Printer Friendly

Spectrum of Lactobacillus species present in healthy vagina of Indian women.

Background & objectives: Laetobacilli are depleted in vagina of women suffering from recurring episodes of bacterial vaginosis with vaginal pH [greater than or equal to] 5. With the objective of making available probiotic lactobacilli for replenishment in such women, a study was undertaken to isolate and characterize the Lactobacilli present in women with eco-healthy vagina in Delhi. No information is so far available on the species of Lactobacilli resident in vagina of women in India.

Methods: Vaginal swabs were taken from 80 women with informed consent after ethical approval and grown in MRS broth. Gram-positive, catalase-negative bacilli generating about 200 bp amplicon by PCR with Lactobacillus genus specific primers were further characterized by employing species specific primers followed by sequencing of 16S rDNA. Isolates of the same species were differentiated by random amplified polymorphic DNA (RAPD) profiles.

Results: The predominant species isolated were L. reuteri present in 26 (32.5%) women, Lfermentum in 20 (25%), and L. salivarius in 13 (16.25%) women. Sequencing of t6S rDNA of 20 isolates showed that except for two isolates of L plantarum, sequences of the remaining agreed well with PCR identification. None of the isolates had similar RAPD profile.

Interpretation & conclusions: Our findings showed lactobacilli species present in healthy vagina of women in India differ from those reported from other countries. This information would be useful to development of probiotic tablets seeking to replenish the missing lactobacilli for reproductive health of women in India.

Key words Bacterial vaginosis--Lactobacillus--PCR--RAPD--16S rDNA sequencing--variable strains

**********

The role of probiotics in conferring benefit to the host is being increasingly realized. However, most reports are on probiotics in dairy products which are of industrial importance and employed in fermented food items. Few reports are available on probiotics resident in female reproductive tract even though the presence of lactobacilli in vagina was first observed by Doderlein in 1894 (1). By virtue of their non pathogenic character, their ability to make lactic acid and thereby keeping vaginal pH around 4 (2), secrete [H.sub.2][0.sub.2] (3), and bacteriocins (4), lactobacilli presumably exercise local anti-microbial action against pathogens.

During the course of a study in women with recurring episodes of bacterial vaginosis (BV), caused by a variety of reproductive tract infections (RTIs), it was noted that the vaginal pH of many women was between 5-7 and that no lactobacilli could be isolated from majority of these women (unpublished observations). Treatment with antibiotics and drugs brought in relief only temporarily. They required replenishment of probiotic lactobacilli for hopefully better reproductive health. As no information was available on the species of lactobacilli inhabiting vagina of women in India, this study was undertaken to isolate and identify lactobacilli resident in healthy vagina of women in Delhi.

Material & Methods

Sampling: With approval of the Institutional Ethics Committee of Sir Ganga Ram Hospital, New Delhi, and after obtaining informed consent of the subjects; vaginal isolates were collected during 2 years from January 2004 to January 2006 from 80 women visiting OPD for either family planning contraceptives or antenatal and post-natal care. The subjects examined were of reproductive age (18-45 yr, mean 26 [+ or -] 3 yr) with healthy vagina having pH 4-4.5, Nugent score [less than or equal to] 4, and no visible infection as seen by speculum examination. A sterile swab was rolled over high vaginal wall and placed in sterile screw cap tubes containing MRS (deMan, Rogosa and Sharpe) broth (HiMedia, India). After bringing the samples to the Talwar Research Foundation Laboratory, New Delhi, the swab was spread on BCP-MRS agar plate. BCP (Bromo-cresol purple, Merck, India) is a colour indicator dye with pH range 5.2-6.8. It turns from purple to yellow with lowering of pH, thus the colony producing lactic acid is identifiable by the yellow color. The plate was incubated at 37[degrees]C in anaerobic jar for 24-48 h. A representative single colony was selected from each isolate and Gram stained. Catalase test was done by pouring a drop of [H.sub.2][O.sub.2] on a colony, and absence of oxygen bubble formation indicated absence of catalase (5). Gram-positive, catalase negative colonies were cultured individually in MRS broth and stored in 20 per cent glycerol at -20[degrees]C.

Genus and species identification by PCR: DNA was isolated by the method described by Pospiech & Neumann (6) with minor modifications. Two ml of culture in MRS broth was centrifuged at 6,000 g for 10 min, and the pellet obtained was suspended in SET buffer (NAC1 75 mM, EDTA 25 mM, Tris 20 mM, pH 7.5) containing 1mg/ml lysozyme (Amresco, USA) and incubated at 37[degrees]C for 1 h. Cell debris was removed by lysis with 10 per cent sodium dodecyl sulphate (SDS) for 30 min at 37[degrees]C and precipitation by 5M NaCl for 30 min. DNA was extracted with chloroform: isoamylalcohol (24:1), precipitated with isopropanol at -20[degrees]C, washed with 70 per cent ethanol and dried under vacuum. The DNA was then suspended in 20 [micro]l of TE buffer (Tris 10 mM, EDTA 1 mM, pH 8.0). Each isolate was then identified to the genus level by amplification with genus specific primer LbLMA-rev (5' CTC AAA ACT AAA CAAAGT TTC 3') and a universal primer R16-1 (5' CTT GTA CAC ACC GCC CGT TCA 3') using programme as initial denaturation at 94[degrees]C for 5 min, followed by 30 cycles of denaturation at 94[degrees]C for 30 sec, annealing at 55[degrees]C and extension at 72[degrees]C for 30 sec and 7 min thereafter (7). After confirming the genus, multiplex PCR-G was employed to determine the group to which an isolate belonged to using primer mix containing equimolar 4 forward primers namely Ldel-7(5'ACAGATGGATGGAGAGCAGA 3'), LU-1'(5'ATTGTAGAGCGACCGAGAAG3'), LU-3'(5'AAACCGAGAACACCGCGTT 3'), LU-5' (5 'CTAGCGGGTGCACTITGTT 3') and 1 commonreverse primer Lac-2 (5'CCTCTTCGCTCGCCGCTACT 3') as per Song et al (8). The primers were got synthesized by order from Sigma, Bangalore. PCR programme (PCR-G) employed initial denaturation at 95[degrees]C for 1 min followed by 35 cycles of denaturation at 95[degrees]C for 20 sec, annealing and extension at 55[degrees]C for 2 min; and final extension at 74[degrees]C for 5 min. Species were identified by multiplex PCR assays as given in Table I. PCR programme and reaction mix was same as for PCR-G except annealing temperature which was 68[degrees]C for PCR II-l, 65[degrees]C for PCR II-2, 62[degrees]C for multiplex PCR III and 60[degrees]C for PCR IV. Amplicons were analysed by electrophoresis in 2 per cent agarose gel followed by ethidium bromide staining.

RAPD analysis: Random amplified polymorphic DNA (RAPD) analysis was done to differentiate various strains of the same species isolated. The primer used was 5' AGT CAG CCA C 3' (Sigma, USA) as per Tynkkynen et al. (9) The reaction mix contained 30 ng of template DNA in PCR buffer with 2 mM Mg[Cl.sub.2], 0.2 mM of each nucleotide and 2.5U of Taq polymerase (Life Technologies, India) in a total volume of 25[micro]l. PCR amplification was conducted in an Applied Biosystems Thermal Cycler 2400 (USA) with the following temperature profiles, initial denaturation at 94[degrees]C for 5 min, followed by 30 cycles at 94[degrees]C for45 sec, 32[degrees]C for 2 min, 72[degrees]C for 2 min, and final extension at 72[degrees]C for 5 min. PCR products were visualized on 1.5 per cent agarose gel. Each strain of a given species having different RAPD pattern was numbered separately. 16S rDNA sequencing: Sequencing of 16S rDNA of selected strains of each species of Lactobacillus was carried out at the National JALMA Institute for Leprosy and other Mycobacterial Diseases, Agra. PCR was done using 0. I mM of primer-forward : 5' AGA GTT TGA TCC TGG CTC AG 3' reverse; 5' CCC ACT GCT GCC TCC CGT AG 3', 200 ng of template DNA, 0.2 mM of dNTPs, and 2.5U Taq polymerase (10). The PCR programme was: initial denaturation at 93[degrees]C for 3 min, followed by 30 cycles at 93[degrees]C for 1 min, 48[degrees]C for 1 min, 72[degrees]C for 2 min and final extension at 72[degrees]C for 10 min. PCR mix was run on 1.5 per cent agarose gel at 120 V and 350 bp DNA fragment was eluted from the gel with QIAEX II gel extraction kit (Qiagens, Germany). The eluted DNA fragment was again amplified by PCR in a reaction mixture containing 8 [micro]l of termination ready reaction mix (ABI PRISM, USA), 200 ng of PCR product DNA, 3.2 pmol of one Edwards primer, in a total volume of 20 [micro]l. 35 cycles of sequencing PCR at 94[degrees]C for 10 sec, 48[degrees]C for 5 sec, 60[degrees]C for 4 min was performed, PCR product was purified by adding 0.1 vol. of 3 M sodium acetate (pH 4.5) and 2.5 vol. of absolute ethanol. The sequencing of the amplicon was carried out using the ABI PRISM 310 genetic analyser. The sequence generated by the programme was identified through BLAST search (11).

Results & Discussion

Vaginal isolates from 80 women grown on MRS medium and characterized as Lactobacillus on the basis of Gram positivity and catalase negativity were all observed to give an amplicon of about 200 bp by genus specific PCR (Fig. 1). Employing Group specific PCR it was observed that 80 per cent of the isolates belonged to Group IV, Group II was present in 13.75 per cent, and Group III in 6.25 per cent of women. No isolate belonged to Group 1 (Table II).

These 80 isolates were then analysed to determine the species by species specific primers. The most frequently encountered species were L. reuteri in 26 (32.5%) women, followed by L. fermentum 20 (25%), L. salivarius 13 (16.25%) and L. plantarum in 5 (6.25%) women. These 4 Lactobacillus species interestingly ali belong to Group IV. Other species isolated were L. crispatus and L. rhamnosus each in 4 (5%) women, L. jensenii in 3 (3.75%), L. gasseri and L. acidophilus each 2 (2.5%) and L. paracasei in 1(1.25%) women. None of the isolate from the 80 women was L. casei or L. delbruckii (Table II). Fig. 2 shows the PCR products of 2 isolates each of the 6 species and 1 isolate each of the rest of 4 species isolated from 80 women.

Sequencing of 16S rDNA of a few isolates of each species (total n=20) was done to confirm the species as indicated by species specific PCR. Except for 2 isolates which were classified as L. plantarum but were identified as L. pentosus by sequencing, the sequence of the remaining isolates analysed agreed with the PCR identification (Table III).

To enquire whether isolates of the same species in a number of women were identical or different; their RAPD profiles were compared. It was noted that none of the isolates amongst 80 had similar profile (Fig. 3).

Reports on the species of Lactobacilli resident in healthy vagina of women from many countries are available. Vasquez et al (12) reported presence of L. crispatus in 47.8 per cent, L. gasseri in 30.4 per cent and L.jensenii in 17.4 per cent of 23 Swedish women examined using the same primers used in this study. Vallor et al (13) reported the predominant species as L. jensenii (41%) and L. crispatus (38%) in USA. Burton et al (14) from Canada reported that of the 14 subjects harbouring Lactobacilli, L. iners was present in 8 (57.1%) and L. crispatus in 7 (50%) women, these two species co-existed in 2 subjects. These two species of lactobacilli were relatively rare in their occurrence in India. On the other hand, the more frequent lactobacilli present were L. reuteri and L. fermentum. These along with L. salivarius and L. plantarum were present in 80 per cent of women.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

The species L. plantarum and L. pentosus are genotypically closely related and show highly similar phenotypes. The two share >99 per cent identity value in their 16S rDNA sequence (15). As specilicity of species-specific primers of L. plantarum was not checked towards L. pentosus, or another closely related species L. paraplantarum (8); 16S rDNA sequencing was performed as a confirmatory test.

An observation of interest was the existence of different strains amongst various species of lactobacilli. Strains presenting a common band in species-specific PCR had different RAPD profiles. This was in agreement with the earlier findings (12,14).

In conclusion, our study showed the lactobacilli present in the healthy vagina of Indian women. However, more studies in other parts of the country are indicated to confirm the findings. This information might be beneficial for the development of probiotic tablets seeking to replenish the missing lactobacilli for reproductive health of women.

Acknowledgment

This study was supported by Research Grants from the Department of Biotechnology (DBT), Govt. of India and the Indian Council of Medical Research (ICMR), New Delhi. The first author (K.G.) was a recipient of University Grants Commission (UGC) Fellowship.

Received August 14, 2008

References

(1.) Doderlein, A. Die Scheidensekretuntersuchugen. Zentralbl Gynakol 1894; 18 : 10-4.

(2.) Skarin A, Sylwan J. Vaginal Lactobacilli inhibiting growth of Gardnerella vaginalis, Mobiluncus and other bacterial species cultured from vaginal content of women with bacterial vaginosis. Acta Pathol Microbiol Immunol Scand (B) 1986; 94 : 475-500.

(3.) Klebanoff SJ, Hillier SL, Eschenbach DA, Waltersdorph AM. Control of the microbial flora of the vagina by [H.sub.2][O.sub.2] generating lactobacilli. J Infect Dis 1991; 164 : 94-100.

(4.) Ocana VS, Holgado AAPR, Nader-Macias ME. Characterization of a bacteriocin like substance produced by a vaginal Lactobacillus salivarius strain. Appl Environ Microbiol 1999; 65 : 5631-5.

(5.) MacFaddin, JF. Biochemical tests.for identification of medical bacteria, yd ed. Philadelphia: Lippincott Williams & Wilkins; 2000. p. 451-3.

(6.) Pospiech A, Neumann B. A versatile quick preparation of genomic DNA from gram positive bacteria. Trends Genet 1995; 11 : 217-8.

(7.) Dubernet S, Desmasures N. A PCR based method for identification of Lactobacillus at genus level. FEMS Microbiol Lett 2002; 214 : 271-5.

(8.) Song Yu-Li, Kato N, Liu C -X, Matsumiya Y, Kato H, Watanabe K. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group and species specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol Lett 2000; 187 : 167-73.

(9.) Tynkkynen S, Satokari R, Saarela M, Mattila-Sandholm T, Saxelin M. Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L.casei strains. Appl Environ Microbiol 1999; 65 : 3908-14.

(10.) Edwards U, Rogall T, Blocker H, Embe M, Bottger EC. Isolation and direct complete nucleotide determination of entire genes, characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 1989; 17: 7843-53.

(11.) Available at: www.ncbi.nlm.nih.gov/BLAST/.

(12.) Vasquez A, Jakobsson T, Ahrne S, Forsum U, Molin G. Vaginal Lactobacillus flora of healthy Swedish women. J Clin Microbio1 2002; 40 : 2746-9.

(13.) Vallor AC, Antonio MAD, Hawes SE, Hillier SL. Factors associated with acquisition of, or persistent colonization by vaginal lactobacilli: role of hydrogen peroxide production. J Infect Dis 2001; 184 : 1431-6.

(14.) Burton JP, Cadieux PA, Reid G. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol 2003; 69 : 97-101.

(15.) Collins MD, Rodrigues UM, Ash C, Aguirre M, Farrow JAE, Martinez-Murcia A, et al. Phylogenetic analysis of the genus Lactobacillus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiol Lett 1991; 77 : 5-12.

Reprint requests: Dr G.P. Talwar, Director Research, E-8, Neb Valley, Neb Sarai, Sainik Farms, New Delhi 110 068, India e-mail: gptalwar@gmail.com

Kavita Bansal Garg, Indrani Ganguli *, Ram Das ** & G.P. Talwar

Talwar Research Foundation, New Delhi, * Department of Obstetrics & Gynaecology, Sir Ganga Ram Hospital New Delhi & ** National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Agra, India
Table 1. Species identified by multiplex PCR

Programme Primer (5'-3' sequence) Species Amplicon

PCR II-1 L-aci-1 (TGCAAAGT GGTAGCGTAAGC) L. acidolchilus 210 bp
 23-10C
 CCTTTCCCTCACGGTACTG
 Ljen-3 L. jensenii 700 bp
 AAGAAGGCACTGAGTACGGA
 23-10C
PCR II-2 Lcri-3 L. crispatus 522 bp
 AGGATATGGAGAGCAGGAAT
 Lcri-2
 CAACTATCTCTCTTACACTGCC
 Lgas-3 L. gasseri 360 hp
 AGCGACCGAGAAGAGAGAGA
 Lgas-2
 TGCTATCGCTTCAAGTGCTT
PCR-III LU-5 1.. paracasei 312 bp
 Lpar-4
 GGCCAGCTATGTATTCACTGA
 LU-5 L. rhamnosus 113 hp
 Rhall
 GCGATGCGAATTTCTATTATT
 Lsal-1 L. salivarius 411 bp
 AATCGCTAAACTCATAACCT
 Lsal-2
 CACTCTCTTTGGCTAATCTT
 Lreu-1 L. reureri 303 bp
 CAGACAATCTTTGATTGTTTAG
PCR-IV Lreu-4
 GCTTGTTGGTTTGGGCTCTTC
 Lpla-3 L. plantarum 248 bp
 ATTCATAGTCTAGTTGGAGGT
 Lpla-2
 CCTGAACTGAGAGAATTTGA
 Lfer-3 L. fermentum 192 bp
 ACTAACTTGACTGATCTACGA
 Lfer-4
 TTCACTGCTCAAGTAATCATC

Table II. Lactobacillus species isolated from healthy vagina of
women (n=80)

Group Species Number of isolates
 identified
 (%)

Group IV: L. reuteri 26(32.5%)
64(80%) L. fermentum 20(25%)
 L. salivarius 13(16.25%)
 L. plantarum 5(6.25%)
Group II: L. crispatus 4(5%)
11(13.75%) L. jensenii 3(3.75%)
 L. gasseri 2(2.5%)
 L. acidophilus 2(2.5%)
Group III: L. casei 0(0)
5 (6.25%) L. paracasei 1(1.25%)
 L. rhamnosus 4(5%)
Group I: L. delbruckii 0(0)
0

Table III. Species identification by two different genotypic
approaches

Isolate RAPD Species designation by
no. type Species specific Sequencing of 16S
 PCR rDNA

LB-04 S1 L. salivarius L. salivarius
LB-09 S2 L. salivarius L. salivarius
LB-30 S3 L. salivarius L. salivarius
LB-45 S4 L. salivarius L. salirarius
LB-36 F1 L. fermentum L. fermentum
LB-39 F2 L. fermentum L. fermentum
LB-60 F3 L. fermentum L. fermentum
LB-65 F4 L. fermentum L. fermentum
LB-73 F5 L. fermentum L. fermentum
LB-01 R1 L. reuteri L. reuteri
LB-23 R2 L. reuteri L. reuteri
LB-55 R3 L. reuteri L. reuteri
LB-61 P1 L. plantarum L. plantarum
LN-75 P2 L. plantarum L. pentosus
LB-80 P3 L. plantarum L. penlosus
LB-10 C1 L. crispatus L. crispatus
LB-08 G1 L. gasseri L. gasseri
LB-42 J1 L. jensenii L. jensenii
LB-12 A1 L. acidophilus L. acidophilus
LB-13 Rh1 L. rhamnosus L. rhamnosus
COPYRIGHT 2009 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Garg, Kavita Bansal; Ganguli, Indrani; Das, Ram; Talwar, G.P.
Publication:Indian Journal of Medical Research
Date:Jun 1, 2009
Words:3036
Previous Article:Cellular & molecular basis of HIV-associated neuropathogenesis.
Next Article:Abundance & distribution of muscoid flies in tsunami--hit coastal villages of southern India during post-disaster management period.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |