Studies on Bacterial Diversity and Vibrio harveyi Distribution Associated with Diseased fugu (Takifugu rubripes) in Northeastern China.
Byline: Qiang Li, Guo Qiao, Li Wang, Jipeng Zhang, Ruijun Li, Ping Ni, Yi Guo and Shigen YeABSTRACT
This study investigated the bacterial diversity and Vibrio harveyi distribution associated with diseased fugu (Takifugu rubripes) in northeastern China from January to December in 2014. The main clinical signs included fin ulceration, skin darkness, hepatohemia and intestinal hydrops. Totally, 104 diseased live fish were collected and 70 strains isolated from naturally diseased T. rubripes. Most isolates were obtained in May, September and December. The isolates were identified through 16S rRNA gene sequence analysis and Vibrio spp.-specific PCR amplification, followed by pathogenicity determination. Results showed that the isolates belonged to 10 genera, including Vibrio (72%), Staphylococcus (9%), Pseudomonas (4%), Bacillus (4%), Vagococcus (3%), Shewanella (3%), Planococcus migula (4%), Exiguobacterium (1%), Enterobacter (1%) and Kocuria roseus (1%).
Vibrio spp. and Vibrio harveyi were the predominant genus and species, respectively. In addition, challenge tests demonstrated that 13 out of 70 isolates were strongly pathogenic and identified as V. harveyi. This study illustrated that V. harveyi could be considered as main pathogen. These investigation results would provide useful information for disease prevention in T. rubripes culture.
Key words
Takifugu rubripes, Bacterial diversity, Vibrio harveyi.
INTRODUCTION
The fugu (Takifugu rubripes) distributes widely in Asia including China, Korea and Japan. T. rubripes is an anadromous and economically important fish in China (Gao et al., 2011). Recently, the consumption demand for T. rubripes is increasing for the tender flesh, delicious tasty and high abundance of protein, and the price soars in China (Liu et al., 2017). Artificial breeding developed quickly along with them since the wild resources have been declined. Especially after year 2016, it became a prosperous industry in North China such as Liaoning Province due to the open artificial breeding allowed by National Government. However, diseases caused by virus, bacteria and parasites remain a limiting factor for aquaculture production and cause great economic losses in the development of artificial cultivation.
Recently, bacterial diseases have been mainly reported in T. rubripes. Edwardsiella tarda belonged to gliding bacteria can cause ascites. Vibrio harveyi can cause symptoms of skin ulceration (Zhang, 2002; Wang et al., 2008). Vibrio ichthyoenteri and Vibrio penaeicida can cause congestion of fins and other symptoms (Zhang et al., 2009). In addition, Streptococcus has been reported to cause skin darkening, head white turbidity and other symptoms (Du, 2003). Most studies have focused on the isolation and identification of some pathogens until now, no more information is available for the periodic distribution and diversity of bacterial pathogens in cultured T. rubripes.
In order to gain deeper insight into the bacterial disease epidemiology in cultured T. rubripes in northeastern China, the diversity of bacterial pathogens associated with disease outbreaks in T. rubripes was carried out from January to December in 2014. These results will provide valuable reference and guidance for the diseases prevention in T. rubripes aquaculture industry.
MATERIALS AND METHODS
Sampling
The naturally diseased T. rubripes were collected from Daheishi farm (farm A) and Zhuanghe farm (farm B) located in Liaoning Province each month from January to December in 2014 (Fig. 1). Body weight of the diseased fish was 150 g-200 g. The clinical symptoms included fin ulceration, abdominal redness, splenomegaly, hepatohemia and renomegaly (Fig. 2). Totally, 104 diseased but not dead fish were collected and all samples were transported to our laboratory at 4 AdegC within 24 h for further analysis.
Bacterial isolation
Diseased fish were washed three times with sterile physiological saline (PS), and then dissected with a scalpel under aseptic conditions. The bacteria were isolated from liver, spleen, kidney, heart, blood, eye, intestine, visceral and ulceration of T. rubripes with typical symptoms, inoculated on the tryptic soy agar (TSA) (Hopebio, Qingdao, China) medium with 2% NaCl, and cultured at 28AdegC for 24 to 72 h. While the prominent isolation ratio of a strain was more than 15% based on the morphological characterization, the isolate would be considered as prominent strain (Li et al., 2010). All prominent strains were subcultured, purified and preserved at -80AdegC in nutrient broth (NB) supplemented with 15% (v/v) glycerol and 2% NaCl. A total of 70 predominant strains were isolated from the diseased T. rubripes (Table I).
Table I.- Bacterial isolates from diseased Takifugu rubripes from January to December in 2014.
Strain No.###Sampling date###Clinical signs###Bacterial origin###Sampling site
2HWH001###January###Fin ulceration, liver redness, splenomegaly###Fin ulceration###A
2FRX001###January###Fin ulceration, intestinal hydrops###Fin ulceration###A
2HWH018###January###Fin ulceration, black skin, hepatohemia###Fin ulceration###B
2PTQ001###February###Fin ulceration###Fin ulceration###A
2DXQ001###February###Fin ulceration, hepatohemia###Fin ulceration###A
2PTQ002###March###Fin ulceration, intestinal hydrops###Fin ulceration###A
2PTQ003###March###Fin ulceration, white feces###Fin ulceration###A
2HWH010###March###Fin ulceration, abdominal redness###Fin ulceration###B
2HWH021###April###Fin ulceration, hepatohemia###Fin ulceration###B
2PTQ004###April###Fin ulceration, intestinal hydrops###Fin ulceration###A
2RZH001###April###Fin ulceration###Fin ulceration###A
2HWH006###May###Fin ulceration###Fin ulceration###A
2HWH003###May###Fin ulceration###Fin ulceration###B
2HWH007###May###Fin ulceration, white feces###Fin ulceration###A
2HWH009###May###Fin ulceration, jejunum, gallbladder swelling###Fin ulceration###A
2RZH002###May###Fin ulceration, intestinal hydrops###Fin ulceration###A
2MG001###May###Fin ulceration, hepatohemia, gallbladder dark###Fin ulceration###A
2HL001###May###Fin ulceration, white feces###Fin ulceration###A
2HL002###May###Fin ulceration###Fin ulceration###A
2CLH001###May###Fin ulceration, hepatohemia###Liver###B
2CLH002###May###Fin ulceration###Fin ulceration###B
2WX001###May###Fin ulceration, hepatohemia, gallbladder dark###Fin ulceration###B
2HJ001###May###Fin ulceration, gallbladder dark###Fin ulceration###B
2HJ002###May###Fin ulceration, white feces###Fin ulceration###B
2HWH002###June###Fin ulceration, intestinal hydrops###Fin ulceration###A
2HWH019###June###Fin ulceration, white feces, visceral anemia###Visceral###B
2RZH003###June###Fin ulceration, gallbladder dark###Fin ulceration###A
2RZH004###June###Fin ulceration, hepatohemia###Liver###A
2HJ003###June###Fin ulceration, black skin, visceral anemia###Visceral###A
2HJ004###June###Fin ulceration, gallbladder dark###Fin ulceration###A
2HWH022###July###Fin ulceration, white feces###Fin ulceration###A
2HWH017###July###Fin ulceration, black skin, intestinal hydrops###Fin ulceration###A
2HWH008###July###Fin ulceration, hepatohemia, gallbladder dark###Fin ulceration###B
2RZH005###July###Fin ulceration, black skin, visceral anemia###Visceral###A
2HJ005###July###Fin ulceration###Fin ulceration###A
2HWH023###August###Fin ulceration###Fin ulceration###A
2HWH024###August###Fin ulceration, liver anemia, renomegaly###kidney###A
2HWH014###August###Fin ulceration, hepatohemia, renomegaly###Liver###A
2HWH005###August###Fin ulceration###Fin ulceration###A
2HWH004###October###Fin ulceration###Fin ulceration###B
2HWH005###May###Fin ulceration###Fin ulceration###A
2CLX003###August###Fin ulceration###Fin ulceration###A
2CLH004###August###Fin ulceration, black skin, visceral anemia###Visceral###A
2CLX005###August###Fin ulceration, black skin, visceral anemia###Visceral###B
2PTQ005###August###Gallbladder dark, intestinal hydrops###Intestine###B
2PTQ006###August###Fin ulceration###Fin ulceration###B
2HWH013###September###Fin ulceration, gallbladder dark###Fin ulceration###A
2HWH012###September###Fin ulceration, gallbladder dark###Fin ulceration###B
2RZH006###September###Fin ulceration###Fin ulceration###A
2YB001###September###Fin ulceration, black skin, visceral anemia###Visceral###A
2HJ006###September###Gallbladder dark, intestinal hydrops###Intestine###A
2HJ007###September###Fin ulceration, hepatohemia###Liver###A
2RZH007###September###Fin ulceration###Fin ulceration###B
2HWH015###October###Fin ulceration, black skin, visceral anemia###Visceral###A
2HWH004###October###Fin ulceration###Fin ulceration###A
2HWH011###October###Fin ulceration, black skin, visceral anemia###Visceral###B
2RZH008###November###Fin ulceration, gallbladder dark###Fin ulceration###A
2YB002###November###Fin ulceration, black skin, visceral anemia###Visceral###B
2XW001###November###Fin ulceration###Fin ulceration###B
2XW002###November###Fin ulceration###Fin ulceration###B
2HWH016###December###Fin ulceration, hepatohemia###Liver###B
2HWH020###December###Gallbladder dark, intestinal hydrops###Intestine###B
2MH001###December###Fin ulceration, gallbladder dark###Fin ulceration###A
2MH002###December###Fin ulceration###Fin ulceration###A
2JDB001###December###Fin ulceration, hepatohemia###Liver###A
2JDB002###December###Fin ulceration, gallbladder dark###Fin ulceration###A
2JDB003###December###Fin ulceration, hepatohemia###Liver###A
2CG001###December###Fin ulceration###Fin ulceration###A
2HJ008###December###Fin ulceration, gallbladder dark###Fin ulceration###B
2HJ009###December###Fin ulceration, hepatohemia###Liver###B
2YB003###December###Fin ulceration###Fin ulceration###B
Table II.- Specific primers sequence of Vibrio spp.
Vibrio spp.###Genes###Target###Primers (5'-3')###Note
###fragment
V. harveyi###toxR###382 bp###F: GAAGCAGCACTCACCGAT###Pang et al. (2006)
###R: GGTGAAGACTCATCAGCA
V.###Col###271bp###F: GAAAGTTGAACATCATCAGCACGA###Di Pinto et al. (2005)
parahaemolyticus###R: GGTCAGAATCAAACGCCG
V. anguillarum###rpoN###519 bp###F: GTTCATAGCATCAATGAGGAG###Tapia-Cammas et al. (2011)
###R: GAGCAGACAATATGTTGGATG
V. splendidus###VSFur###223 bp###F: GACGCATATGTCAGACAATAATCAAG###Liang et al. (2016)
###R: CTCGAGCTTCTTCGCTTTATGT
V. alginolyticus###colH###526 bp###F: TCGCGATTGCGACAACATTAACCAGCACTGGCGT###Xu et al. (2017)
###R: ACAAACGCATCCACTGATTCTTTCACCGCTGGGGTGA
Identification of bacterial isolates
Two different methods were used to identify these 70 isolates.
16S rRNA genes sequence analysis
DNA extraction and purification were carried out following the methods of Li et al. (2010) with some modifications. The isolates were cultured in TSB with 2% NaCl for 24 h at 28 AdegC. Cells were harvested by centrifugation (150 x g, 10 min) at 4 AdegC and the pellets were washed 3 times with distilled water. The pellets were then suspended in distilled water and DNA was extracted following manufacturer's instruction of TIANamp bacteria DNA kit (TIANGEN). The DNA was purified by increasing the DNA washing times with tris-ethylenedi-aminetetraacetic acid (TE) buffer.
Two universal primers, Eubac 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and Eubac 1492R (5'-TACGGCTACCTTGTTACGACTT-3') synthesized by Sangon Biotech (Shanghai) were used to amplify bacterial 16S rRNA genes (~1500 bp). Twenty five microliters used in the PCR system included 2.5 uL 10x PCR buffer, 0.5 uL dNTPs (10 mM of each dNTP), 2 uL MgCl2* 6H2O (25 mM), 0.5 uL of each primer (10 uM), 1uL DNA template, and 0.2 uL Taq DNA polymerase (5 U uL-1). The final volume was adjusted with the addition of triple distilled water. The thermal cycle was run in a T3 thermal cycler (Biometra) at 94 AdegC initially for 5 min, 35 cycles of 94 AdegC for 30 s, 55 AdegC for 30 s and 72 AdegC for 90 s, and then 72 AdegC for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis and sequenced by Sangon Biotech (Shanghai).
The obtained sequences were aligned and compared with other bacterial 16S rRNA sequences available in GenBank of NCBI database and in EzTaxon server 2.1. According to the results of PCR amplification by Vibrio spp.-specific primers and challenge tests (as following), four representative strains (2HWH003, 2HWH017, 2HWH019 and 2HWH020) were selected for further analysis. A phylogenetic tree of these four bacteria was constructed by the neighbor-joining method using the MEGA 5.0 software, and bootstrap analysis with 1000 replicates was adopted to estimate the relative branch support of the tree (Wu et al., 2015).
PCR amplification by Vibrio spp.-specific primers
Based on the results from 16S rRNA genes sequence analysis, 50 strains were identified to Vibrio spp. and they were further identified by PCR amplification with Vibrio spp.-specific primers (Table II). Genomic DNA was extracted as described above and PCR amplification were conducted following the procedures (Di et al., 2005; Pang et al., 2006; Liang et al., 2016; Tapia-Cammas et al., 2011; Xu et al., 2017). PCR products were examined by 1% agarose gel electrophoresis.
Challenge tests
The above identification results showed that Vibrio spp. (72%, Vibrio / total isoaltes) were the predominant genus, and V. harveyi (48%, V. harveyi / Vibrio spp.) was the predominant species and could be detected each month. Thus, V. harveyi was selected to do challenge tests to investigate the pathogenicity of isolates to T. rubripes. Two challenge methods were used to determine the pathogenicity.
Experimental animals and acclimation
Normal T. rubripes (mean body weight of 200 g) were obtained from a farm at Dalian, Liaoning Province and acclimated in a tank of static water at temperature of 17 AoC, pH of 8.0, salinity of 29-32 psu and DO higher than 5 mg L-1 for 2 weeks prior to the experiments. The tank was provided with aeration and water was exchanged by 30% daily throughout the whole experiment. T. rubripes were fed with commercial diets (Tongwei Feeding Company, China) three times daily at 3% of their body weight under a 12 h light/12 h dark cycle.
Intramuscular injection
T. rubripes were randomly divided into 24 tanks with 10 individuals per tank. All 24 V. harveyi isolates were incubated in nutrient broth (NB) containing 2% NaCl at 180 rpm in an orbital shaker for 24 h at 28 AdegC. Bacterial cells were collected by centrifugation at 6000 x g for 10 min at 4 AdegC, and bacterial suspension (1.0x108 cells mL-1) in sea water was prepared by observing optical density at 600 nm (OD600). Each T. rubripes was injected with 0.2 mL of bacterial suspensions (1.0x105 cells g-1 fish) by intramuscular injection at dorsal fin base as experimental groups, and the control group was injected with an equal volume of sterilized sea water. T. rubripes were observed daily for 14 days post-bacterial challenge, and all mortalities were recorded. When the cumulative mortality was more than 50% at 14 d, the isolate was considered as pathogenic bacteria.
Immersion infection
Four representative strains (2HWH003, 2HWH017, 2HWH019 and 2HWH020) were selected for immersion tests based on their above virulence investigation. T. rubripes were randomly divided into five tanks with 10 individuals per tank, and the fin of each fish was sheared by scalpel under sterile conditions. Then, those wounded fish were immersed in the sea water with final bacterial suspension of 4.4x106 cells mL-1 for 1 h as experimental groups and fish in control group was soaked in sterilized sea water. The clinical signs and mortalities were recorded within 14 days. All challenge tests were conducted in triplicate.
RESULTS
Clinical symptoms of diseased T. rubripes
During one-year diseases investigation associated with T. rubripes, the main symptoms of diseased fish were skin darkening, fin ulceration, liver congestion, splenomegaly, intestinal tract ascites, and gallbladder was deep (Fig. 2).
Bacteria associated with disease
A total of 70 strains were isolated from diseased T. rubripes in farms A and B within one year, 45 strains of which were isolated from farm A and 25 strains from farm B. And these 70 strains were identified and characterized to 10 genera by 16S rRNA gene sequence analysis, including Vibrio (72%), Staphylococcus (9%), Pseudomonas (4%), Bacillus (4%), Vagococcus (3%), Shewanella (3%), Planococcus migula (4%), Exiguobacterium (1%), Enterobacter (1%) and Kocuria roseus (1%) (Fig. 3A). Based on the results of challenge tests, four representative strains were selected and the phylogenetic tree was constructed using the 16S rRNA gene sequences. Results showed that the four bacterial isolates were clustered into one clade and closed to V. harveyi (Fig. 4). Moreover, 50 strains belonged to Vibrio spp. were amplified by Vibrio spp.-specific primers.
The results showed that 24 strains belonged to V. harveyi (24 strains of V. harveyi/50 strains of Vibrio spp. = 48%), 8 strains of V. alginolyticus (16%), 5 strains of V. splendidus (10%), 2 strains of V. anguillarum (4%), 1 strain of V. parahaemolyticus (2%), and 10 strains were unidentified to the species level (Fig. 3B).
Bacterial diversity was different from farm A to farm B. In farm A, 45 strains were obtained and included 32 strains of Vibrio spp. (71%), 4 strains of Staphylococcus spp. (9%), 3 strains of Pseudomonas spp. (7%), 2 strains of Vagococcus spp. (4%), each 1 strain of Planococcus Migula spp., Enterobacter spp., Bacillus spp. and Kocuria roseus spp. (2%), respectively (Fig. 5A). Among 32 strains of Vibrio spp., 14 strains belonged to V. harveyi (44%), 7 strains of V. alginolyticus (22%), 2 strains of V. anguillarum and V. splendidus (6%), 1 strain of V. parahaemolyticus (3%) (Fig. 5B). In farm B, 25 strains were obtained, and 18 strains belonged to Vibrio spp. (72%), 2 strains of Staphylococcus spp., Shewanella spp. and Bacillus spp. (8%), 1 strain of Exiguobacterium spp. (4%), respectively (Fig. 6A).
Among 18 strains of Vibrio spp., 10 strains belonged to V. harveyi (56%), 3 strains of V. splendidus (17%) and 1 strain of V. alginolyticus (5%), respectively (Fig. 6B). Vibrio spp. were the predominant genus and V. harveyi was the main species in both farms A and B. Compared with farm A, bacterial diversity in farm B was lower (Fig. 5B).
The bacterial diversity was diverse along with months based on one-year survey from two farms. The bacteria were isolated more in May and December, and V. harveyi could not be isolated in February and November (Fig. 7A). More bacteria were carried by diseased T. rubripes in May and September, followed by June, July and December. In May, V. harveyi, V. alginolyticus, Vagococcus spp. and Kocuria roseus spp. were isolated more. In September, V. harveyi, V. alginolyticus and unidentified Vibrio spp. and Bacillus were isolated. The bacterial diversity was similar in June and July. Apart from February, bacteria could be isolated in other months, and the diversity was sole in January, March, April, June, July and October. V. harveyi was the predominant species (Fig. 7).
V. harveyi distribution
V. harveyi could be isolated from both two farms throughout year. V. harveyi could mainly be isolated in January, May, June, July, August, September and October in farm A. In addition, V. harveyi could almost be isolated each month in farm B except February, August and November.
Challenge tests
The clinical signs of diseased T. rubripes infected naturally and artificially by intramuscular and wounded immersion were similar, including skin darkening (Fig. 2A), fin ulceration (Fig. 2B), fin bleed (Fig. 2C), liver congestion (Fig. 2D), splenomegaly (Fig. 2E) and intestinal hydrops (Fig. 2F). The mortality was observed at 2 dpi (days post infection) in most bacterial injection groups. No clinical signs and death were noted in control group. Thirteen strains were determined to be virulent with 14-d cumulative mortalities of more than 50%, which were numbered as strains 2HWH001, 2HWH002, 2HWH003, 2HWH004, 2HWH005, 2HWH008, 2HWH010, 2HWH011, 2HWH012, 2HWH013, 2HWH017, 2HWH019 and 2HWH020, respectively (Table III). The virulence was different from strains.
Among them, strain 2HWH020 showed highest virulence with cumulative mortality of 80% by intramuscular injection and 50% by wounded immersion. Strain 2HWH003 as a pathogenic isolate was lowest virulent to T. rubripes, and the cumulative mortality was 70% by intramuscular injection and 10% by wounded immersion (Table III).
Table III.- Results of challenge tests by Vibrio harveyi isolates (24 strains).
Strain number###14-day cumulative mortality (%)
###Intramuscular###Wounded
###injection###immersion
2HWH001###100###N
2HWH002###90###N
2HWH003###70###10
2HWH004###80###N
2HWH005###80###N
2HWH006###20###N
2HWH007###20###N
2HWH008###80###N
2HWH009###30###N
2HWH010###70###N
2HWH011###80###N
2HWH012###70###N
2HWH013###90###N
2HWH014###20###N
2HWH015###40###N
2HWH016###30###N
2HWH017###100###20
2HWH018###50###N
2HWH019###80###20
2HWH020###90###50
2HWH021###40###N
2HWH022###40###N
2HWH023###20###N
2HWH024###30###N
Control###0###0
DISCUSSION
In agreement with reports by Wang et al. (2008), the one-year investigation demonstrated that main symptoms of diseased fish T. rubripes were skin darkening, fin ulceration, liver congestion and splenomegaly, respectively. Bacteria could be isolated from all samples tested.
V. harveyi has been considered as one of important bacterial pathogens in sea water aquaculture (Zhou et al., 2012; Zhang and Austin, 2000; Ransangan et al., 2012; Montero and Austin, 2010) and limits the development of aquaculture seriously. In the present study, V. harveyi could be isolated in almost every month except February and could be obtained from both farms A and B. In addition, V. harveyi isolates were determined to be pathogenic to T. rubripes, and cause main symptoms of fin rot and skin ulceration. Thus, V. harveyi can be considered as the main pathogenic bacteria of T. rubripes in Liaoning Province, North China. Other researches also demonstrated that V. harveyi can cause T. rubripes skin ulceration (Won et al., 2009; Wu et al., 2015) and skin ulcer disease (Shen et al., 2017). Two challenge methods were used to determine the pathogenicity of V. harveyi isolates.
In the challenge tests of T. rubripes by intramuscular injection, fin ulceration were not observed as shown in naturally infected fish although higher mortality was recorded. Accordingly, V. harveyi showed moderate pathogenicity to tiger puffer when 20% mortality was observed within 6 days post-infection at bacterial concentration of 1.0x108 CFU mL-1 (Mohi et al., 2010). Thus, the wounded immersion tests were conducted and infected fish showed unfinished fin rot symptoms as naturally infected. It is related with the bacterial infection way as reported by Wang et al. (2008). Shi et al. (2005) also showed that V. harveyi could fail to infect large yellow croaker (Pseudosciaena crocea) by intramuscular injection, and the pathogen could successfully infect the organisms by wounded immersion.
Bacterial diversity was various with culture conditions and months. In this study, 45 of 70 strains belonged to 8 genera were isolated from farm A, and another 25 strains belonged to 5 genus were isolated from farm B. The isolation frequency and bacterial diversity in farm A were more various than that in farm B, although both farm A and B are located in Dalian City, Liaoning Province, North China. Their differences might be related with the sea water treatment method. A conventional indoor flow aquaculture system without any seawater treatment is used in farm A, while automated recirculating aquaculture system (RAS) with seawater pre-treated by filtration and sterilization is used in farm B. The over-wintering period of T. rubripes is from November of each year to May of the following year, and the temperature is generally 13-16 AdegC. This study found that less bacteria could be isolated during this period compared to other months.
It suggested that the number and type of bacteria might be related to water temperature. The higher temperature is more suitable for bacterial growth. In farm B, water has been treated by drum filters and biological filters to stabilize the environmental conditions. Bacteria number in farm B can be reduced and is obviously lower than that in marine water untreated. In addition, RAS has been reported to enhance the immunity of cultured species (Lin et al., 2017; Kikuchi et al., 2006; Yanagawa et al., 2011; Lin et al., 2017). Combined with the present study, the number of diseased fish in farm B was less than that in farm A, and less bacteria could be isolated from farm B than farm A. It suggested that pre-treatment of seawater is more effective in T. rubripes aquaculture. The annual bacteria distribution showed that bacteria species increased obviously in May, which might be related with the water temperature raise after over-wintering and lower immunity caused by non-feeding during the winter.
Simultaneously, V. harveyi is an opportunistic bacterial pathogen and it grows along with the water temperature. As we know, disease of aquatic organisms is combined with culture environment, hosts and pathogens. Under the lower immunity and more pathogens, it will be easier to be infected and bacterial isolates were obtained more in May in this study. From June to September, T. rubripes grows faster at suitable water temperature and no more diseases were detected. However, the bacterial species increased significantly in December, which might be correlated with the culture conditions since T. rubripes needs to be transferred from outdoor ponds into indoor tanks for over-wintering. The transfer operation was able to cause body surface injure and intrigue stress, which gave the opportunity to be infected by pathogens.
However, the bacterial diversity in December was still lower than that in May due to the lower temperature against bacterial pathogen infection. The above results strongly suggested that some strategies should be taken for disease prevention before/after transfer and post over-wintering.
CONCLUSIONS
A one-year investigation about diseased T. rubripes cultured in North China showed that bacteria could be isolated each month, and V. harveyi was the main pathogen. V. harveyi was isolated more in May and December, suggesting that bacterial diseases should be attracted more attention after over-wintering and before/after transfer.
ACKNOWLEDGEMENTS
This work was funded by National Public Science and Technology Research Funds Projects of Ocean (Grant No. 201405003), National key RandD Program of China (Grant No. 2017YFD0701700) and Planned Science and Technology Project of Liaoning (Grant No. 2017203002).
Statement of conflict of interest
The authors declare that there is no conflict of interests regarding the publication of this article.
REFERENCES
Di, P.A., Ciccarese, G., Tantillo, G., Catalano, D. and Forte, V.T., 2005. A collagenase- targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J. Fd. Protec., 68: 150-153. https://doi.org/10.4315/0362-028X-68.1.150
Du, J.Y., 2003. Streptococcal disease on Takifugu rubripes. Hebei Fish., 127: 30-31.
Gao, L.J., Huang, Y.Q., Xia, L.J., Jian-Xue, L.U. and Liu, S.C., 2011. Comparison of flesh quality of farmed fugu (Takifugu rubripes) from different culture models. J. Fish. China, 35: 1668-1676.
Kikuchi, K., Iwata, N., Furuta, T., Kawabata, T. and Yanagawa, T., 2006. Growth of tiger puffer (Takifugu rubripes) in closed recirculating culture system. Fish. Sci., 72: 1042-1047. https://doi.org/10.1111/j.1444-2906.2006.01254.x
Won, K.M., Won, K.H. and Park, S.I., 2009. Vibrio harveyi associated with deep skin ulcer in river puffer (Takifugu obscures), exhibited in a public aquarium. Aquacul. Res., 40: 963-967. https://doi.org/10.1111/j.1365-2109.2008.02151.x
Li, H., Qiao, G., Gu, J.Q., Zhou, W., Li, Q., Woo, S.H., Xu, D.H. and Park, S.I., 2010. Phenotypic and genetic characterization of bacteria isolated from diseased cultured sea cucumber (Apostichopus japonicus) in northeastern China. Dis. aquat. Organ., 91: 223-235. https://doi.org/10.3354/dao02254
Liang, W.K., Zhang, S.S., Zhang, W.W., Li, C.H. and Han, Q.X., 2016. Characterization of functional furVs as a biomarker for detection of aquatic pathogen Vibrio splendidus. J. World Aquacul. Soc., 47: 577-586. https://doi.org/10.1111/jwas.12288
Lin, Z.L, Wang, H., Yu, C.Y., Lv, F.H., Liu, H.M. and Zhang, T., 2017. Commercial production of tiger puffer (Takifugu rubripes) in winter using a recirculating aquaculture system. J. Ocean Univ. China, 16: 107-113. https://doi.org/10.1007/s11802-017-2802-1
Liu, Y., Qin, Z., Zhang, H. and Yi, L., 2017. Genetic analysis of redfin puffer (Takifugu rubripes) for growth traits by using a marker-based pedigree. J. Fish. China, 41: 22-26.
Mohi, M.M., Kuratani, M., Miyazaki, T. and Yoshida, T., 2010. Histopathological studies on Vibrio harveyi-infected tiger puffer (Takifugu rubripes) (Temminck et Schlegel), cultured in Japan. J. Fish Dis., 33: 833. https://doi.org/10.1111/j.1365-2761.2010.01184.x
Montero, A.B. and Austin, B., 2010. Characterization of extracellular products from an isolate of Vibrio harveyi recovered from diseased post larval Penaeus vannamei (Bonne). J. Fish Dis., 22: 377-386. https://doi.org/10.1046/j.1365-2761.1999.00189.x
Pang, L., Zhang, X.H., Zhong, Y., Chen, J., Li, Y. and Austin, B., 2006. Identification of Vibrio harveyi using PCR amplification of the toxR gene. Lett. appl. Microbiol., 43: 249-255. https://doi.org/10.1111/j.1472-765X.2006.01962.x
Ransangan, T.M. and Alharbiand A.H., 2012. Characterization and experimental infection of Vibrio harveyi isolated from diseased Asian seabass (Lates calcarifer). Malaysian J. Microbiol., 8: 110-116.
Shen, G.M., Shi, C.Y., Fan, C., Jia, D., Wang, S.Q., Xie, G.S., Li, G.Y., Mo, Z.L. and Huang, J., 2017. Isolation, identification and pathogenicity of Vibrio harveyi, the causal agent of skin ulcer disease in juvenile hybrid groupers Epinephelus fuscoguttatus x Epinephelus lanceolatus. J. Fish Dis., 40: 1351-1362. https://doi.org/10.1111/jfd.12609
Shi, Y.S., Tong, G.Z., Xue, C.B., Gu, S.Y. and Gong, H.X., 2005. Identification and drug sensitive test of Vibrio harveyi isolated from the tail-rotted Pseudosciaena crocea in Zhoushan. Chinese J. Hlth. Lab. Technol., 15: 267-269.
Tapia-Cammas, D., Yanez, A., Arancibia, G., Toranzo, A.E. and Avendano-Herrera, R., 2011. Multiplex PCR for the detection of Piscirickettsia salmonis, Vibrio anguillarum, Aeromonas salmonicida and Streptococcus phocae in Chilean marine farms. Dis. aquat. Organ., 97: 135-142. https://doi.org/10.3354/dao02395
Wang, B., Lan-Ping, Y.U., Liang, H.U., Yan, L.I., Liu, S.F. and Jiang, Z.Q., 2008. Isolation and identification of bacteriosis pathogen from cultured Fuguo bscurus with canker of skin. J. Fish. Sci. China, 15: 352-358.
Wu, F., Tang, K., Yuan, M., Shi, X., Shakeela, Q. and Zhang, X.H., 2015. Studies on bacterial pathogens isolated from diseased torafugu (Takifugu rubripes) cultured in marine industrial recirculation aquaculture system in Shandong Province, China. Aquacul. Res., 46: 736-744. https://doi.org/10.1111/are.12220
Xu, Y.G., Sun, L.M., Wang, Y.S., Chen, P.P., Liu, Z.M., Li, Y.J. and Tang, L.J., 2017. Simultaneous detection of Vibrio cholerae, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio vulnificus in seafood using dual priming oligonucleotide (DPO) system-based multiplex PCR assay. Fd. Contr., 71: 64-70.
Yanagawa, T., Kawabata, T., Iwata, N. and Kikuchi, K., 2011. Production of tiger puffer (Takifugu rubripes) with a recirculating aquaculture system. Eco-Engineering, 23: 11-16.
Zhang, W.G., 2002. The common disease and prevention of Takifugu rubripes. Fish. Guide Rich, 11: 34-34.
Zhang, X.H. and Austin, B., 2000. Pathogenicity of Vibrio harveyi to salmonids. J. Fish Dis., 23: 93-102. https://doi.org/10.1046/j.1365-2761.2000.00214.x
Zhang, X.J., Chen, C.Z., Yan, B.L., Fang, H., Qin, G.M. and Xu, J., 2009. Studies on biological characteristics of pathogenic Vibrio ichthyoenteri isolated from pufferfish (Takifugu rubrips). Acta Hydrobiol. Sin., 33: 1118-1125. https://doi.org/10.3724/SP.J.1035.2009.61118
Zhou, J., Fang, W., Yang, X., Shuai, Z., Hu, L., Li, X., Qi, X., Hang, S. and Xie, L., 2012. A nonluminescent and highly virulent Vibrio harveyi strain is associated with "bacterial white tail disease" of Litopenaeus vannamei shrimp. PLoS One, 7: e29961. https://doi.org/10.1371/journal.pone.0029961
![]() ![]() ![]() ![]() | |
Publication: | Pakistan Journal of Zoology |
---|---|
Article Type: | Report |
Date: | Feb 28, 2019 |
Words: | 5388 |
Previous Article: | The Effects of Wumei Pill on TLRs/NF-kB Signaling Pathway in Rats with Diarrhea-Predominant Irritable Bowel Syndrome. |
Next Article: | Relationship Between the Size of Galleria mellonella Larvae and the Production of Steinernema feltiae and Heterorhabditis bacteriophora. |
Topics: |