Printer Friendly

Structure of flavonoid 3'-hydroxylase gene for pubescence color in soybean.

SOYBEAN cultivated at high latitudes and altitudes frequently suffers from low temperatures. Chilling stress retards growth, causes abortion of flowers and immature pods, and reduces the final seed yield (Raper and Kramer, 1987). Furthermore, chilling temperatures (about 15[degrees]C) during flowering induce browning and cracking of seed coats (Sunada and Ito, 1982). Cultivars with yellow hilum color compared to those with brown hilum are preferred in Japan for confectionary use due to better external appearance. However, yellow hilum cultivars are more susceptible to low temperatures resulting in reduced seed yield compared with brown hilum cultivars. Further, seed coat pigmentation occurs only in yellow hilum cultivars and is absent in cultivars with brown hilum (Sunada and Ito, 1982; Takahashi, 1997).

In Japan, cultivars with brown and yellow hilum generally have tawny and gray pubescence, respectively. Soybean breeders in Hokkaido (northern Japan) have observed that chilling tolerance is associated with pubescence color rather than hilum color based on the observation of chilling tolerance of populations segregating for both hilum and pubescence color. Takahashi and Asanuma (1996) evaluated chilling tolerance of a pair of near-isogenic lines (NILs) for pubescence color, To7B with tawny pubescence (TT), and To7G with gray pubescence (tt). Seed yield under the control condition was similar between the NILs. In contrast, seed yield of To7B and To7G under chilling treatment (15[degrees]C for 4 week) was 24 and 45% less than control, respectively. Further, [N.sub.2]-fixing ability, as indicated by nitrogenase activity in root nodules was similar in both NILs under the control conditions, and [N.sub.2]-fixing ability in To7B and To7G under chilling treatments was 40 and 57% less than control, respectively. Pod number, an indicator of pollen sterility, was similar in both the NILs under chilling treatment as well as control conditions (Takahashi and Asanuma, 1996). Takahashi et al. (2005) further investigated chilling tolerance of NILs of 'Harosoy' for the T locus and obtained similar results. Probably, the dominant T allele is associated with chilling tolerance by improving seed-filling ability under chilling conditions.

To investigate the role of genes T and I (responsible for distribution of seed coat color, reviewed by Palmer et al., 2004) on low temperature-induced seed coat pigmentation and cracking, Takahashi and Asanuma (1996) and Takahashi (1997) compared Harosoy and its NILs for the two loci. Independent of the genotypes at I locus, the dominant T allele completely suppressed the development of low temperature-induced pigmentation around the hilum region and partly suppressed seed coat cracking. Dominant I allele also suppressed seed coat pigmentation and cracking under the genotype of tt, although its inhibitory effect was not as obvious as gene T. Thus, T gene is presumed to be associated with chilling tolerance in terms of yield and quality of seeds.

Based on the results, breeders at Tokachi Agric. Exp. Stn. have started to develop yellow hilum cultivars with tawny pubescence to improve chilling tolerance of yellow hilum cultivars (Kurosaki et al., 2004). Cultivars with IITT genotype frequently have dull gray-brown discoloration over the entire seed coat especially when cultivated under cool summer conditions (Cober et al., 1996). Further, cultivars with IIrrTT genotype have imperfect yellow hilum: hilum color ranges from yellow to brown depending on the genetic background and environmental conditions (Cober et al., 1998). Degree of gray-brown discoloration depends on the genetic background similar to hilum color (Kurosaki and Yumoto, 2001). Thus, it may be possible to develop chilling-tolerant cultivars with clear yellow seed coat and tawny pubescence.

Gene T is involved in flavonoid biosynthesis and is presumed to encode a F3'H that hydroxylates the 3' position of the B-ring in flavonoids (Buttery and Buzzell, 1973). Toda et al. (2002) cloned and characterized the F3'H cDNA from To7B and To7G. Sequence analysis revealed that they differed by a single-base deletion of C in the coding region of To7G. The deletion generated a truncated polypeptide lacking the GGEK consensus sequence and the heme-binding domain resulting in a nonfunctional protein.

The mechanism for the relationship between T gene and chilling tolerance is controversial. Morrison et al. (1994) presumed that pubescence color might influence the microclimate of the canopy and consequently affect seed yield. Schori and Gass (1994) attributed the association to linkage between a gene controlling flowering synchronism and T locus: asynchronous flowering habit associated with dominant T allele has a compensatory role in pod setting under chilling conditions. Takahashi (1997) postulated that the dominant T allele suppresses low temperature-induced pigmentation by inhibiting the oxidation of phenolic compounds. The F3'H gene produces flavonoids with 3', 4'-dihydroxy configuration, and these flavonoids possess a high antioxidant activity relative to those with a single hydroxyl group on the B-ring (Pratt, 1976). Varietal differences in [N.sub.2]-fixation ability of root nodules under chilling treatment could also be explained by the anti-oxidative activity of the flavonoids with 3', 4'-dihydroxy configuration.

The roles of genes closely linked to F3'H gene or residual heterogeneity cannot be completely excluded because the NILs were developed by crossing and selling. Furthermore, existence of genetic rearrangements was suggested in the vicinity of T locus (Toda et al., 2002; Zabala and Vodkin, 2003). Transgenic experiments using the F3'H cDNA may be useful to differentiate the contribution of F3'H gene from closely linked genes, and clarify the function of F3'H in relation to chilling tolerance. This study was conducted to characterize the structure of the entire F3'H gene in soybean.

MATERIALS AND METHODS

Plant Materials

Soybean NILs for T gene, To7B (tawny pubescence, TT) and To7G (gray pubescence, tt), were developed at Tokachi. Agric. Exp. Stn. by crossing T207 (tt) with Toshidai-7910, a landrace of Sakhalin (TT) (Takahashi and Asanuma, 1996). Genomic DNA was extracted by CTAB method (Murray and Thompson, 1980) from trifoliolate leaves of To7B (TT), Karafuto-1 (landrace of Sakhalin, TT), Moshidou Gong 503 (Chinese forage cultivar, TT), Clark (U.S. cultivar, TT), To7G (tt), Toyosuzu (Japanese cultivar, tt), Misuzudaizu (Japanese cultivar, tt), and Harosoy (Canadian cultivar, tt). For genetic analysis, Karafuto-1 was crossed with Toyosuzu, and seeds of [F.sub.2] population were obtained by selfing. Genomic DNA was extracted from leaves of 89 [F.sub.2] plants grown in the field. Genotypes at T locus of [F.sub.2] plants were determined using 15 plants each from 89 [F.sub.3] families.

Isolation of FYH Genomic Clones

Genomic Southern analysis with BamHI digestion produced an intense band with approximate molecular size of 4 kb that cosegregated with pubescence color (Toda et al., 2002). In this report, BamHI-digested genomic DNA fragments of To7B were separated by electrophoresis in 1% low-melting agarose. DNA fragments with approximate size of 4 kb were excised from the gel, and the DNA was extracted using GELase according to the manufacturer's instructions (EPICENTRE Biotechnologies, Madison, WI). The extracted DNA was cloned into the BamHl site of ZAP Express vector (Stratagene, La Jolla, CA) and a minigenomic library was constructed. Plaque hybridization was performed using the entire cDNA of soybean F3'H (sf3'h1, Toda et al., 2002) as a probe according to standard procedures (Sambrook and Russell, 2001).

To investigate the varietal differences in DNA sequences, the first intron of To7G and the promoter region of To7G, Karafuto-1, Moshidou Gong 503, Clark, Toyosuzu, Misuzudaizu, and Harosoy were amplified by PCR and cloned into TA cloning vector (Invitrogen, Carlsbad, CA). PCR primer information and approximate position in the F3'H gene are presented in Table 1 and Fig. 1, respectively.

[FIGURE 1 OMITTED]

DNA Sequencing and Motif Analysis

Nucleotide sequences of both strands were determined with BigDye terminator cycle method using a Genetic Analyzer ABI3100 (Applied Biosystems, Foster City, CA). Nucleotide sequences were analyzed with the BLAST program (Altschul et al., 1997). Motif analysis of the putative promoter region was performed using the PLACE Signal Scan Search software (Higo et al., 1999).

SSR Analysis

The PCR mixture contained 50 ng of genomic DNA, 4.5 pmol of each primer, 2 nmol of nucleotides, and 0.25 unit of ExTaq in 1x ExTaq buffer supplied by the manufacturer (TAKARA BIO, Ohtsu, Japan) in a total volume of 10 [micro]L. The initial 12 min denaturation at 94[degrees]C was followed by 28 cycles of 30 sec denaturation at 94[degrees]C, 30 sec annealing at 54[degrees]C, and 30 sec extension at 68[degrees]C. A final 5 min extension at 68[degrees]C completed the program. The PCR was performed in an Applied Biosystems GeneAmp 9700 thermal cycler. The PCR products were mixed with an equal volume of formamide dye (96% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol), denatured by heating for 3 min at 90[degrees]C, and chilled on ice. Electrophoresis was performed using the HEGS (high efficiency genome scanning) system (Kawasaki and Murakami, 2000). The 7% denaturing polyacrylamide gels with 8.5 M urea were preheated by running at 100 V for 30 min at 50[degrees]C in an incubator. Six microliters of each denatured sample was loaded on the gels and electrophoresed at 120 V for 3 h at 50[degrees]C in the incubator. The fragments were visualized by ethidium bromide staining.

RESULTS AND DISCUSSION

Isolation of F3'H Genomic Clones

As expected by genomic Southern analysis, the positive clone (F3'H-G1) in plaque hybridization contained an insert of approximately 4.2 kb. Sequence analysis revealed that the clone included two exons corresponding to 473 to 1644 bp of sf3'h1 cDNA (DDBJ accession number: AB061212) separated by a 901-bp intron, and it lacks the upstream region (Fig. 1). The clone was presumed to contain the region downstream from the middle of an intron. To clone the upstream genomic region, genomic Southern analysis was performed using restriction enzymes producing compatible ends with BamHI (BclI and BglII) using the upstream region (the region from 1 to 515 bp) of the sf3'h1 clone as a probe. BclI digestion produced a positive band with approximate molecular size of 4.9 kb. A mini-library was constructed using the DNA fragments corresponding to the positive band size into the ZAP Express vector. One clone was chosen by plaque hybridization as a candidate. Sequence analysis revealed that the clone with molecular size of about 4.9 kb (F3'H-G2) contained the first exon corresponding to 1 to 472 bp of sf3'hl cDNA and approximately 1.5 kb upstream from the start codon. The two clones from the genomic library, F3'H-G1 and F3'H-G2, have an overlapping region of 644 bp and the DNA sequence of this region was identical in these two clones. Cloning and sequence analysis of the region spanning these two clones using the PCR primer no. 7 (Fig. 1 and Table 1) confirmed that the two clones were derived from a single gene and that the two clones cover the entire F3'H gene.

Structure of the F3'H Gene

Sequence analysis of the two genomic clones revealed that soybean F3'H gene consisted of three exons and two introns (Fig. 1). DNA sequences were deposited in the DDBJ database under the accession numbers of AB191404 (entire gene in To7B), AB191405 (5'-upstream region in To7G) and AB191406 (first intron in To7G). The first intron of To7B is 4114 bp long and corresponds to the large intron partly examined by Zabala and Vodkin (2003). DNA sequences of the first intron differed at 14 positions between To7B and To7G (data not shown). However, the differences were either single-base Indel or single-base substitution. Large segments of recombination, deletion, or substitution were not observed.

Motif analysis of the 1.5-kb upstream region from the start codon probably corresponding to the promoter revealed a plant MYB-binding domain (AACCAAAC) at [approximately equal to] 1400 bp upstream and a G-box core sequence (CACGTG) at [approximately equal to] 1250 bp upstream of the start codon (Fig. 2). Further, a binding motif of plant R2R3-MYB proteins (motif type IIG; GTTTGGTA; Romero et al., 1998) and 26 TA repeats were found at [approximately equal to] 280 bp and [approximately equal to] 940 bp upstream from the start codon, respectively. MYB proteins, along with basic helix-loop-helix proteins and WD40 proteins, comprise one of the major regulatory proteins in flavonoid biosynthesis in maize (Zea mays L.), Antirrhinum, and petunia (Petunia hybrida Vilm.) (Mol et al., 1998). The consensus sequence of plant MYB-binding domain has been found in promoters of flavonoid biosynthetic genes such as phenylalanine ammonia lyase, chalcone synthase, and dihydroflavonol 4-reductase (Sablowski et al., 1994).

[FIGURE 2 OMITTED]

G-boxes, elements with the core sequence CACGTG, are found in the promoters of many genes responsive to a variety of different stimuli such as light, anaerobiosis, and abscisic acid (Terzaghi and Cashmore, 1995). AT-rich sequences are bound by nuclear proteins and have been found in numerous light-regulated promoters, including the tomato (Lycopersicon esculentum Mill.) RBCS3A, pea (Pisum sativum L.) RBCS3A, maize CAB-ml, and pea GS2 (Terzaghi and Cashmore, 1995). Function of the MYB-binding domains, G-box, and AT-rich repeats should be confirmed by in vivo assays.

Number and structure of the TA repeats differed among cultivars. TTAA was interposed within the TA repeats in To7G (tt), Moshidou Gong 503 (TT), Clark (TT), Toyosuzu (tt), and Harosoy (tt), while absent in To7B (TT), Misuzudaizu (tt), and Karafuto-1 (TT). The exact number of TA repeats could not be determined in most cultivars. Number of TA repeats generally differed by 1 to 3 among four DNA clones derived from identical cultivars even using KOD DNA Polymerase (TOYOBO, Tokyo, Japan) with high PCR fidelity. However, the number of TA repeats substantially differed among cultivars, and varietal differences were evident (Table 2). It is uncertain whether the structure or number of TA repeats is associated with the expression profile of the F3'H gene. The other regions in the promoter differed by single-base substitutions at two positions and a three-base Indel at one position among the eight cultivars (data not shown).

Construction of SSR Marker for F3'H Gene

A pair of PCR primers flanking the TA repeats (designated as SoyF3'H; forward primer, GTCATAAAAT ATCATTATTATTATATCTATTAA; reverse primer, CACTCCCAAAAGCTTTTAAGTGT) produced polymorphic PCR bands among cultivars (Fig. 3). Generally, size of the PCR band was not largely different among tawny pubescence cultivars (TT), whereas the band size was highly variable among gray pubescence cultivars (tt). The band size was approximately similar to that expected from the promoter sequences (Table 2). SSR analysis using 89 [F.sub.2] plants segregating for T locus revealed that the band polymorphism cosegregated with genotypes at the T locus (Fig. 4). The SSR marker may be useful as an internal marker of F3'H gene even in populations when pubescence color is not different between parents.

[FIGURES 3-4 OMITTED]

The [O.sub.2]-diffusion barrier exists in the root nodule cortex that surrounds the central zone of infected cells to maintain low [O.sub.2] concentration, because nitrogenase is irreversibly inactivated by [O.sub.2] (Hunt and Layzell, 1993). We hypothesize that flavonoids with 3', 4'-dihydroxy configuration having higher anti-oxidative activity may protect the [O.sub.2]-diffusion barrier by scavenging the activated form of [O.sub.2] generated under low temperature conditions in root nodules. Two consensus DNA sequences for nodulin, AAAGAT and CTCTT, were identified in soybean (Stougaard et al., 1987). The F3'H promoter contained four copies of the former motif but lacks the latter motif (data not shown). Tissue specificity of F3'H gene expression should be investigated. Detailed physiological and histological studies may be necessary to prove the anti-oxidative hypothesis. The promoter sequence information obtained in this report may be useful for investigations on the transcriptional control of the F3'H gene including the regulatory mechanism and tissue or stress specific expression. Further, the native F3'H promoter may be useful for the transgenic experiments to investigate the relationship between F3'H gene and chilling tolerance in soybean.

ACKNOWLEDGMENTS

We thank the staff of the Soybean Breeding Laboratory, Tokachi Agric. Exp. Stn., Memuro, Hokkaido, Japan for providing the seeds of the isolines. We are grateful to Dr. S. Akada (Hirosaki University) and Dr. H. Matsumoto (University of Tsukuba) for advice, and Dr. Joseph G. Dubouzet (National Institute of Crop Science) for critical reading of the manuscript. This study was partially supported by the Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

Abbreviations: bp, base pair; F3'H, flavonoid 3'-hydroxylase; kb, kilo-base; NILs, near-isogenic lines; SSR, simple sequence repeat.

REFERENCES

Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.

Buttery, B.R., and R.I. Buzzell. 1973. Varietal differences in leaf flavonoids of soybeans. Crop Sci. 13:103-106.

Cober, E.R., G.R. Ablett, R.I. Buzzell, B.M. Luzzi, V. Poysa, A.S. Sahota, and H.D. Voldeng. 1998. Imperfect yellow hilum color in soybean is conditioned by II rr TT. Crop Sci. 38:940-941.

Cober, E.R., J.A. Fregeau-Reid, and H.D. Voldeng. 1996. Soybean seed coat discoloration. Can. Soybean Tech. Bull. 1(2):2.

Higo, K., Y. Ugawa, M. Iwamoto, and T. Korenaga. 1999. Plant cis-acting regulatory DNA elements (PLACE) databases. Nucleic Acids Res. 27:297-300.

Hunt, S., and D.B. Layzell. 1993. Gas exchange of legume nodules and the regulation of nitrogenase activity. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44:483-511.

Kawasaki, S., and Y. Murakami. 2000. Genome analysis of Lotus japonicus. J. Plant Res. 113:497-506.

Kurosaki, H., and S. Yumoto. 2001. Effects of temperatures during reproductive periods on color tune of hilum and seed coat in near isogenic lines for pubescence color in soybean. (In Japanese.) Rep. Hokkaido Branch, Crop Sci. Soc. Jpn. and Hokkaido Branch. Jpn. Soc. Breed. 42:155-156.

Kurosaki, H., S. Yumoto, and I. Matsukawa. 2004. Correlation of cold-weather tolerance with pubescence color and flowering time in yellow hilum soybeans in Hokkaido. Breed. Sci. 54:303-311.

Mol, J., E. Grotewold, and R. Koes. 1998. How genes paint flowers and seeds. Trends Plant Sci. 3:212-217.

Morrison, M.J., H.D. Voldeng, and R.J.D. Guillemette. 1994. Soybean pubescence color influences seed yield in cool-season climates. Agron. J. 86:796-799.

Murray, M.G., and W.F. Thompson. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8:4321-4325.

Palmer, R.G., T.W. Pfeiffer, G.R. Buss, and T.C. Kilen. 2004. Qualitative genetics, p. 137 233. In H.R. Boerma and J.E. Specht (ed.)

Soybeans: Improvement, production, and uses. 3rd. ed. Agron. Monogr. 16. ASA, CSSA, and SSSA, Madison, WI.

Pratt, D.E. 1976. Role of flavones and related compounds in retarding lipid-oxidative flavor changes in foods, p. 1-13. In G. Charalambous and I. Katz (ed.) Phenolic, sulfur, and nitrogen compounds in food flavors. ACS Symposium Series 26. Am. Chem. Soc., Washington, DC.

Raper, C.D., and P.J. Kramer. 1987. Stress physiology, p. 589-641. In J.R. Wilcox (ed.) Soybeans: Improvement, production, and uses. 2nd. ed. Agron. Monogr. 16. ASA, CSSA, and SSSA, Madison, WI.

Romero, I., A. Fuertes, M.J. Benito, J.M. Malpica, A. Leyva, and J. Paz-Ares. 1998. More than 80RZR3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J. 14:273-284.

Sablowski, R.W.M., E. Moyano, F.A. Culianez-Macia, W. Schuch, C. Martin, and M. Bevan. 1994. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes. EMBO J. 13:128-137.

Sambrook, J., and D.W. Russell. 2001. Molecular cloning. A laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Schori, A., and T. Gass. 1994. Description of two flowering types and [F.sub.2] segregation in relation to pubescence color. Soybean Genet. Newsl. 21:156-160.

Stougaard, J., N.N. Sandal, A. Gron, A. Kuhle, and K.A. Marcker. 1987.5' Analysis of the soybean leghaemoglobin lbc3 gene: Regulatory elements required for promoter activity and organ specificity. EMBO J. 6:3565-3569.

Sunada, K., and T. Ito. 1982. Soybean grain quality as affected by low temperature treatments in plants (color of hilum, seed coat cracking). (In Japanese.) Rep. Hokkaido Branch, Crop Sci. Soc. Jpn. and Hokkaido Branch. Jpn. Soc. Breed. 22:34.

Takahashi, R. 1997. Association of soybean genes I and T with low-temperature induced seed coat deterioration. Crop Sci. 37:1755-1759.

Takahashi, R., and S. Asanuma. 1996. Association of T gene with chilling tolerance in soybean. Crop Sci. 36:559-562.

Takahashi, R., E.R. Benitez, H. Funatsuki, and S. Ohnishi. 2005. Soybean maturity and pubescence color genes improve chilling tolerance. Crop Sci. 45:1387-1393.

Terzaghi, W.B., and A.R. Cashmore. 1995. Light-regulated transcription. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:445-474.

Toda, K., D. Yang, N. Yamanaka, S. Watanabe, K. Harada, and R. Takahashi. 2002. A single-base deletion in soybean flavonoid 3'-hydroxylase gene is associated with gray pubescence color. Plant Mol. Biol. 50:187-196.

Zabala, G., and L.O. Vodkin. 2003. Cloning of the pleiotropic T locus in soybean and two recessive alleles that differentially affect structure and expression of the encoded flavonoid 3' hydroxylase. Genetics 163:295-309.

Kyoko Toda, Maiko Akasaka, Emilyn G. Dubouzet, Shinji Kawasaki, and Ryoji Takahashi *

K. Toda, E.G. Dubouzet, and R. Takahashi, National Institute of Crop Science and University of Tsukuba, Kannondai 2-1-18, Tsukuba, Ibaraki, 305-8518 Japan: M. Akasaka, National Agric. Research Center, Tsukuba, Ibaraki, 305-8666 Japan; S. Kawasaki, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602 Japan. Received 25 Oct. 2005. * Corresponding author (masako@affrc.go.jp).
Table 1. PCR primers used for the analysis of F3'H gene and their
corresponding product lengths in To7G.

Primer
designation    Forward primer (5' to 3')    Reverse primer (5' to 3')

no.

1              GATCATCCATCCACGATAGTTTC      CGTGTGAGATCAAAAAATCTTTC
2              CATCTCAAATACATGTAAATGTAA     GAGCCTTTGAAATACAATTCAC
3              ATTGAGTTTGAAGAAGAAACTTCC     GCGGCAACCACGACATCGACGAAG
4              GATGTCGTGGTTGCCGCGTCG        CAACTCATTTTAGCAAGCATAAC
5              GCGGTTTTCCTTTTATGTCATT       ATTTTCAAACTATAATAACTAAAAGAG
6              TATCAAACAGATAATATAAAGTTTC    CACGCGTTTCAAATGTGGC
7              AAACTACGTATTTTTATATTACTG     GGGGTAGAATGAAAATGCGATG
8              CTCCTAGGTTAAAATAGTAAATC      GAAGGAATAGAGAAATAGAAATGA
9              CCAGACACGTACAGCTACAA         CTGAACTTGCCAAGTTGCAT

Primer          Annealing     Product
designation    temperature    length

no.            [degrees]C       bp

1                  58           676
2                  56          1085
3                  58           735
4                  58           848
5                  54           793
6                  54           743
7                  54          1494
8                  54           834
9                  54           975

Table 2. Structure of TA repeats in the promoter region and expected
amplicon size in SSR analysis of a pair of near-isogenic lines for
T gene, To7B and To7G, and six soybean cultivars.

                     Alleles                               Expected
                       at                                  amplicon
Cultivar             T locus    Structure of TA repeats    size (bp)

To7B                   TT       TA (26)                     181
Karafuto-1             TT       TA (27-28)                  183-185
Mosbidou Gong 503      TT       TA (3)-TTAA-TA (20-21)      179-181
Clark                  TT       TA (3)-TTAA-TA (16-18)      171-175
To7G                   tt       TA (3)-TTAA-TA (10)         159
Toyosuzu               tt       TA (3)-TTAA-TA (24-27)      187-193
Misuzudaizu            tt       TA (28-29)                  185-187
Harosoy                tt       TA (3)-TTAA-TA (30-33)      199-205
COPYRIGHT 2005 Crop Science Society of America
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Toda, Kyoko; Akasaka, Maiko; Dubouzet, Emilyn G.; Kawasaki, Shinji; Takahashi, Ryoji
Publication:Crop Science
Geographic Code:9JAPA
Date:Nov 1, 2005
Words:3744
Previous Article:Agronomic performance of recombinant inbred line populations segregating for isoflavone content in soybean seeds.
Next Article:Barley HVA1 gene confers salt tolerance in R3 transgenic oat.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters