    11    12    13    14    n

A hexapterus        1     8    39    26    25    13     9     4   126
A. personatus       4    23    61    96    75    27     5         291
A. japonicus        1     6    24    36    12     4                83
A. heian n. sp.                       2     7    11     3          23

                          Pectoral-fin rays

                   13    14    15    16    17    n

A hexapterus        6    47    48     1         103
A. personatus      37   135    54     7         233
A. japonicus        6    50    32     2     1    91
A. heian n. sp.           7    11     4     1    23

                     Pigmented pectoral-fin rays

                   2     3     4     5     6     7

A hexapterus        3    14    25    18     3
A. personatus            19    20    28    12     5
A. japonicus                    3    10    14    15
A. heian n. sp.                 1     5     6     4

                         Pigmented pectoral-fin rays

                   8     9     10    11    n     7

A hexapterus                               63
A. personatus                              84     5
A. japonicus       14     6           1    63    15
A. heian n. sp.     3           1          20     4

                         Principal caudal-fin rays

                   13    14    15    16    17    18    n

A hexapterus              1    99    19     2         122
A. personatus       1     2   240    26     8     1   278
A. japonicus              2    73    13     5     1    94
A. heian n. sp.                19     2     2          23

Table 7

Counts of precaudal, caudal, total vertebrae, and gill rakers of the
lower arch in specimens of species of Ammodytes of the North Pacific
region that were analyzed in this study.

                                Precaudal vertebrae

                   36    37    38    39    40    41    42    43

A hexapterus                                1     2    14    32
A. personatus                                     2     9    52
A. japonicus        1    12     9    27    33    18     6     1
A. heian n. sp.                       2     5     1     9     6

                              Precaudal vertebrae

                   44    45    46    47    48    49    n

A hexapterus       52    19     9     3               132
A. personatus      80    66    51    25     9     1   295
A. japonicus                                          108
A. heian n. sp.                                        23

                                    Caudal vertebrae

                   21    22    23    24    25    26    27    28    n

A hexapterus        1     6    22    34    46    18     5         113
A. personatus       3     9    50   103    89    35     6         295
A. japonicus        5    23    43    23     8     3           2   107
A. heian n. sp.           2     6    14     1                      23

                                     Total vertebrae

                   59    60    61    62    63    64    65    66

A hexapterus                                            2     6
A. personatus                                           2    16
A. japonicus        1     3    16    29    45    18     5     1
A. heian n. sp.     2     7     2    10     2    23

                                   Total vertebrae

                   67    68    69    70    71    72    73    n

A hexapterus       26    44    35    16     3     1         133
A. personatus      43    62    61    42    39    27     4   296
A. japonicus                                                117
A. heian n. sp.

                          Lower gill rakers

                   16    17    18    19    20    21

A hexapterus                                4    12
A. personatus                   1     1    23    54
A. japonicus        2     9    12    25    19     5
A. heian n. sp.                 1           2     5

                          Lower gill rakers

                   22    23    24    25    26    n

A hexapterus       33    14     7     2          72
A. personatus      64    48    13    11     1   217
A. japonicus        2     3     4           1    82
A. heian n. sp.     9     5     1                23
COPYRIGHT 2015 National Marine Fisheries Service
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Orr, James W.; Wildes, Sharon; Kai, Yoshiaki; Raring, Nate; Nakabo, T.; Katugin, Oleg; Guyon, Jeff
Publication:Fishery Bulletin
Article Type:Report
Geographic Code:9JAPA
Date:Apr 1, 2015
Words:19473
Previous Article:Development of swimming speed and schooling behavior of juvenile white rockfish (Sebastes cheni) in relation to ambient light intensity.
Next Article:Direct observation of fishing effort, catch, and discard rates of charter boats targeting reef fishes in the northern Gulf of Mexico.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters