Printer Friendly

Specific RT-PCR assays for the detection of Trichoderma harzianum (Th azad) in rhizopsperic soil sample of Uttar Pradesh India.

Species of the fungus Trichoderma, a genus of Hyphomycetes, are ubiquitous in the environment, but especially in soil. They have been used in a wide range of commercial applications including the production of enzymes [De la Cruz, J, et al. (1999), Kubicek, CP et al. (1998), Lorito, M et al. (1998)] and in the biological control of plant diseases [Hjeljord, L, et al. (1998), Samuels, GJ (1996)]. Characterization and identification of strains at the species level is the first step in utilizing the full potential of fungi in specific applications [Lieckfeldt, E, et al. (1999)]. Biological assays, carried out in the laboratory, are often an effective and rapid method for identifying strains with biocontrol activity [Grondona I et al. (1992)].To predictably and successfully use biocontrol agents to combat plant disease in the field, it is essential that their biology and ecology be well under- stood [Lo, CT et al. (1996)]. In addition, the release of bio control agents into the environment has created a demand for the development of methods to monitor their presence or absence in soil. Therefore, monitoring population dynamics in soil is of much importance. Previous methods employed to identify strains of Trichoderma spp. in soil samples have included the use of dilution plates on selective media. However, this method does not distinguish between indigenous strains and artificially introduced ones [Kimura, H et al. (1999)]. Staining techniques, based on reporter genes such as the b-glucuronidase gene (GUS), have been used to study host-pathogen interactions in vivo [Green, H, et al. (1995)] and monitoring commercial Trichoderma strains [Freeman, S et al. (2002), Lo, CT et al. (1998)]. This method is not suitable for detecting or monitoring Trichoderma strains under natural conditions since this would involve the release of genetically modified organisms into the environment.

In recent years, several PCR-based molecular techniques have been used to detect and discriminate among microorganisms. Sequence analysis of the internal transcribed spacer region 1 (ITS1) of the ribosomal DNA has been helpful in the neotypification, description, and characterization of species in the genus Trichoderma [Gams, W, et al. (1998), Shahid M et al. (2013a, 2014f), Grondona, I et al. (1997), Hermosa, MR et al. (2000), Lieckfeldt, E, et al. (1999), Muthumeenakshi, S. et al. (1994), Ospina-Giraldo, MD et al. (1999)]. In addition, the analysis of DNA sequences from multiple genetic loci has been used to establish the phylogenetic relationship of the species within Trichoderma [Chaverri, P. et al. (2003), Kullnig-Gradinger, C. et al. (2002)]. Another useful method for the identification of Trichoderma strains is the randomly amplified polymorphic DNA (RAPD) technique [Zimand, G et al. (1984), Shahid M et al. (2013b, 2014g)]. In a previous study, we identified RAPD fragments that were able to discriminate between different biocontrol agents of Trichoderma spp. [Hermosa, MR et al. (2001)]. By converting a RAPD- derived fragment, amplified from strain T. atroviride 11, into a sequence-characterized amplified region (SCAR) we showed that this marker was specific to T atroviride 11. The generation of a SCAR marker for this strain is of particular interest because T. atroviride 11 has been shown to be an efficient biocontrol agent against phy- topathogenic fungi such as Phomabetae, Rhizoctonia so- lani, Sclerotinia sclerotiorum, and Polymyxa betae, the vector of the sugar beet rhizomania disease virus [Campos, T et al. (2001), Grondona, I, et al. (2001), Grondona, I. et al. (1992)].

Although conventional PCR has become an attractive tool for the detection of specific microorganisms in microbial systems, this technique does not allow accurate quantification of DNA because of the variability in the efficiency of amplification between PCR reactions [Raeymaekers, L (1998)]. This limiting factor has been overcome by the emergence of new techniques, capable of quantifying nucleic acids in vitro. Real-time PCR is based on the use of TaqMan probes or SYBR Green I dyes. Both systems measure the intensity of a fluorescent signal proportional to the quantity of DNA generated during the PCR amplifica- tion. Quantitative real-time PCR is widely used in medicine for the diagnosis of clinical viruses [Kimura, H. et al. (1999).], bacteria [Hein, I, et al. (2001), Ke, D, et al. (2000)], protozoa [Lin et al. (2000)], and fungi [Loeffler, J. et al. (2000)]. Although it is used in plant pathology studies [Schena, L. et al. (2002) ], there are few references regarding its application to quantifying fungi from soil [Filion, M. et al. (2002)].

The aim of the present study was to develop specific PCR-based markers to detect T. harzianum Th azad in soil. Also, two primers, QTh azadf and QTh azadr, designed from the 837-bp SCAR marker, were used to quantify fungal DNA of this strain extracted from soil samples using real-time PCR.

METHODS

Fungal Strains, Growth Conditions, and DNA Extraction

The 49 Trichoderma spp. were used in this study are shown in Table 1. Each strain was cultured on Potato Dextrose Agar medium (PDA, Himedia) and stored at -80[degrees]C in 10% glycerol. Petri dishes containing PDA medium were inoculated with a 0.5-cm diameter agar plug, cut from the growing edge of a 4-day colony for each strain, and grown in the dark at 25 C. Spores were harvested after 6 or 7 days, by adding 2 mL of water to the plates and scraping the culture with a rubber spatula. The suspensions were filtered through a double layer of cheese- cloth to separate large mycelia fragments from conidia. Spore concentrations were adjusted to 1 x [10.sup.9] conidia mL). Mycelia, for each strain, were obtained by inoculating flasks containing 100 mL of Potato Dextrose Broth (PDB, Himedia Laboratories) and growing the cultures at 25[degrees]C for 48h on orbital shaker (120 rpm). Mycelia were harvested and washed with sterile distilled water, frozen, and lyophilized. Total DNA was extracted from 50 mg of freeze-dried mycelia [Shahid M. et al. 2014a, Mondejar R L et al (2010), Raeder, U. et al. (1985)].

DNA extracted from 250 mg of soil was obtained using the Fast DNA SPIN (for soil) kit (according to manufacturer's instructions, with a modification in the lysis step. Lysis was carried out using the solution provided in the kit. However, the samples were incubated at 65 C and vortexed every 5 min for 30 min. The DNA extracted from each sample was resuspended in 100 1L of DES buffer accompanying the kit.

Screening Trichoderma Strains for SCAR Markers

SCAR A1 (5 GGAAGCTTGGCGTTTATTGTA CAAAG-3) and SCAR A1c (5-GGAAGCTTGGGTATT GAGCTGGGCCT-3) primers, designed from a previous study involving T. atroviride 11 [Hermosa, MR. et al. (2001)], were used to test the amplification of DNA from 50 strains of Trichoderma spp. Each PCR reaction contained 50 ng of fungal DNA (Table 1), 2.5 U of DNA Taq polymerase, 1 * DNA polymerase buffer , 0.2 mM of each deoxynucleoside triphosphate, 1.5 mM of MgCl2, and 0.32 lM of each primer in a total volume of 50 lL. PCR conditions included an initial denaturation of 5 min at 940[degrees]C, followed by 35 cycles of 1 min at 94[degrees]C, 1 min 30 s at 68[degrees]C, and 2 min at 72[degrees]C, with a final extension step of 72[degrees]C for 7 min, using a DNA PTC-100 thermal cycler. PCR products were analysed by electrophoresis in a 1.2% agarose gel in 1 * TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA [pH 8]), stained with ethidium bromide. The molecular size marker was / X174- HaeIII (Promega, Madison, WI, USA).

Generation of a SCAR Marker for T. harzianum Th azad

A 1.5-kb PCR fragment was excised from an agarose gel and the DNA was purified with the GENE CLEAN kit according to the manufacture's specifications. The fragment was cloned into the pGEM-T Easy vector (Promega) with T4 DNA Ligase [Vieira PM et al (2013), Sambrook, J. et al. (1989)]. Plasmid DNA was extracted using a miniplasmid preparation protocol [Hanahan, D (1985)]. The 1.5-kb fragment was sequenced using fluorescent terminators on an AB RT PCR.

Their identification is important in developing a potential strain for further analysis. These isolate belongs to 8 different species of Trichoderma genus viz. Trichoderma viride (30 strains), Trichoderma harzianum, Trichoderma asperellum, Trichoderma longibrachiatum (7 strains), Trichoderma atroviride (8 strains), Trichoderma koningii, Trichoderma virens and Trichoderma reesei collected from rhizospheric soil of chickpea, pigeonpea and lentil crop. They are finally deposited to culture bank NBAIM, Mau and allotted with a unique NBAIM Accession number.

Real-Time PCR Assays. One primer set, QTh azadf (5-TGGCGTTGAATTGAGTTTGTGT3) and QTh azadr (5-CCCTCCGTA TGGGTTT TAAGGT-3) , was designed using the Primer Express software program version 2.0.0 (Applied Biosystems). These oligonucleotides, designed from the 837-bp SCAR marker, flanked a 72-bp DNA fragment specific for identifying the strain T. harzianum Th azad. The specificity of this primer set was tested against DNA from all 50 Trichoderma spp. strains, using a conventional PCR machine, and on annealing temperature of 59[degrees]C for the reactions.

The QTh azadr and QTh azadf primers were used in real time-PCR experiments with 6-carboxyfluorescein (6-FAM) as the reporter fluorochrome & 6-carboxyte- tramethylrhodamine (TAMRA) as the quencher. The 20- lL master mixture contained 2 lL of undiluted DNA template from different sources, 10 lL of TaqMan Universal PCR Master Mix (Applied Biosystems), a 0.45-lM concentration of each primer, and 0.5 lM of a TaqMan fluorescent DNA probe (Applied Biosystems). Thermal cycler conditions were as follows: 50 C for 2 min and 95 C for 10 min, and 40 cycles of PCR amplification at 95 C for 15 s and 59 C for 30 s.

A standard curve, based on threshold cycles (Ct), was created using plasmid DNA containing the 837-bp SCAR marker, and the QTh azadf/QTh azadr primer pair. Plasmid DNA amounts, quantified by spectrophotometry and serially diluted, were 200 pg, 20 pg, 2 pg, 200 fg, 20 fg, and 2 fg. Sterile water was used as a negative control to replace template DNA in PCR reactions (NTC). Ct values were calculated by the ABI Prism 7000 SDS software program (Applied Biosystems) to indicate significant fluorescence signals rising above background during the early cycles of the exponentially growing phase of the PCR amplification process. The standard curve was obtained by plotting the Ct value, defined by the crossing cycle number, versus the logarithm of the quantity of the different plasmid DNA samples. Two microlitre of undiluted DNA from the A, B, C was included as template in the real-time PCR reactions Two microlitre of genomic DNA was also included as positive control. The amount of template DNA was calculated by interpolating the cycle threshold with the standard curve, determined by the ABI Prism 7000 SDS software program, and by the application of a correction factor. DNA quantities were corrected by dividing by 35, a figure that represented the ratio between the 110-bp target fragment and the total size of the plasmid DNA used to generate the standard curve. All reactions were carried out in triplicate.

RESULTS

SCAR Marker Generation for T. harzianum Th azad

Two PCR products were amplified using SCAR A1 and SCAR A1c primers: one 990-bp fragment corresponding to strain T. atroviride 11 and one 1.5-kb fragment corre- sponding to T harzianum Th azad . The 990-bp fragment was shown to be diagnostic of T atroviride in work previously done using 17 strains of Trichoderma [Hermosa, MR. et al. (2001)]. Two primers, BR1 and BR2, were designed to the 1.5-kb fragment from T. harzianum Th azad and used to amplify DNA extracted from 49 strains of Trichoderma spp..Of these samples, only one 1.5 kb amplicon, specific to a sample containing only T. harzianum Th azad DNA, was amplified using an annealing temperature of 65[degrees]C. No PCR products were detected in any of the other 48 PCR reactions.

Detecting Trichoderma in Inoculated Soils

Sample A, a sterile soil artificially inoculated with a mix of 49 Trichoderma spp. strains at a concentration of 109 spores per 10 g of soil, yielded 1.6 to 5.6 lg of DNA per g (w/w) of soil. No differences in the amount of DNA were observed in soil samples. The amount of DNA extracted from soil sample, a sterile soil inoculated only with T. harzianum Th azad at a concentration of 109 spores per 10 g of soil, was not detected in agarose gel.

BR1 and BR2 primers were used to screen the DNA from the soil samples (Table 1) to discriminate between samples with or without T. harzianum Th azad. The diagnostic 1.5 Kb PCR fragment was amplified in soil samples which included spores of T. harzianum Th azad. No PCR products were amplified in samples, where spores of T. harzianum Th azad were not added (Fig. 1). Identical results were observed when mycelia instead of spores of the Trichoderma spp. strains were used to inoculate the soils. The quantities of DNA extracted from soils inoculated with mycelia were 60% higher than the amount extracted using spores as the inoculant.

Screening and Quantification of Fungal DNA Using Real-Time PCR

The QTh azadf/QTh azadr primer pair was used in real-time PCR. A standard curve was created using 4-fold dilutions series of the plasmid containing the 1.5kb SCAR fragment and both primers. The threshold was set to a value of 0.50 with a baseline ranging from cycle 1 to 36. The standard curve showed a linear correlation between input DNA and cycle threshold (Fig. 2), with a correlation coefficient (r2) of 0.100754. Significant fluorescent signals were observed for reactions containing DNA extracted from sample , inoculated with 109 spores of T. harzianum Th azad per 10 g of soil (Table 1). Genomic DNA of T. harzianum Th azad, included as positive control, was also detected. No significant fluorescent signals, rising above background, were detected for sample, which did not contain T. harzianum Th azad strain. In addition, no fluorescence was observed for sample, a nonsterile and artificially inoculated soil, which included 49 Trichoderma spp. strains distinct from T. harzianum Th azad. Thus, indicating that primers QTh azadf and QTh azadr did not amplify the DNA from other microorganisms or Trichoderma spp. strains present in this soil. The absence of T. harzianum Th azad propagules in sample was confirmed by plating triplicates of 100 mg of soil on Trichoderma specific medium, TSM [Askew, DH. et al. (1993)]. For sample A, fluorescent signals were detected, but this result was not consistent within the three replicates done for each experiment and could not be considered as a real quantification.

Strains identification in situ is an important factor in the monitoring of microorganisms used in the field. In this study, we demonstrated the use of Sequence Characterized Amplified Region (SCAR) markers to detect genomic DNA from Trichoderma strains from soil. Two primers (SCAR A1 (5' -GGAAGCTTGG CGTTTATTGTACAAAG-3') and SCAR A2 (5'-GGAAGCTTGGGTAT TGAGCTGGGCCT-3') were tested against DNA of 49 isolates of Trichoderma spp. and a 1.5 kb fragment from T. harzianum Th azad, using annealing temperature of 68[degrees]C. These fragments showed no significant homology to any sequence deposited in the database.

DISCUSSION

The identification of organisms on the basis of DNA investigation requires the characterization of discrimi- nating DNA targets. In fact, this is especially important in the case of Trichoderma strains widely used in the bio- control of soil-borne plant-pathogens. Although T. harzianum is the species most frequently used in biological control, a search of the sequences from commercial strains revealed that T. asperellum, T. atroviride and T koningii were also common species used [Hermosa, MR. et al. (2000), Samuels, GJ (1996)]. Moreover, because of the difficulty of monitoring the biocontrol activity of a given strain in natural environments, the development of molecular characters is needed. A recent work describes the cotransformation of a T harzianum strain with green fluorescent protein and GUS genes [Bae, YS. et al. (2000)] to study its ability to colonize soil and sclerotia of a plant pathogenic fungus. These genes provide a valuable tool for the detection and monitoring of specific strains of T. harzianum released into the soil. However, the practical use of these transformants is difficult because of the public concern about genetic modified organisms in natural environments.

PCR has provided a reliable method for the identification and detection of microorganisms. Specific primers have been designed from ITS regions or rRNA genes of fungi such as Rosellinia necatrix [Schena, L. et al. (2002)] or Glomus intraradices [Filion, M. et al. (2003) ], and specific primers from the Fusarium solani f. sp. phaseoli translation elongation factor 1 alpha (tefl) gene [Filion, M. et al. (2003)] have permitted the identification of these fungi. Several studies have indicated that some Trichoderma species are closely related [Gams, W, et al. (1998), Kullnig-Gradinger et al. (2002)]. Divergence values of ITS1 and ITS2 regions, ranging from 1.2 to 6.5%, 0 to 5.2% and 1.9 to 14.6%, have been shown for three sections of this genus: Longibrachiatum, Trichoderma, and Pachybasium [Shahid M. et al. 2013c, 2014b, Kuhls, K. et al. (1997)]. Similarly, sequence analysis of ITS1 revealed T. atroviride, T. asperellum, and T. harzianum differ by only 0 to 3% [Hermosa, MR. et al. (2000)]. A DNA sequence data analysis of four genes (ITS regions, tef1 a, calmodulin, and a-actin) from T. harzianum produced 1.5, 20.9, 14.8, and 5.8% of informative-characters, respectively [Shahid M. et al. 2013b, 2014d]. However, taking into account the high taxonomic value of these genes, they are not useful enough for designing strain-specific primers for monitoring Trichoderma isolates.

T. harzianum Th azad is commonly used in basic biocontrol research [De la Cruz, J, et al. (1999)] and produces a variety of cell-wall-degrading enzymes in natural substrata [Benitez, T. et al. (1998)]. Because of its value as a research model, this strain was considered in the present study. In previous work, a strain-specific SCAR marker was developed to distinguish T. atroviride 11 from 42 Trichoderma spp. strains, including biocontrol agents, belonging to 13 species [Shahid M. et al. 2013a, 2014c, Hermosa, MR. et al. (2000)]. In the present study, when the SCAR A1 and SCAR A1c primers were tested under annealing conditions at 65[degrees]C, A 1.5 kb fragments was amplified with the DNA from T. harzianum Th azad. The 1.5-kb band amplified from T. harzianum Th azad DNA with SCAR A1 and SCAR A1c primers and sequence analysis provided no evidence of homology with other GenBank sequences.

The specificity of BR1 and BR2 was tested against the DNA isolated from 49 Trichoderma species, The primer pair, BR1 and BR2, amplified an 1.5 KB product with T. harzianum Th azad DNA. These results suggest that we have identified a suitable molecular marker and that the PCR-specific primers, BR1 and BR2, are useful for detecting T. harzianum Th azad. The amount of DNA recovered from a given soil is highly related to factors such as soil type or the method of extraction. In most cases, the recovered DNA from soil is not proportional to the number of inoculated microbial propagules until values are >106-107 spores per g of soil [Frostegard, A. et al. (1999)]. In real-time PCR experiments primers QTh azadf and QTh azad did permit the quantification of a target fragment, contained within the SCAR marker of T harzianum Th azad, from known amounts of spores artificially inoculated in soil samples. The sensitivity of the technique was shown by detecting quantities <0.057 fg of the 1.5kb target fragment of T. harzianum Th azad, based on the values of the standard curve. In other real-time experiments using the Taq-Man system, 0.77 fg of Mycobacterium avium DNA was detected in fecal samples [Fang et al. (2002)]. Our results showed a higher sensitivity (10 times greater) using a Taq-Man probe. In soil sample containing only T. harzianum Th azad spores, DNA was quantifiable and the results were reproducible. Fluorescent signals were observed around cycle 31. In the case of soil sample, inoculated with a mixture of 109 spores per 10 g of soil of the 49 strains, including T. harzianum Th azad, the results were not consistent or reproducible. This may be explained by the use of a lower annealing temperature, which was determined by the Primer Ex- press program when primers QTh azadf and QTh azadr were designed. In initial experiments, 65[degrees]C was the annealing temperature that allowed the specific amplification of the 1.5 kb SCAR marker of T. harzianum Th azad, using BR1 and BR2, tested using the DNA from 49 strains. The annealing temperature used in real-time PCR with primers Q Th azadr and QTh azadf primers was 59[degrees]C and the total size of the target fragment was 1.5kb. Perhaps under these conditions the primers were nonspecifically binding to sites within the DNA of the various strains included within the mixture and therefore were not able to result in a positive or reproducible fluorescent signal for soil sample, whereas this was not the case for sample containing only T. harzianum Th azad. Primers QTh azadf and QTh azadr were also tested using conventional PCR with the DNA from pure cultures of 49 Trichoderma spp. Only one amplicon was detected with T. harzianum Th azad genomic DNA, from spores, indicating the specificity of Q Th azadf and Q Th azad.

SCAR primers BR1 and BR2 were able to detect T. harzianum Th azad using conventional PCR. However, even though QTh azadf and QTh azadr were able to detect T.harzianum Th azad in both pure culture and artificially inoculated sterile soil, their specificity was not great enough to detect and quantify T.harzianum Th azad among a mixture of strains. These results suggest that the use of real-time PCR to quantify a specific strain within natural soil containing a complex mixture of microbes is not reproducible with these particular primers and conditions. However, this does not mean that this strategy would not be useful to quantify a given species using multicopy genes such as those from the rRNA cluster [Schena, L. et al. (2002)].

ACKNOWLEDGMENTS

The authors are grateful for the financial support granted by the ICAR under the Niche Area of Excellence on Exploration and Exploitation of Trichoderma as a antagonists against soil born pathogen, running in Department of Plant Pathology, C.S. Azad University of Agriculture and Technology, Kanpur.

REFERENCES

(1.) Askew DH, Laing MD., An adapted selective medium for the quantitative isolation of Trichoderma species. Plant Pathol 1993; 42: 686-690

(2.) Bae YS, Knudsen, GR., Cotransformation of Trichoderma harzianum with beta-glucuronidase and green fluorescent protein genes provides a useful tool for monitoring fungal groth and activity in natural soil. Appl Environ Microbiol 2000; 66: 810-815

(3.) Benitez T, Limon MC, Delgado-Jarama J, Rey, M., Glu- canolytic and other enzymes and their genes. In: Harman, GE, Kubicek, CP (Eds.) Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications, Taylor & Fran- cis, London, 1998; 101-127

(4.) Campos T, Rosello J, Hermosa MR, Rubio B, Grondona I, Monte, E (2001) Antagonistic effect of a Trichoderma formulation against Sclerotinia sclerotiorum in lettuce. In: Elad, Y, Freeman, S, Monte, E (Eds.) Biocontrol Agents: Mode of Action and Interaction with Other Means of Control, IOBC/WPRS, Bet Dagan, pp 113-116.

(5.) De la Cruz J, Llobell, A: Purification and properties of a basic endo-beta-1,6-glucanase (BGN16.1) from the antagonistic fungus Trichoderma harzianum. Eur J Biochem, 1999; 265: 145-151.

(6.) Fang Y, Wu W Pepper J, Larsen J, Marras S, Nelson E, Ep-person W, Christopher-Hennings, J: Comparison of real- time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples. J Clin Microbiol, 2002; 40: 287-291

(7.) Filion M, St-Arnaud M, Jabaji-Hare, SH: Direct quantification of fungal DNA from soil substrate using real-time PCR. J Microbiol Methods 1735: 1-10

(8.) Freeman S, Maymon M, Kirshner B, Rav-David D, Elad, Y: Use of GUS transformants of Trichoderma harzianum isolate T39 (TRICHODEX) for studying interactions on leaf surfaces. Biocontrol Sci Technol, 2002; 12: 401-407

(9.) Frostegard A, Courtois S, Ramisse V, Clerc S, Bernillon D, Gall F Jeannin P, Nesme X, Simonet, P: Quantification of bias related to the extraction of DNA directly from soil. Appl Environ Microbiol 1999; 65: 5409-5420.

(10.) Gams W, Meyer, W. What exactly is Trichoderma harzianum? Mycologia, 1998; 90: 904-915

(11.) Green H, Jensen, DF. A tool for monitoring Trichoderma harzianum: II. The use of a GUS transformant for ecological studies in the rhizosphere. Phytopathology, 1995; 85: 1436-1440

(12.) Grondona I, Perez de Algaba A, Monte E, Garcia-Acha, I. Biological control of sugar beet diseases caused by Phoma betae. Greenhouse field tests. In: Hockenhull, J, Jensen, DF, Fokema, NJ (Eds.) New Approaches in Biological Control of Soil-Borne Diseases, IOBC, Copenhagen, Denmark, 1992; pp 39-41

(13.) Grondona I, Hermosa, MR, Tejada, M, Gomis, MD, Mateos, PF, Bridge, PD, Monte, E, Garcia-Acha, I. Physiological and biochemical characterization of Trichoderma harzianum, a bio- logical control agent against soil borne fungal plant pathogens. Appl Environ Microbiol, 1997; 63: 3189-3198

(14.) Grondona, I, Hermosa MR, Vizcaino JA, Garcia Benavides P, Redondo J, Rico C, Monte E, Garcia-Acha, I. Integrated control of rhizomania disease by Trichoderma and cultural management. In: Elad, Y, Freeman, S, Monte, E (Eds.) Biocontrol Agents: Mode of Action and Interaction with Other Means of Control, IOBC/ WPRS, Bet Dagan, Israel, 2001; pp 213-216

(15.) Hanahan, D. Techniques for transformation of Escherichia coli. In: Glover, DM (Ed.) DNA Cloning. A Practical Approach, IRL Press Limited, Oxford, 1985; p 109

(16.) Hermosa MR, Grondona I, Diaz-Minguez JM, Iturriaga EA, Monte, E. Development of a strain-specific SCAR marker for the detection of Trichoderma atroviride 11, a biological control agent against soilborne fungal plant pathogens. Curr Genet, 2001; 38: 343-350

(17.) Hermosa MR, Grondona I, Iturriaga EA, Diaz-Minguez JM, Castro C, Monte E, Garcia- Acha, I. Molecular character- ization of biocontrol isolates of Trichoderma. Appl Environ Microbiol, 2000; 66: 1890-1898.

(18.) Hjeljord L, Tronsmo, A. Trichoderma and Gliocladium in biocontrol: an overview. In: Harman GE, Kubicek, CP (Eds.) Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications, Taylor & Francis, London, 1998; pp 129- 152

(19.) Ke D, Menard C, Picard FJ, Boissinot M, Ouellete M, Roy PH, Bergeron, MG. Development of conventional and real-time PCR assays for the rapid detection of group B Streptococci. Clin Chem, 2000; 46: 324-331

(20.) Kimura H, Morita M, Yabuta Y, Kuzushima K, Kato K, Kojima S, Matsuyama T, Morishima, T. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J Clin Microbiol 1999; 37: 132-136

(21.) Kubicek CP, Penttila, ME. Regulation of production of plant polysaccharide degrading enzymes by Trichoderma. In: Harman, GE, Kubicek, CP (Eds.) Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications, Taylor & Francis, London, 1998; pp 49-72

(22.) Kuhls K, Samuels GJ, Meyer W, Kubicek CP, Borner, T. Revision of Trichoderma sect. Longibrachiatum including related teleomorphs based on analysis of ribosomal DNA internal tran- scribed spacer sequences. Mycologia, 1997; 89: 442-460

(23.) Kullnig-Gradinger C, Szakacs G, Kubicek, CP. Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycol Res, 2002; 106: 757-767

(24.) Lieckfeldt E, Samuels GJ, Nirenberg HI, Petrini, O. A morphological and molecular perspective of Trichoderma viride: is it one or two species? Appl Environ Microbiol, 1999; 65: 2418- 2428

(25.) Lin MH, Chen TC, Kuo TT, Tseng CC, Tseng, CP. Real- time PCR for quantitative detection of Toxoplasma gondii. J Clin Microbiol, 2000; 38: 4121-4125

(26.) Lo CT, Nelson EB, Harman, GE. Biological control of turfgrass diseases with a rhizosphere competent strain of Trichoderma harzianum. Plant Dis, 1996; 80: 736-741

(27.) Lo CT, Nelson EB, Hayes CK, Harman, GE, Ecological studies of transformed Trichoderma harzianum strain 1295-22 in rhizosphere and on the phylloplane of creeping bentgrass. 1998; 88: 129-136

(28.) Loeffler J, Henke N, Hebart H, Schmidt D, Hagmeyer L, Schumacher U, Einsele, H. Quantification of fungal DNA by using fluorescence resonance energy transfer and the Lightcycler system. J Clin Microbiol 2000; 38: 586-590

(29.) Lorito, M. Chitinolytic enzymes and their genes. In: Har- man, GE, Kubicek, CP (Eds.) Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications, Taylor & Francis, London, 1998; pp 73-100

(30.) Muthumeenakshi S, Mills PR, Brown AE, Seaby, DA. Intraspecific molecular variation among Trichoderma harzianum isolates colonizing mushroom compost in the British Isles. Microbiology, 1994; 140: 769-777

(31.) Ospina-Giraldo MD, Royse DJ, Chen X, Romaine, CP Molecular phylogenetic analyses of biological control strains of Trichoderma harzianum and other biotypes of Trichoderma spp. associated with mushroom green mold. Phytopathology, 1999; 89: 308-313.

(32.) Raeder U, Broda, P. Rapid preparation of DNA from fila- mentous fungi. Lett Appl Microbiol, 1985; 1: 17-20

(33.) Raeymaekers, L, Quantitative PCR. In: Lo, YMD (Ed.) Methods in Molecular Medicine: Clinical Applications of PCR, Humana Press, Totowa, NJ, 1998; pp 27-38.

(34.) Sambrook J, Fritsch EF, Maniatis, T, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989; NY

(35.) Samuels, GJ, Trichoderma: a review of biology and systematics of the genus. Mycol Res, 1996; 100: 923-935.

(36.) Schena L, Nigro F, Ippolito, A. Identification and detection of Rosellinia necatrix by conventional and real-time PCR. Eur J Plant Pathol, 2002; 108: 355-366.

(37.) Shahid M, Singh Anuradha, Srivastava Mukesh, Rastogi Smita, Pathak, Neelam. Sequencing of 28S rRNA gene for identification of Trichoderma longibrachitum 28CP/7444 species in Soil sample. International Journal of Bio Technology for Wellness Industries., 2013b; 2: 84-90.

(38.) Shahid M, Srivastava Mukesh, Sharma Antima, Pandey Sonika, Kumar Vipul, Singh, Anuradha. Identification & Molecular Variability Analysis of a Potential Strain of Trichoderma/Hypocrea for Bioformulation Production with an Increased Shelf Life, J Plant Pathol Microb, 2013b; 4: 204.

(39.) Shahid M, Srivastava Mukesh, Sharma Antima, Singh Anuradha, Pandey Sonika, Kumar V, Pathak Neelam, Rastogi, Smita. Molecular characterization of Trichoderma longibrachiatum 21PP isolated from rhizospheric soil based on universal ITS primers Afr. J. Microbiol. Res. 2013c; 7(41):4902-4906.

(40.) Shahid M, Singh Anuradha, Srivastava M, Srivastava, DK. Molecular Characterization of Trichoderma viride Isolated from Rhizospheric Soils of Uttar Pradesh Based on rDNA Markers and Analysis of Their PCRISSR Profiles:-Journal of Molecular Biomarker & Diagnosis, 2014a; 5: 2 1000170.

(41.) Shahid M, Srivastava Mukesh, Kumar Vipul, Singh Anuradha, Pandey, Sonika. Genetic Determination of Potential Trichoderma Species Using ISSR (Microsatellite) Marker in Uttar Pradesh, India. Journal of Microbial & Biochemical Technology., 2014b; 6(3): 174-178.

(42.) Shahid M, Srivastava Mukesh, Kumar Vipul, Singh Anuradha, Sharma Antima, Pandey Sonika, Rastogi S, Srivastava, AK. Phylogenetic Diversity Analysis of Trichoderma species Based on ITS Marker. African Journal of Biotechnology, 2014c; 13(3): 449-455

(43.) Shahid M, Srivastava Mukesh, Sharma Antima, Pandey Sonika, Kumar Vipul, Singh, Anuradha. Production of a novel bioformulation of Trichoderma/Hypocrea using biotechnological approaches, African Journal of Agricultural Research, 2014d; 9 (24): 1895-1905.

(44.) Zimand G, Valinsky L, Elad Y, Chet I, Manulis, S. Use of RAPD procedure for the identification of Trichoderma strains. Mycol Res, 1984; 98: 531-53.

(45.) Zimand G, Valinsky L, Elad Y, Chet I, Manulis, S. Use of RAPD procedure for the identification of Trichoderma strains. Mycol Res, 1984; 98: 531-53.

(46.) Mondejar R L, Anton A, Raidl S, Ros M, Pascual J A. Quantification of the biocontrol agent Trichoderma harzianum with real-time TaqMan PCR and its potential extrapolation to the hyphal biomass. Bioresource Technology, 2010; 101: 2888-2891.

(47.) Vieira PM, Guedes AS, Stecca A, Saulo S, Linhares J, Siqueira D, Silva R D N and Ulhoa C J, Identification of differentially expressed genes from Trichoderma harzianum during growth on cell wall of Fusarium solani as a tool for biotechnological application. BMC Genomics, 20131 14: 177.

Mohammad Shahid, Mukesh Srivastava, Sonika Pandey, Vipul Kumar, Anuradha Singh, Shubha Trivedi and Y.K. Srivastava

Biocontrol Laboratory, Department of Plant Pathology, CSA University of Agriculture & Technology, Kanpur--208002, India.

(Received: 09 September 2015; accepted: 01 November 2015)

* To whom all correspondence should be addressed. E-mail: sonica.dey@gmail.com

Caption: Fig 1. Showing expression of T. harzianum Th azad DNA

Caption: Fig. 2. Standard curve with the correlation coefficient ([r.sup.2]) ob- tained by plotting the cycle threshold (Ct) against the input DNA plasmid quantity (logarithm scale) after real-time PCR
Table 1. Trichoderma isolates used in this study

S.    Strain    Source         ITCC No.   Fungus
No.   code                                Identified

1     6 CP      Sultanpur      7442/09    T.atroviride

2     24CP      Sitapur        7443/09    T.atroviride

3     71 L      Hardoi         7445/09    T.atroviride

4     115 L     Bahraich       7446/09    T.atroviride

5     52 L      Unnao          7447/09    T.atroviride

6     105 CP    Etawah         7451/09    T.atroviride

7     75 PP     Auriya         7448/09    T.atroviride

8     126 PP    Kanpur Dehat   7449/09    T.atroviride

9     21 PP     Kaushambi      7437/09    T. longibrachiatum

10    31PP      Allahabad      7438/09    T. longibrachiatum

11    81PP      Mirzapur       7439/09    T. longibrachiatum

12    100 PP    Sonbhadra      7440/09    T. longibrachiatum

13    120 PP    Bhadoi         7441/09    T. longibrachiatum

14    28 CP     Barabanki      7444/09    T. longibrachiatum

15    5 CP      Kanpur Nagar   7450/09    T. longibrachiatum

16    8 CP      Kanpur Nagar   8305/11    T. viride

17    11 CP     Allahabad      8306/11    T. viride

18    17 CP     Kaushambi      8307/11    T. viride

19    33 CP     Sitapur        8308/11    T. viride

20    34 CP     Hardoi         8309/11    T. viride

21    35 CP     Fatehpur       8310/11    T. viride

22    66 CP     Auriya         8311/11    T. viride

23    89 CP     Unnao          8312/11    T. viride

24    102 CP    Etawah         8313/11    T. viride

25    119 CP    Kanpur Dehat   8314/11    T. viride

26    01 PP     Hardoi         8315/11    T. viride

27    09 PP     Kanpur Nagar   8316/11    T. viride

28    14 PP     Barabanki      8317/11    T. viride

29    17 PP     Fatehpur       8318/11    T. viride

30    29 PP     Unnao          8319/11    T. viride

31    42 PP     Bahraich       8320/11    T. viride

32    67 PP     Auriya         8321/11    T. viride

33    74 PP     Sitapur        8322/11    T. viride

34    78 PP     Etawah         8323/11    T. viride

35    124 PP    Kanpur Dehat   8324/11    T. viride

36    13 L      Kanpur Nagar   8325/11    T. viride

37    104 L     Etawah         8331/11    T. viride

38    35 L      Sitapur        8326/11    T. viride

39    68 L      Hardoi         8327/11    T. viride

40    74 L      Auriya         8328/11    T. viride

41    89 L      Gonda          8329/11    T. viride

42    100 L     Faizabad       8330/11    T. viride

43    109 L     Allahabad      8332/11    T. viride

44    117 L     Sultanpur      8333/11    T. viride

45    119 L     Kanpur Dehat   8334/11    T. viride

46    Th azad   CSA Univ.      6796/12    T.harzianum
                Farm

47    T.spe     CSA Univ.      8940/12    T.asperellum
      /(CSAU)   Farm

48    T. kon    CSA Univ.      5201/13    T.koningii
      /(CSAU)   Farm

49    T. vire   CSA Univ.      4177/13    T. virens
      /(CSAU)   Farm

S.    Crop         GPS Location
No.

1     Chickpea     Latitude: 26.2500 [degrees]N
                   Longitude: 79.0000 [degrees]E

2     Chickpea     Latitude: 27.5700 [degrees]N
                   Longitude: 80.6800 [degrees]E

3     Lentil       Latitude: 26U 292 28.3232 2
                   Longitude: 80U 182 26.3612 2

4     Lentil       Latitude: 27.7500 [degrees]N
                   Longitude: 81.7500 [degrees]E

5     Lentil       Latitude: 26.5500 [degrees]N
                   Longitude: 80.4800 [degrees]E

6     Chickpea     Latitude: 26.7700 [degrees]N
                   Longitude: 79.0300 [degrees]E

7     Pigeon pea   Latitude: 26.4700 [degrees]N
                   Longitude: 79.5200 [degrees]E

8     Pigeon pea   Latitude: 26.2277
                   Longitude: 79.8370

9     Pigeon pea   Latitude: 26U 342 27.612 2
                   Longitude: 79U 182 24.6232 2

10    Pigeon pea   Latitude: 25.4358
                   Longitude: 81.8463

11    Pigeon pea   Latitude: 25.1500 [degrees]N
                   Longitude: 82.6000 [degrees]E

12    Pigeon pea   Latitude: 24.6897 [degrees]N
                   Longitude: 83.0653 [degrees]E

13    Pigeon pea   Latitude: 25.3932
                   Longitude: 82.5657

14    Chickpea     Latitude: 26.9200 [degrees]N
                   Longitude: 81.2000 [degrees]E

15    Chickpea     Latitude: 25U 82 34.8212 2
                   Longitude: 81U 592 2.9792 2

16    Chickpea     Latitude: 26.4600 [degrees]N
                   Longitude: 80.3300 [degrees]E

17    Chickpea     Latitude: 25.4358
                   Longitude: 81.8463

18    Chickpea     Latitude: 26U 342 27.612 2
                   Longitude: 79U 182 24.6232 2

19    Chickpea     Latitude: 27.5700 [degrees]N
                   Longitude: 80.6800 [degrees]E

20    Chickpea     Latitude: 26U 292 28.3232 2
                   Longitude: 80U 182 26.3612 2

21    Chickpea     Latitude: 25.9300 [degrees]N
                   Longitude: 80.8000 [degrees]E

22    Chickpea     Latitude: 26.4700 [degrees]N
                   Longitude: 79.5200 [degrees]E

23    Chickpea     Latitude: 26.5500 [degrees]N
                   Longitude: 80.4800 [degrees]E

24    Chickpea     Latitude: 26.7700 [degrees]N
                   Longitude: 79.0300 [degrees]E

25    Chickpea     Latitude: 26.2277
                   Longitude: 79.8370

26    Pigeonpea    Latitude: 26U 292 28.3232 2
                   Longitude: 80U 182 26.3612 2

27    Pigeonpea    Latitude: 25U 82 34.8212 2
                   Longitude: 81U 592 2.9792 2

28    Pigeonpea    Latitude: 26.9200 [degrees]N
                   Longitude: 81.2000 [degrees]E

29    Pigeonpea    Latitude: 25.9300 [degrees]N
                   Longitude: 80.8000 [degrees]E

30    Pigeonpea    Latitude: 26.5500 [degrees]N
                   Longitude: 80.4800 [degrees]E

31    Pigeonpea    Latitude: 27.7500 [degrees]N
                   Longitude: 81.7500 [degrees]E

32    Pigeonpea    Latitude: 26.4700 [degrees]N
                   Longitude: 79.5200 [degrees]E

33    Pigeonpea    Latitude: 27.5700 [degrees]N
                   Longitude: 80.6800 [degrees]E

34    Pigeonpea    Latitude: 26.7700 [degrees]N
                   Longitude: 79.0300 [degrees]E

35    Pigeonpea    Latitude: 26.2277
                   Longitude: 79.8370

36    Lentil       Latitude: 26.4600 [degrees]N
                   Longitude: 80.3300 [degrees]E

37    Lentil       Latitude: 26.7700 [degrees]N
                   Longitude: 79.0300 [degrees]E

38    Lentil       Latitude: 27.5700 [degrees]N
                   Longitude: 80.6800 [degrees]E

39    Lentil       Latitude: 26U 292 28.3232 2
                   Longitude: 80U 182 26.3612 2

40    Lentil       Latitude: 26.4700 [degrees]N
                   Longitude: 79.5200 [degrees]E

41    Lentil       Latitude: 27.2500 [degrees]N
                   Longitude: 82.0000 [degrees]E

42    Lentil       Latitude: 26.7800 [degrees]N
                   Longitude: 82.1300 [degrees]E

43    Lentil       Latitude: 25.4358
                   Longitude: 81.8463

44    Lentil       Latitude: 26.2500 [degrees]N
                   Longitude: 79.0000 [degrees]E

45    Lentil       Latitude: 26.2277
                   Longitude: 79.8370

46    Chickpea     Latitude: 26.4912 [degrees]N
                   Longitude: 80.3070 [degrees]E

47    Pigeonpea    Latitude: 26.4912 [degrees]N
                   Longitude: 80.3070 [degrees]E

48    Pigeonpea    Latitude: 26.4912 [degrees]N
                   Longitude: 80.3070 [degrees]E

49    Pigeonpea    Latitude: 26.4912 [degrees]N
                   Longitude: 80.3070 [degrees]E
COPYRIGHT 2016 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Shahid, Mohammad; Srivastava, Mukesh; Pandey, Sonika; Kumar, Vipul; Singh, Anuradha; Trivedi, Shubha
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Geographic Code:9INDI
Date:Mar 1, 2016
Words:6367
Previous Article:Characterization of a bioactive compound from Tinospora cardifolia having activity against wide range of bacteria and fungi.
Next Article:Towards sustainable intensification of maize (Zea mays L.) + legume intercropping systems; experiences; challenges and opportunities in India; a...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters