Printer Friendly

Structure Function Relationship of Lactate Dehydrogenase/ e-Crystallin from Lenses of Indian Spiny-Tailed Lizard (Uromastyx hardwickii).

Byline: Ambreen Atta, Amber Ilyas, Zehra Hashim and Shamshad Zarina

ABSTRACT

Eye lens is a fascinating object to study protein evolution. Lenses contain highly stable long-lived proteins with the least turnover. Lens transparency is maintained by water soluble proteins classified into ubiquitous (a, b and g crystallin) and taxon-specific lens crystallins. Ubiquitous crystallins show great diversity among vertebrates and invertebrates due to selective pressure leading to adaptive conflict. Taxon-specific lens crystallins, on the other hand, are products of gene sharing or gene duplication phenomenon where metabolic enzymes are recruited as crystallins in addition to their structural role. Current investigation was designed to study the evolutionary changes and discriminating adaptations in lens proteins. For this purpose, Indian spiny-tailed lizard Uromastyx hardwickii was used as an evolutionary model. We report partial nucleotide sequence of LDH/e-crystallin comprising of 628 bp corresponding to 209 amino acids from lenses of Uromastyx hardwickii.

To get more insight about the structure-function relationship, bioinformatics tools were used. Homology between sequences of e-crystallin and LDH and conservation of catalytic residues indicated that e-crystallin is a result of recruitment through gene sharing phenomenon.

Key words

Biochemical adaptation Lactate dehydrogenase B e-crystallin, gene sharing Uromastyx hardwickii

INTRODUCTION

Ocular lens is an interesting object to study evolution, cell differentiation, aging and selective adaptation. In lens, transparency and light refractive properties are maintained by water soluble proteins known as crystallins (Bloemendal, 1981). Crystallins are long-lived, stable proteins with the least turnover (de Jong et al., 1989) and can resist various toxic environmental pressures. Crystallins consist of two groups known as ubiquitous (a, b, g crystallin) and taxon-specific lens crystallins. The members of former group are abundantly found in most of the living organisms. The latter group, however, has limited distribution and has been evolved by a gene recruitment phenomenon (Wistow, 1995).

Taxon-specific crystallins were first discovered in lenses from birds followed by many studies in other species (Williams and Piatigorsky, 1979). Birds and reptiles have diverged approximately 200 million years ago and still share several morphological characters (Keeton, 1972). Major taxon-specific lens crystallins in birds and reptiles are e-crystallin and d-crystallin (de Jong et al., 1981). e-crystallin is closely related to LDH-B enzyme, is catalytically active and contains a dinucleotide fold for NADH binding (Wistow et al., 1987). Duck lens e-crystallin and LDH-B are suggested to be the products of same gene, evolved by gene sharing phenomenon (Hendricks et al., 1988). e-crystallin has evolved at a slower rate (2 to 4 substitutions per 100 residues per 100 million years) as compared to other crystallins. e-crystallin was first observed in avian lenses (Stapel et al., 1985).

Later, e-crystallin was discovered in reptilian lens but was not found in other taxa (Stapel et al., 1985).

The level of LDH/e-crystallin varies from species to species. Wistow et al. (1990) reported up to 40% of total soluble proteins from lens of humming bird. In birds and reptiles, it was found up to 23% of total water-soluble proteins (Wistow et al., 1987, Stapel et al., 1985). The only complete sequence of e-crystallin has been reported from duck lens (Hendricks et al., 1988) while among reptiles, members of order Crocodilia (caiman, crocodiles and alligator) (Stapel et al., 1985) and Squamata (Gecko phelsuma and Uromastyx hardwickii) showed existence of e-crystallin (Roll et al., 1996; Atta et al., 2014). These investigations, however, mostly dealt with kinetic, immunostaining detection and partial sequence studies. Chiou and colleagues (Chiou et al., 1991) reported the presence of e-crystallin in caiman lenses. They have conducted kinetic studies of caiman e-crystallin and compared their results with duck e-crystallin.

Another study (Stapel et al., 1985) highlighted presence of e-crystallin in alligator, Heron and tufted duck using two-dimensional electrophoresis. The presence of e-crystallin in gecko lens was confirmed by using an immunostaining method (Roll et al., 1996). A recent study has reported partial characterization of LDH like crystallin from Uromastyx hardwickii at mRNA level (Atta et al., 2014). In this communication, we report the partial sequence of LDH/e-crystallin like protein from the water-soluble lens fraction of Uromastyx hardwickii. Furthermore, the observed sequence has been explored to examine structure-function relationships.

MATERIALS AND METHODS

Sample collection

Fresh lenses from Uromastyx hardwickii were obtained after the approval of Institutional Review Board to conduct this study. All procedures were in accordance with the standards set forth in the Guide for the Care and Use of Laboratory Animals (National Academy of Science, National Academy Press, Washington, D.C.).

Gene expression analysis using RT-PCR

Total RNA was extracted from U. hardwickii lenses by using SV total RNA isolation system kit (Promega, USA) according to manufacturer's protocol. mRNA was reverse transcribed using SuperScript(r) III First-Strand Synthesis System (Invitrogen, UK). PCR of e-crystallin/LDH gene was performed using total lens cDNA as template. Each 50 ul reaction volume contained cDNA (5ug), 2X Master Mix (GoTaq(r) Green Master Mix (2X) Promega, U.S.A) with 0.4uM sense and 0.4uM antisense primers respective to LDH gene. Primers were designed from LDH fingerprinting and phosphate-specific binding region (NAD(H) pyrophosphate binding site) (Birktoft et al., 1982). PCR blank and RT blank were used as negative controls. Primer sequences and annealing temperatures (Tm) are given in Table I. Four sense and one common antisense primer was used. PCR conditions were: denaturation at 94C for 2 min, annealing at 53-55C for 1.5 min and extension at 74C for 1 min.

35 cycles of PCR were performed for gene amplification in gradient thermocycler (Eppendorf).

PCR products were visualized by using agarose gel electrophoresis. 2% agarose gel was prepared in TBE buffer (45mM Tris, 45mM boric acid, 1mM EDTA) pH 8.5. Ethidium bromide (0.5ug/mL) was used to visualize PCR products under UV light using gel documentation system (Bio-Rad). 100 bp DNA ladder was used as marker.

DNA sequencing

Purified PCR products and 10 pmol forward and reverse primers were directly sent to First BASE Laboratories (Selangor, Malaysia) for DNA sequencing. Analysis of DNA sequences was done by using basic local alignment search tool (BLAST) (www.ncbi.nlm.nih.gov/blast). DNA sequence was submitted to GenBank data base.

Bioinformatics analysis

In silico translation was performed using translate tool of ExPASy server (http://web.expasy.org/translate/) and resulting amino acid sequence was submitted to online automated three-dimensional structure prediction server SWISS-MODEL (http://swissmodel.expasy.org/). The coordinates of human lactate dehydrogenase (PDB ID: 1I0Z) were used as a template which showed 90% sequence similarity with target sequence. The model was evaluated by PROCHECK (Laskowski et al., 1993) while domain identification was performed using InterPro (https://www.ebi.ac.uk/interpro). For multiple sequence alignment CLUSTALW online tool was employed (http://www.genome.jp/tools/clustalw/). BOXSHADE alignment tool (Version 3.21) was used for depicting multiple sequence alignment in color (http://www.ch.embnet.org/software/BOX_form.html). Phylogenetic analysis was performed using protein maximum likelihood without molecular clock module of PHYLIP software (Retief, 1999).

Tree was drawn using drawgram tool (Felsenstein, 1991). To assess the reliability of the dataset and validity of results, bootstrapping was performed (Hillis and Bull, 1993). Resulting trees with and without bootstrapping were compared and results were analyzed. Results with 70% or more score in bootstrapping were considered significant.

RESULTS AND DISCUSSION

U. hardwickii lives in desert and is highly exposed to UV radiations (Zain-Ul-Abedin and Barbara, 1977). Earlier studies have focused on biochemical changes of tissues/body fluids from U. hardwickii with reference to their variable environmental factors (Ahmed et al., 2006; Barka-Dahane et al., 2010). In the present study, we report partial nucleotide and protein sequence of LDH like crystallin from U. hardwickii lenses. Gene expression analysis using LDH gene primers (Table I) resulted in four PCR products (Fig.1) which were subjected to sequencing. Resulting sequences were overlapped and a final sequence of 628 bp was obtained (Fig. 2a). Nucleotide sequence was submitted to GenBank data base (KJ432281) and UniprotKB database (X2J6H4). The gene sequence was conceptually translated to 209 amino acids using ExPASy translate tool (Fig. 2b). The three dimensional structure of partial amino acid sequence (209 residues) was constructed using Human LDH (1I0Z) as a template (Fig. 3).

Human LDH is a homotetrameric molecule comprising of 333 residues in each chain. Since we were unable to get a complete sequence, partial sequence was used for analysis. Structure analysis revealed retention of overall fold, catalytically crucial residues, cofactor binding site and antigenic loop (Fig. 4). Our modeled structure depicted tetrameric structure comprising of a-helices and b-sheets. The X-ray structure of the template indicated four monomeric units; each comprising of two domains namely Rossmann fold and substrate-binding domain (Read et al., 2001). The predicted model had the same orientation for the active site region (100-111) and antigenic loop (221-227) as for the template (Fig. 3). Model accuracy was evaluated by PROCHECK which indicated that the predicted model contained more than 90% residues in core region and none in disallowed region suggesting a good model. InterPro analysis also revealed relationship with lactate/malate dehygrogenase (results not shown).

Table I.- Sequences of forward (F), reverse (R) primers and predicted melting temperatures used for the study.

PCR primers###Primer sequence###Predicted Tm (C)

Primer-1###F: 5' GGCCAAGTCGGGATGGC 3'###54

###R: 5' CCCTTGACCATGGTGGATAC 3'###62.4

Primer-2###F: 5'GAAATGATGGATCTACAGCATGG 3'###55

###R: 5' CCCTTGACCATGGTGGATAC 3'###62.4

Primer-3###F: 5' GTCCGCCAGCAAGAAGGG 3'###53

###R: 5' CCCTTGACCATGGTGGATAC 3'###62.4

Primer-4###F: 5' CGTCTTGATCTTGTGCAGAGG 3'###54

###R: 5' CCCTTGACCATGGTGGATAC 3'###62.4

To examine the evolutionary relationship, sequences of LDH/e-crystallin like protein (U. hardwickii, duck) and LDH (fish, amphibians, birds, mammals, reptiles) were used to construct a phylogenetic tree. Results of phylogenetic analysis (Fig. 5) revealed that the sequence of LDH/e-crystallin like protein from U. hardwickii has evolved from lizards (I. iguana and S. undulates). Reliability of the tree is evident from high bootstrap values thus supporting observed topology.

Multiple sequence alignment of LDH/e-crystallin like protein from U. hardwickii with e-crystallin (duck) and LDH (Iguana iguana, Sceloporus undulates and Homo sapiens) is shown in Figure 6. Residues critical for catalytic activity and substrate recognition include Arg100, Gln101, Arg107, Ser162, Asp167, Arg170, Arg172, and His194 were found to be conserved in all sequences including LDH/e-crystallin like protein from U. hardwickii (Fig. 6). His194 is suggested to act as catalytic acid which in turn is stabilized by Asp167 (Read et al., 2001) while Arg107 has shown to assist in transition state stabilization (Clarke et al., 1986). All of the critical residues are retained in LDH/e-crystallin like protein from U. hardwickii suggesting the likelihood of the protein to be catalytically functional.

It has been observed that among taxon-specific crystallin, e-crystallin distribution is restricted to avian and reptilian species. It is also established that e-crystallin has sequence homology with LDH (Wistow et al., 1987). e-crystallin was first reported in duck lenses (De Jong et al., 1981) followed by identification in various birds. In duck, epsilon crystallin was reported as an abundant lens crystallin and shows high sequence similarity with heart LDH-B (Hendriks et al., 1988). We reported earlier nucleotide sequence of e-crystallin from U. hardwickii lenses comprising of 119 bp (Atta et al., 2014). In vertebrates, enzymes and enzyme-crystallins are encoded by identical genes (Piatigorsky and Wistow, 1991). It has also been documented that in non-lens tissues, expression of enzyme crystallins is low while within lens, higher concentrations are found to fulfill their requirement as a structural taxon-specific protein (Thomas and Dimonie, 1990).

Although the presence of e-crystallin could not be ascertained at protein level, mRNA and enzyme activity data suggests presence of LDH like protein in U. hardwickii lenses. Current data provides helpful information in the perspective of lens development mechanism and visual adaptive conflict in species under selective pressures during evolution.

ACKNOWLEDGMENTS

First BASE Laboratories (Selangor, Malaysia) is acknowledged for providing DNA sequencing facility.

Statement of conflict of interest

Authors have declared no conflict of interest.

REFERENCES

Ahmed, M., Ahmad, M., Hasan, R., Qureshi, A. and Ahmed, Z., 2006. The effects of mefenamic acid on hematocrit of the lizard, Uromastix hardwickii. Pak. J. pharm. Sci., 19: 48-51.

Atta, A., Ilyas, A., Hashim, Z., Ahmed, A. and Zarina, S., 2014. Lactate dehydrogenase like crystallin: A potentially protective shield for Indian spiny-tailed lizard (Uromastyx hardwickii) lens against environmental stress? Protein J., 33: 128-134.

Barka-Dahane, Z., Bendjelloul, M., Estabel, J. and Exbrayat, J.M., 2010. The distribution of vasotocin and mesotocin immunoreactivity in the hypothalamic magnocellular neurosecretory nuclei of the Saharan herbivorous lizard, Uromastix acanthinurus Bell, 1825 (Sauria-Agamidae). Histol. Histopathol., 25: 159-175.

Birktoft, J.J., Fernley, R.T., Bradshaw, R.A. and Banaszak, L.J., 1982. Amino acid sequence homology among the 2-hydroxy acid dehydrogenases: mitochondrial and cytoplasmic malate dehydrogenases form a homologous system with lactate dehydrogenase. Proc. natl. Acad. Sci. USA., 79: 6166-6170.

Bloemendal, H., 1981. Molecular and cellular biology of the eye lens (ed. H. Bloemendal), Wiley and Sons, New York, pp. 1-47.

Chiou, S.H., Lee, H.J., Huang, S.M. and Chang, G.G., 1991. Kinetic comparison of caiman epsilon-crystallin and authentic lactate dehydrogenases of vertebrates. J. Protein Chem., 10: 161-166.

Clarke, A.R., Wigley, D.B., Chia, W.N., Barstow, D., Atkinson, T. and Holbrook, J., 1986. Site-directed mutagenesis reveals role of mobile arginine residue in lactate dehydrogenase catalysis. Nature, 324: 699-702

De Jong, W.W., Hendriks, W., Mulders, J.W. and Bloemendal, H., 1989. Evolution of eye lens crystallins: the stress connection. Trends Biochem. Sci., 14: 365-368.

De Jong, W.W., Stapel, S.O. and Zweers, A., 1981. e-Crystallin, a novel avian and reptilian eye lens protein. Comp. Biochem. Physiol., 69: 593-598.

Felsenstein, J., 1991. PHYLIP (Phylogeny Inference Package), Version 3.4. Distributed by the author, University of Washington, Seattle, Washington.

Hendriks, W., Mulders, J.W., Bibby, M.A., Slingsby, C., Bloemendal, H. and De Jong, W.W., 1988. Duck lens epsilon-crystallin and lactate dehydrogenase B4 are identical: a single-copy gene product with two distinct functions. Proc. natl. Acad. Sci. U.S.A., 85: 7114-7118.

Hillis, D.M. and Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System. Biol., 42: 182-92.

Keeton, W.T., 1972. Biological science. 2nd edition, Norton, New York.

Laskowski, R.A., MaCarthur, M.W. and Thornton, J.M., 1993. PROCHECK: a program to check the stereochemical quality of protein structure. J. appl. Crystallogr., 26: 283-291.

Piatigorsky, J. and Wistow, G., 1991. The recruitment of crystallins: New function precedes gene duplication. Science, 252: 1078-79.

Read, J.A., Winter, V.J., Eszes, C.M., Sessions, R.B. and Brady, R.L., 2001. Structural basis for altered activity of M-and H-Isozyme forms of human lactate dehydrogenase. Proteins: Struct. Funct. Genet., 43: 175-185.

Retief, J.D., 1999. Phylogenetic analysis using PHYLIP. Meth. Mol. Biol., 132: 243-258.

Roll, B., Amons, R. and De Jong, W.W., 1996. Vitamin A2 bound to cellular retinol-binding protein as ultraviolet filter in the eye lens of the gecko Lygodactylus picturatus. J. biol. Chem., 271: 10437-40.

Stapel, S.O., Zweers, A., Dodemont, H.J., Kan, J.H. and De Jong, W.W., 1985. e-Crystallin, a novel avian and reptilian eye lens protein. Eur. J. Biochem., 147: 129-136.

Thomas, J.C. and Dimonie, V., 1990. Fiber optic dynamic light scattering from concentrated dispersions. 3: Particle sizing in concentrates. Appl. Opt., 29: 5332-5335.

Williams, L.A. and Piatigorsky, J., 1979. Heterogeneity of delta-crystallins of the embryonic mallard lens. Correlation between subunit compositions and isoelectric points. Biochemistry, 18: 1438-42.

Wistow, G.J., 1995. Molecular biology and evolution of crystallins: gene recruitment and multifunctional proteins in the eye lens. R.G. Landes Co., Austin TX and Springer, New York.

Wistow, G.J., Anderson, A. and Piatigorsky, J., 1990. Evidence for neutral and selective processes in the recruitment of enzyme-crystallins in avian lenses. Proc. natl. Acad. Sci., 87: 6277-80.

Wistow, G.J., Mulders, J.W. and De Jong, W.W., 1987. The enzyme lactate dehydrogenase as a structural protein in avian and crocodilian lenses. Nature, 326: 622-624.

Zain-ul-Abedin, M. and Barbara, K.Z., 1977. In: Characterization, biochemistry of the lizard Uromastix hardwickii, University of Karachi Press, Karachi.
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Atta, Ambreen; Ilyas, Amber; Hashim, Zehra; Zarina, Shamshad
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Aug 31, 2016
Words:2858
Previous Article:Compositional Profiling and Proteolytic Activities in Cow and Buffalo Milk Cheddar Cheese.
Next Article:Effect of Acidification in a Phytase Sprayed Sunflower Meal Based Diet on Growth and Dietary Nutrient Digestibility Performances of Labeo rohita...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters