Printer Friendly

Synchronous Water-Clear Cell Double Parathyroid Adenomas: A Hitherto Uncharacterized Entity?

A Hitherto Uncharacterized Entity?

Water-clear cell (WCC) hyperplasia is a rare but well-documented cause of primary hyperparathyroidism. In classic WCC hyperplasia, all 4 parathyroid glands have finely vacuolated cells, although the glands may vary considerably in size and are seldom completely replaced by WCCs.[1] To our knowledge, only 2 previous cases of hyperparathyroidism due to WCC adenoma have been reported.[2,3] Herein, we describe a patient with synchronous WCC double parathyroid adenomas, an entity that has not previously been described.

REPORT OF A CASE

A 56-year-old woman with a palpable, 2.0-cm right thyroid nodule was found to have an elevated serum calcium level of 3.3 mmol/L (reference range, 2.13-2.63 mmol/L), with an inappropriately elevated intact parathyroid hormone level of 52 ng/L (reference range, 10-65 ng/L). The patient was asymptomatic. She did not have any history of renal calculi, and she did not have any family history of thyroid or parathyroid disease.

Her preoperative evaluation included sonography, which showed a 2.3-cm, solid right thyroid mass; a Sestamibi scan, which was nonlocalizing; a fine needle aspiration biopsy of the thyroid nodule, which showed cytological findings consistent with a colloid nodule; and a bone densitometry study, which showed osteopenia involving the lumbar spine and the femoral necks.

In December 1997, the patient underwent a bilateral parathyroid exploration and a right thyroid lobectomy and isthmectomy. The right side was explored first. The right superior parathyroid gland was enlarged, whereas the right inferior parathyroid was grossly within normal limits. The patient had indicated preoperatively that even if we encountered 1 enlarged parathyroid and 1 normal-sized parathyroid on the right side, she preferred a bilateral exploration because of her concern about the risk of persistent hyperparathyroidism (estimated at about 4% with unilateral exploration). During exploration of the left side of the neck, the left superior parathyroid gland was enlarged, whereas the left inferior parathyroid gland was grossly within normal limits. Both of the superior parathyroid glands were excised, followed by a right thyroid lobectomy and isthmectomy. The blood supply to the right inferior parathyroid could not be preserved. It was excised, confirmed with an incisional biopsy, and sent for cryopreservation. The left inferior parathyroid gland was confirmed with an incisional biopsy, marked with a hemoclip, and preserved in situ.

The patient's postoperative course has been uneventful. Her serum calcium level decreased to normal limits within a few days of surgery, and she has remained normocalcemic; the most recent serum calcium level, measured 2 years postoperatively, was 2.5 mmol/L (reference range, 2.13-2.63 mmol/L).

PATHOLOGIC EXAMINATION

Gross and Microscopic Evaluation

The hemithyroidectomy specimen revealed a 2.3-cm, partially cystic, encapsulated lesion in a vaguely nodular background. Histologically, the findings were consistent with a dominant nodule of nodular hyperplasia. The right and left superior parathyroid glands measured 2.8 and 1.5 cm and weighed 1700 and 500 mg, respectively. Both parathyroid glands showed histologically similar encapsulated lesions (Figures 1 and 2) composed of uniform, moderately sized sheets of WCCs. The cytoplasm was finely vacuolated (Figures 1, B, and 2, B). The nuclei showed minimal atypia, with finely stippled chromatin. The cells were aggregated in nests and were separated by fine fibrovascular septa. A minute rim of extracapsular, histologically unremarkable parathyroid tissue was present in each of the superior parathyroid glands. Incisional biopsy specimens of both inferior parathyroid glands showed histologically normal parathyroid tissue.

[Figures 1-2 ILLUSTRATION OMITTED]

Immunohistochemical and Ultrastructural Evaluation

The WCCs of the enlarged superior parathyroid glands were immunoreactive for parathyroid hormone (Dako, Carpinteria, Calif, at 1:25), cytokeratin AE1/3 (Boehringer-Mannheim, Indianapolis, Ind, at 1:8000), chromogranin (Biogenex, San Ramon, Calif, at 1:400), and synaptophysin (Dako at 1:100). Neither chief nor oxyphil cells were admixed with the WCCs.

Ultrastructural examination of formalin-fixed deparaffinized tissue from the 1700-mg right superior parathyroid gland showed numerous, fine intracytoplasmic vacuoles. Although of uncertain derivation, the ultrastructural appearance of these vacuoles was consistent with derivation from the Golgi apparatus.

X-Linked Clonality Analysis by Polymerase Chain Reaction

Formalin-fixed and paraffin-embedded tissue sections (4 [micro]m) were cut and collected onto slides. Two sections of each specimen were dewaxed in xylene for 10 minutes and rinsed thoroughly in absolute ethanol twice. The tissue sections were scraped off the slides, transferred into a microtube containing approximately 100 [micro]L of digestion solution (200 pg/mL of proteinase K in 1 x polymerase chain reaction [PCR] buffer), and digested at 37 [degrees] C overnight. DNA was extracted using the Promega Wizard Genomic DNA purification kit (Promega, Madison, Mich) following manufacturer's instructions. The DNA extract was dissolved in 50 [micro]L of water. Twenty microliters of the extract were digested with 10 U of HpaII (Boehringer Mannhelm, GmbH, Germany) at 37 [degrees] C overnight. To monitor the digestion efficiency, DNA was extracted from paraffin-embedded sections of a male thyroid gland and digested in parallel. For positive control, DNA from HL60 cell line (established from a female patient with leukemia) was also digested.

The PCR method used was adapted from a previous study[4] based on inactivation pattern of the human androgen receptor gene (HUMARA) with modification. Briefly, PCR was performed in 25 [micro]L of a reaction mixture containing 10 mmol/L Tris/HCL (pH 8.3), 50 mmol/L KC1, 1.5 mmol/L MgCl2, 0.2 mmol/L of each dNTP, 4 pmol of each primer (AR3: TGCGCGAAGTGATCCAGAAC and AR4: CTTGGGGAGAACCATCCTCA), 0.2 U of Taq DNA polymerase (Boehringer Mannheim), and 5 [micro]L of digested or undigested DNA sample (or 50 ng of DNA from HL60 cell line). Amplification was performed in a thermal cycler (GeneAmp 2400, Perkin Elmer, Calif) for 35 cycles of 94 [degrees] C for 30 seconds, 56 [degrees] C for 30 seconds, and 72 [degrees] C for 45 seconds. The PCR products were run on 8% polyacrylamide gel, stained with ethidium bromide, and viewed under UV light.

Undigested DNA from HL60 showed 2 discrete bands, indicating 2 alleles, whereas digested DNA from the same cell line showed a single band, indicating the monoclonal nature of the cell line. Undigested DNA extract from the male thyroid gland showed one bright dominant band, indicating a single allele from the only X chromosome, whereas digested DNA sample from the same individual exhibited no dominant band, indicating sufficient digestion of the DNA sample. An undigested DNA sample from the right superior parathyroid gland and from the left superior parathyroid gland specimens showed 2 identical dominant bands corresponding to 2 HUMARA alleles, whereas digested DNA samples from the same specimens showed only one dominant band with identical size (Figure 3). The results indicate that both specimens were monoclonal and had the same inactivation pattern of the androgen receptor gene.

[Figure 3 ILLUSTRATION OMITTED]

COMMENT

Most patients with hyperparathyroidism are cured by the removal of a single enlarged parathyroid gland that is referred to as a parathyroid adenoma. Roth[5] has defined the parathyroid adenoma as "a solitary parathyroid tumor accompanied by three, or rarely two normal glands." Harness et al" has defined the criteria for the diagnosis of multiple parathyroid adenomas as (1) more than 1 and fewer than 4 enlarged parathyroid glands at operation, (2) operative finding of at least one normal parathyroid gland, (3) evidence of neither multiple endocrine neoplasia nor familial hyperparathyroidism, and (4) permanent normocalcemia after resection of the enlarged parathyroid glands. Although attempts have been made to establish the histologic criteria for the diagnosis of parathyroid adenomas, these criteria have been characterized as "hopelessly confusing."[5]

About 15% of patients with primary hyperparathyroidism have multiglandular disease. When all four glands are enlarged, the condition is referred to as parathyroid hyperplasia, and the surgical management involves either subtotal parathyroidectomy (typically 3 1/2 glands) or total parathyroidectomy with autotransplantation of some of the resected parathyroid tissue.[7-12] The incidence of persistent and recurrent hyperparathyroidism, and the incidence of permanent hypoparathyroidism are higher in patients operated on for multiglandular disease compared with those with single adenomas.[13]

The classification of patients with more than 1 but less than 4 enlarged parathyroid glands has been debated for many years. In particular, whether cases with 2 enlarged parathyroid glands and 2 grossly normal parathyroid glands are due to double adenomas or asymmetric hyperplasia has been a point of controversy.[7,8,14,15] This issue has important implications because hyperparathyroidism due to double adenomas should be cured by removal of the 2 enlarged glands".[6,13-20]; if the disease were due to asymmetric hyperplasia, the patient would be at risk for persistent or recurrent hyperparathyroidism because of the 2 remaining abnormal parathyroid glands. On the other hand, if cases of double adenomas are misinterpreted as asymmetric hyperplasia, unnecessary resection of normal parathyroid glands will increase the risk for permanent hypoparathyroidism.

In hyperparathyroidism due to classic WCC hyperplasia, which was first described by Albright et al[21] in 1934, all 4 glands are diffusely replaced by WCCs. Between 1930 and 1939, 6 (12.8%) of the 47 cases of hyperparathyroidism treated at Massachusetts General Hospital were due to WCC hyperplasia.[22] For reasons that are unclear, the incidence of WCC hyperplasia decreased during each of the following decades to 6.8%, 4.9%, and finally to less than 1%. Although WCC hyperplasia has been a recognized entity for more than 60 years, to our knowledge only 2 case reports describing patients with WCC adenomas have been published.[2,3] Reference to another case was made in an editorial by Roth, who referred to a single case of a WCC adenoma that was identified among the more than 2000 cases of hyperparathyroidism that were evaluated at Massachusetts General Hospital.[5]

On light microscopy, WCCs of the parathyroid gland are polygonal with distinct cytoplasmic membranes. Despite its name, the WCCs are seldom entirely "clear" but are often variably vacuolated, foamy, and granular.[1] By electron microscopy, the vacuoles are of uncertain origin but are possibly derived from the Golgi apparatus.[23] Secretory and prosecretory granules are sparsely present; however, the concentration of parathyroid hormone, per milligram of fresh tissue, is approximately 1000 times lower than in normal parathyroid glands or chief cell adenomas.

In recent years, proliferation markers and chromosomal and clonality studies have been used to study the pathogenesis of hyperparathyroidism, and the possible role of oncogenes has also been investigated.[1] Although these studies have shed some light on the pathogenesis of hyperparathyroidism, the current approach to the diagnosis of hyperparathyroidism continues to be based on the preoperative evaluation, the intraoperative findings, and examination of the parathyroid tissue with light microscopy.

In our case, the 2 enlarged superior parathyroid glands were almost completely replaced by WCCs with only a minute rim of extracapsular, histologically unremarkable parathyroid tissue, whereas the inferior parathyroids were grossly and histologically normal. Although many observers have noted that the superior glands are usually much larger than the inferior glands in WCC hyperplasia,[24-26] if our patient's hyperparathyroidism were due to asymmetric hyperplasia, we would have expected to find foci of WCCs in the biopsy specimens from the inferior parathyroid glands. In view of the normal size and histologic findings of the inferior parathyroid glands, we believe that the findings in our case are most consistent with synchronous WCC double parathyroid adenomas. Nonetheless, as previously noted, the possibility that these findings may represent an early stage of WCC hyperplasia cannot be entirely excluded.[26]

Although WCC double adenomas has not been previously documented, a case of WCC hyperplasia reported by Stout[26] could be interpreted as synchronous WCC double adenomas. That case involved bilateral enlarged superior parathyroid glands; one measured 3.8 x 3.1 x 1.0 cm (5.2 g), and the other measured 1.2 x 0.4 x 0.3 cm (weight not documented), each of which demonstrated an encapsulated WCC lesion with an adjacent rim of compressed normal parathyroid tissue. The right inferior parathyroid gland, which measured 0.7 x 0.5 x 0.4 cm, was excised. In addition, a biopsy specimen of the left inferior parathyroid gland, which was described as being grossly normal, was obtained. Step serial sections of the right inferior parathyroid showed one cluster of WCCs, but otherwise the gland consisted almost entirely of chief cells, with rare small clusters of transitional oxyphil and oxyphil cells. Microscopic examination of the biopsy specimen of the left inferior parathyroid gland showed only chief cells.

Clonality of benign proliferative lesions of endocrine glands, including that of parathyroid glands, remains an enigmatic issue as outlined by DeLellis and Tischler.[27] The identification of monoclonality of the 2 parathyroid lesions is not by itself diagnostic of double adenomas.[28] Even using the latest techniques, clonal analysis cannot allow a clear distinction between hyperplasia and adenoma.

CONCLUSIONS

We describe a patient with hyperparathyroidism who was found to have 2 enlarged superior parathyroid glands that were almost completely replaced by WCCs, with only a minute rim of extracapsular, histologically unremarkable parathyroid tissue. The inferior parathyroid glands were grossly and histologically normal. These finding are most consistent with the diagnosis of double adenomas of the WCC type. We acknowledge, however, that it is not possible to entirely exclude the possibility that the findings in this unusual case could be due to asymmetric hyperplasia, despite the results of molecular analysis.[27] However, the clinical course, laboratory data, intraoperative findings, histopathologic features, and results of other ancillary techniques in this case are strongly supportive of the diagnosis of synchronous WCC double adenomas of parathyroid gland.

References

[1.] DeLellis RA. Tumors of the Parathyroid Glands. Washington, DC: Armed Forces Institute of Pathology; 1993:79-83. Atlas of Tumor Pathology; 3rd series, fascicle 6.

[2.] Grenko RT, Anderson KM, Kauffman G, Abt AB. Water-clear cell adenoma of the parathyroid: a case report with immunohistochemistry and electron microscopy. Arch Pathol Lab Med. 1995;119:1072-1074.

[3.] Kovacs K, Horvath E, Ozawa Y, Yamada S, Matiushita H. Large clear cell adenoma of the parathyroid in a patient with MEN-1 syndrome: ultrastructural study of the tumor exhibiting unusual RER formations. Acta Biol Hung. 1994;45: 275-284.

[4.] Peng HZ, Du MQ, Diss TC, Isaacson PG, Pan LX. Clonality analysis in tumours of women by PCR amplification of X-linked genes. J Pathol. 1997;181: 223-227.

[5.] Roth SI. Water-clear cell "adenoma": a new entity in the pathology of primary hyperparathvroidism. Arch Pathol Lab Med. 1995;119:996-997.

[6.] Harness JK, Ramsburg SR, Nishiyama RH, Thompson NW. Multiple adenomas of the parathyroid: do they exist? Arch Surg. 1979;114:468-474.

[7.] Block MA, Frame B, Jackson CE. The efficacy of subtotal parathyroidectomy for primary hyperparathyroidism due to multiple gland involvement. Surg Gynecol Obstet. 1978;147:1-5.

[8.] Wang CA, Reider SV. A density test for the intraoperative differentiation of parathyroid hyperplasia from neoplasms. Ann Surg. 1978;187:63-67.

[9.] Cooke TJ, Boey JH, Sweeney EC, Gilbert JM, Taylor S. Parathyroidectomy: extent of resection and late results. Br J Surg. 1977;64:153-157.

[10.] Paloyan E, Lawrence AM, Oslaps R, Shah KH, Ernst K, Hofmann C. Subtotal parathyroidectomy for primary hyperparathyroidism: long-term results for 292 patients. Arch Surg. 1983;118:425-431.

[11.] Edis AJ, van Heerdan JA, Scholz DA. Results of subtotal parathyroidectomy for primary chief cell hyperplasia. Surgery. 1979;86:462-469.

[12.] Goretzki PE, Dotzenrat C, Roeher HD. Management of primary hyperparathyroidism caused by multiple gland disease. World I Surg. 1991;15:63-67.

[13.] Wells SA Jr, Leight GS, Hensley M, Dilley WG. Hyperparathyroidism associated with enlargement of two or three parathyroid glands. Ann Surg. 1985; 202:533-538.

[14.] Cope OH, Keynes WN, Roth SI, Castleman B. Primary chief cell hyperplasia of the parathyroid glands: a new entity in the surgery of hyperparathyroidism. Ann Surgery. 1958;148:375-388.

[15.] Tenzelman S, Shen W, Shaver JK, et al. Double parathyroid adenomas: clinical and biochemical characteristics before and after parathyroidectomy. Ann Surg. 1993;218:300-309.

[16.] Attie JN, Bock G, Auguste LJ. Multiple parathyroid adenomas: report of thirty-three cases. Surgery. 1990;108:1014-1020.

[17.] Clark OH, Way LH, Hunt TK. Recurrent hyperparathyroidism. Ann Surg. 1976;184:391-402.

[18.] Hines JR, Atijah R, Kliefoth J, Beal JM. Hyperparathyroidism: problems in surgical management. Am J Surg. 1982;144:504-510.

[19.] Roses DF, Karp NS, Sudarsky LA, Valensi QJ, Rosen RJ, Blum M. Primary hyperparathyroidism associated with two enlarged parathyroid glands. Arch Surg. 1989;124:1261-1265.

[20.] Verdonk CA, Edis AJ. Parathyroid "double adenomas": fact or fiction? Surgery. 1981 ;90:523-526.

[21.] Albright F, Bloomberg E, Castleman B, Churchill EB. Hyperparathyroidism due to diffuse hyperplasia of all parathyroid glands rather than adenoma of one: clinical studies of three such cases. Arch Intern Med. 1934;54:315-329.

[22.] Castleman B, Schantz A, Roth SI. Parathyroid hyperplasia in primary hyperparathyroidism: a review of 85 cases. Cancer. 1976;381:668-1675.

[23.] Roth SI. The ultrastructure of primary water-clear cell hyperplasia of the parathyroid glands. Am J Pathol. 1970;61:233-240.

[24.] Wootner LB, Keating FR, Black BM. Tumor and hyperplasia of the parathyroid glands: a review of the pathological findings in 140 cases of primary hyperparathyroidism. Cancer. 1952;5:1069-1088.

[25.] Dawkins RL, Tashjian AH, Castleman B, et al. Hyperparathyroidism due to clear cell hyperplasia: serial determination of serum ionized calcium, parathyroid hormone and calcitonin. Am J Med. 1973;54:119-126.

[26.] Stout LC. Water-clear-cell hyperplasia mimicking parathyroid adenoma. Hum Pathol. 1985;16:107.5-1076.

[27.] DeLellis RA, Tischler AS. Clonality of endocrine proliferative lesions: a critical reappraisal. Endocr Pathol. 1998;4:281-285.

[28.] Sanjuan X, Bryant BR, Sobel ME, Merino MJ. Clonality analysis of benign parathyroid lesions by human androgen receptor (HUMARA} gene assay. Endocr Pathol. 1998;4:293-300.

Accepted for publication June 15, 2000.

From the Departments of Otorhinolaryngology (Dr Kuhel and Mr Gonzales) and Pathology (Drs Hoda, Pan, Chiu, Giri, and DeLellis), New York Presbyterian Hospital--Weill Medical College of Cornell University, New York, NY.

Reprints: Syed A. Hoda, MD, Department of Pathology, New York Presbyterian Hospital--Well Medical College of Cornell University, Starr 1028, Box 93, 525 E 68th St, New York, NY 10021 (e-mail: sahoda@ mail. med.cornell.edu).
COPYRIGHT 2001 College of American Pathologists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Kuhel, William I.; Gonzales, Donald; Hoda, Syed A.; Pan, Langxing; Chiu, April; Giri, Dilip; DeLelli
Publication:Archives of Pathology & Laboratory Medicine
Date:Feb 1, 2001
Words:3004
Previous Article:Anabolic Steroid Abuse and Cardiac Sudden Death: A Pathologic Study.
Next Article:Xanthogranulomatous Salpingitis and Oophoritis: A Case Report and Review of the Literature.
Topics:


Related Articles
Double Adenoma of the Parathyroid Gland.
Unilateral versus bilateral neck exploration in parathyroid surgery: An assessment of 55 cases.
MED10 Spontaneous remission of primary hyperparathyroidism due to autoinfarction/hemorrhage of a parathyroid adenoma. (Medicine).
Multiple primary pleomorphic adenomas in a single parotid gland: report of a new case. (Original Article).
Primary hyperparathyroidism secondary to simultaneous bilateral parathyroid carcinoma. (Original Article).
The 'sentinel clot' sign in spontaneous retropharyngeal hematoma secondary to parathyroid apoplexy.
Differential expression of kinase genes in primary hyperparathyroidism: adenoma versus normal and hyperplastic parathyroid tissue.
Preoperative localization of parathyroid adenomas.
Ultrasound--first imaging modality in the detection of parathyroid adenomas.

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters