Printer Friendly

ShrimpMap: a low-density, microsatellite-based linkage map of the Pacific whiteleg shrimp, Litopenaeus vannamei: identification of sex-linked markers in linkage group 4.

ABSTRACT A preliminary low-density linkage map (ShrimpMap) based solely on simple sequence repeats (SSRs) or microsatellite genetic markers was constructed for specific pathogen-free (SPF) shrimp, Litopenaeus vannamei, from the United States Marine Shrimp Farming Program (USMSFP). Marker loci originated mostly from genomic libraries cloned using DNA from ovaries of adult shrimp or cDNA libraries cloned using RNA of juveniles challenged with either Taura syndrome virus (TSV) or white spot syndrome virus (WSSV). Out of approximately 150 polymorphic markers initially tested with a small test panel consisting of 16 individuals, 100 (83 genomic SSRs and 17 EST-SSRs) were useful for genotyping with the entire mapping panel, a three-generation pedigree comprising two grandparents, two parents and 89 progeny. High frequency of null alleles (approx. 25% of markers) was observed in shrimp microsatellites. Chi-square goodness-of-fit tests revealed that 30 of the 100 markers showed segregation distortion, 17 of which were highly significant distorted (P < 0.001). Linkage analysis using CRIMAP with a LOD score of 3.0 provided a map with coverage for 14 linkage groups consisting of 67 linked markers spaced every ~22 cM with an observed genome length of 689.1 cM and an estimated genome length for L. vannamei of 2675.7 cM. Variable results were obtained using a LOD score of 5.0. Sex-linked microsatellites were identified in linkage group 4 (LG4) of ShrimpMap, a linkage group that also includes 28 s rRNA, nonLTR retrotransposon reverse transcriptase and other markers with no homology to any sequence in the GenBank database. The map includes the first EST-SSR markers mapped for L. vannamei. Human ESTs also amplified in shrimp DNA and two of them were useful for linkage analysis. Work is underway to place additional EST-SSR markers on to ShrimpMap to serve as a framework map for penaeid species to facilitate integration of linkage and physical maps, study conservation and evolutionary genomics in penaeids, and search for candidate genes associated with fitness traits in wild and cultured shrimp. Moreover, the mapped EST-SSRs provide valuable comparative genomic links not only between L. vannamei and other penaeid species but also between shrimp and other invertebrate and vertebrate genomes.

KEY WORDS: linkage map, Litopenaeus vannamei, ShrimpMap, simple sequence repeats, SSRs, microsatellites, EST-SSRs, sex-linked markers, transposable elements, non-LTR retrotransposons, reverse transcriptase, 28s rRNA

INTRODUCTION

The Pacific whiteleg shrimp, Litopenaeus vannamei, is the most important penaeid shrimp species farmed worldwide. Viral diseases cause serious economic losses and threaten the sustainability of the shrimp aquaculture industry and conservation of biodiversity of wild shrimp. To date however, little is known about the molecular genetic and cellular mechanisms involved in the response of the shrimp immune system to viral attacks, the organization of the shrimp genome in general. In the United States, a selective breeding program based only on specific pathogen-free (SPF) shrimp was initiated to begin domestication of Litopenaeus vannamei free of Infectious hypodermal and hematopoeitic necrosis virus (IHHNV) (Lotz et al. 1995, Alcivar-Warren et al. 1997, Carr et al. 1997, Moss & Arce 2003). When Taura Syndrome Virus (TSV) emerged later as a major problem for the industry (Lightner et al. 1997), the same stocks were used to selectively breed for TSV resistance and other economically important traits such as high growth and survival under near zero water exchange and low salinity conditions (reviewed in Argue & Alcivar-Warren 1999, Moss et al. 1999, Argue et al. 2002, Moss & Arce 2003). To better understand these traits and increase the rate of genetic improvement in shrimp breeding programs for these and other traits of economic importance such as resistance to emerging diseases, improvement of carcass quality, and reproductive and nutritional performance, the loci responsible for these traits need to be first identified. The most direct approach to identify these loci is by fine-mapping quantitative trait loci (QTL) and identification of positional candidate genes. To do this, a highly saturated linkage map for L. vannamei is needed and will require a large number of polymorphic codominant markers such as simple sequence repeats (SSRs) or microsatellites (Alcivar-Warren 2001, Alcivar-Warren et al. 2002, 2006).

Microsatellites are the markers of choice for population genetic and gene mapping of agricultural species because of their abundance, high levels of polymorphism, Mendelian inheritance, and codominant expression. In shrimp, microsatellite genetic markers have been developed from sequences of genomic libraries of P. monodon (Tassanakajon et al. 1998, Xu et al. 1999, Pongsomboon et al. 2000, Wuthisuthimethavee et al. 2003a), P. japonicus (Moore et al. 1999, Sugaya et al. 2002), P. stylirostris (Vonau et al. 1999), P. setiferus (Ball et al. 1998), Fenneropenaeus chinensis (Wang et al. 2005), Litopenaeus schmitti (Maggioni et al. 2003) and L. vannamei (Garcia et al. 1996, Bagshaw & Bucholt 1997, Cruz et al. 2002, Meehan et al. 2003, Alcivar-Warren et al. 2006, Jia et al. 2007, Freitas et al. 2007, Garcia & Alcivar-Warren 2007), but very few of these microsatellites have been placed on to a linkage map (Moore et al. 1999, Alcivar-Warren et al. 2006, Wuthisuthimethavee et al. 2003b, Zhang et al. 2007) or shown to be transferable across penaeid species. These shrimp microsatellites have mostly been used in population genetic studies (Garcia et al. 1994, Brooker et al. 2000, Xu et al. 2001, Ball & Chapman, 2003, Maggioni et al. 2003, Valles-Jimenez et al. 2004), genetic relationships (Xu et al. 2003a), pedigree tracking and genetic diversity in breeding programs (Wolfus et al. 1997, Moore et al. 1999, Vonau et al. 1999, Cruz et al. 2004, Zhang & Xiang 2005), and they appear to be species-specific (Moore et al. 1999). So far, most of the microsatellites used for linkage mapping of L. vannamei (Zhang et al. 2007) were developed in our laboratory (Meehan et al. 2003).

There are many challenges to develop a genetic linkage map for shrimp including the relatively large size of the shrimp genome, which is approximately 70% the size of the human genome (Chow et al. 1990), the presence of large number of rearranged and repetitive sequences (Alcivar-Warren et al. 2006 & references therein) some of which show homology to motifs of nonLTR retrotransposons and other transposable elements (Xu & Alcivar-Warren 2007), and the difficulty in differentiating the large number of small sized chromosomes (CamposRamos 1997, Xiang et al. 1993). Information on genome organization and detailed linkage and physical maps for L. vannamei are lacking. The first physical mapping work in shrimp using fluorescent in situ hybridization (FISH) reported localization of pentanucleotide repeats [TAACC.sub.n] to the telomeres of shrimp chromosomes, suggesting that this repeat motif is likely the telomere sequence for L. vannamei (Alcivar-Warren et al. 2006). [TAACC.sub.n] repeats are also the site of introgression of telomere-specific retrotransposons (reviewed in Alcivar-Warren et al. 2006), suggesting active genetic rearrangements and plasticity of the shrimp genome.

Genetic mapping of penaeid species has been slow and concentrated mostly on a few important farmed species such as Penaeus monodon (Wilson et al. 2002, Maneeruttanarungroj et al. 2006), M. japonicus (Moore et al. 1999, Li et al. 2003), and L. vannamei (Perez et al. 2004, Zhang et al. 2007) using primarily dominant amplified fragment length polymorphism (AFLP) markers and a few codominant microsatellite markers. A preliminary genetic linkage map based only on genomic microsatellites was reported for P. monodon (Wuthisuthimethavee et al. 2003a, Wuthisuthimethavee et al. 2003b). Efforts to develop a high-density linkage map for L. vannamei based only on microsatellite genetic markers have been slow because of difficulty in obtaining a large number of highly polymorphic markers for mapping, lack of sequence conservation in repetitive genome regions, high frequency of null alleles, high mutation rates, lack of sequencing data from BAC libraries, and high cost associated with the development of not only genomic microsatellites but also expressed sequence tags (ESTs) suitable for developing Type I codominant markers such as multiallelic EST-SSRs (Alcivar-Warren et al. 2007, Dhar et al. 2007). We have developed approximately 150 microsatellites from genomic (Garcia et al. 1996, Meehan et al. 2003, Alcivar-Warren et al. 2006, Garcia & Alcivar-Warren 2007) and cDNA (Dhar et al. 2000, Fan et al. 2001, Alcivar-Warren et al. 2007, Dhar et al. 2007, Delaney et al. 2007, Keating et al. 2007) libraries that could be used to construct a framework genetic map for L. vannamei (ShrimpMap). The specific objective of this study was to use these genomic and expressed microsatellites to construct a preliminary linkage map for SPF L. vannamei.

MATERIALS AND METHODS

Production of the Mapping Family

We produced reference and resource mapping families to serve as the focus of our efforts in the shrimp genome mapping project. A three-generation family (herein called the International Reference Mapping Family, or IRMF) was provided by Dr. William Carr from the USMSFP breeding program maintained at the Oceanic Institute (OI) in Oahu, HI. Parental brood stocks were selected taking into consideration the geographic origin of the shrimp and potential for increasing polymorphism information content of markers to be developed (Table 1). A three-generation mapping family was produced at the Oceanic Institute in Oahu, HI and reared at OI's facility in Kona, HI. The Dato (P12) and Sire (R68) originated from Batch #5 (TSVR Line) of the USMSFP's breeding program. The Dam's mother originated from the Kona line (Population 1, originally from Sinaloa, Mexico) and the Dam's father originated from a Hybrid line [hybrids of Population 1 and Population 2 (originally from Esmeraldas, Ecuador and maintained in captivity for various years)]. The Sire's mother and father were from a newly introduced candidate SPF population from Oaxaca, Mexico.

DNA Isolation

DNA was isolated from the two parents, two maternal grandparents and approximately 200 progeny following a standard phenol-chloroform method (Garcia et al. 1994). Eighty-nine offspring (40 males and 49 females) were used for genotyping and linkage analysis.

Simple Sequence Repeats (SSRs) or Microsatellites Used in This Study

Both Type II (SSRs or microsatellites) and Type I (SSRs from expressed sequence tags, or EST-SSRs) polymorphic markers were used for genotyping. Polymorphic Type II markers include microsatellite M1 isolated from a RAPD marker (B20) (Garcia et al. 1996), an anonymous marker (TUDWPvD20) cloned using a PCR fragment amplified with primers designed for the D-loop of shrimp mitochondrial DNA but amplified instead a nuclear DNA sequence with no homology to any sequence in the GenBank database (Alcivar-Warren & Dhar, unpublished), and various polymorphic microsatellites isolated from two genomic libraries constructed using DNA from ovaries of adult SPF L. vannamei (Population 1, from Sinaloa, Mexico; Kona Line) from OI's breeding program (Meehan et al. 2003, Alcivar-Warren et al. 2006, Garcia & Alcivar-Warren 2007). Polymorphic Type I markers were developed using sequences from Tufts' EST database (ShrimpESTbase) obtained mostly by mRNA differential display (mRNADD) or cDNA library cloning techniques. Bioinformatics tools were used for identification of SSRs on EST sequences isolated mostly from cDNA libraries cloned using RNA from (a) SPF juveniles of the TSV-resistant line challenged per os with TSV94ushi genotype (Dhar et al. 2000, Fan et al. 2001), and (b) SPF juveniles of the TSV-resistant line injected intramuscularly with a white spot syndrome virus (WSSV) isolate from China (Alcivar-Warren et al. 2007). The polymorphic EST-SSR markers genotyped with the entire IRMF panel include: (a) 5 ESTs isolated by mRNADD using RNA of juveniles from the highest- and lowest-surviving families after a per os TSV challenge (Dhar et al. 2000, Fan et al. 2001), (b) 2 cDNAs containing AT-rich elements in shrimp (TUDLvShIL1.21, TUDLvShIL1.28) that were RT-PCR amplified using RNA of TSV-challenged juveniles (Dhar et al. 2007), (c) 3 cDNAs originated from a subtracted cDNA library of SPF L. vannamei injected intramuscularly with WSSV, (d) 5 ESTs from a cDNA library (TSV2A) of per os TSV-challenged SPF L. vannamei juveniles, and (e) 2 human cDNAs associated with cadmium accumulation (U26403 and D28118).

Primer Synthesis, Microsatellite Amplification and Scoring, Polymorphism Analysis

Fluorescent and nonfluorescent oligonucleotide primers were synthesized by Integrated DNA Technology Inc. (IDT, Coraville, IA) and used for allele amplification and used to amplify alleles with DNA from a small test panel consisting of 16 SPF L. vannamei representing offspring and parents of the reference and resource mapping families being used to construct ShrimpMap. Allele amplification was performed at annealing temperatures ranging from 48[degrees]C to 62[degrees]C using either a radioactive [sup.32]p-based protocol or a fluorescent-based protocol using either an ABI genotyper (Perkin Elmer Inc.) or a CEQ8000 (Beckman Coulter Inc.) For the [sup.32]p-based protocol, polymerase chain reaction (PCR) was performed in a 25 [micro]L reaction volume containing 100 ng DNA, 7.5 ng of [gamma]-[sup.32]p-ATP labeled reverse primer, 50 ng (5 [micro]M) of forward primer, 2.0 mM of Mg[Cl.sub.2], 0.2 mM of dNTPs, 2.5 units of Taq polymerase (Promega, WI) and x1 buffer. The thermal cycler (PTC-100, MJ Research, MA) profile was: 94[degrees]C for 3 min, 94[degrees]C for 1 min, annealing temperature for 1 min, and 72[degrees]C for 2 min and ran for 21 cycles (Meehan et al. 2003). Amplified products were electrophoresed in polyacrylamide gels and visualized by autoradiography. Samples were run next to a known (B20) sequence (Garcia et al. 1996) to estimate approximate allele sizes.

For the fluorescent-based protocols, we first used a modification of the user's manual of ABI PRISM 377 DNA sequencer. PCR mixture consisted of 0.3 [micro]M (20 ng) template DNA, 0.333 [micro]M reverse primer (fluorescently labeled with 6-FAM, TET or HEX), 0.333 [micro]M forward primer, 0.125 mM dNTPs, 0.04 U/[micro]L Taq polymerase (Promega), 2.5 mM MgC12 and x1 buffer in a total of volume of 15 [micro]L. The PCR profile using a MJ Research thermocycler PTC-100[TM] was: 95[degrees]C for 12 min. followed by 30 cycles of 94[degrees]C for 1 min., annealing temperature for 1 min., 72[degrees]C for 2 min. and ending with 72[degrees]C for 30 min. The amplified products were then multiplexed by combining in a total volume of HEX-, TET- and 6-FAM-labeled PCR products in different ratios for best amplification results. Three micro liters of loading mix (ABI Prism 377 DNA Sequencing Manual) and 1 [micro]L of the multiplexed PCR product were combined and used in loading the gel. After the ABI run was completed, GeneScan Analysis Software processed the gel image. This was also manually checked to make sure all lanes used in the gel line up properly and the size standard being used is applied appropriately. Once the gel image was processed, the information is exported into GenoTyper Software that assigns allele sizes (base pairs, bp) to the amplified product in each lane based on the size standard being used. To avoid inaccuracy in scoring among different gels, a control DNA sample provided by ABI of known genotype was included in each set of samples for each gel. The protocol used with the CEQ8000 genotyper follows manufacturer instructions (Beckman Coulter Inc.) All genotypic results were compiled in an excel sheet and checked manually for different types of genotyping errors. The allele sizes of amplified products were reviewed by two different researchers. Polymorphism status was determined as previously reported (Meehan et al. 2003).

Linkage Mapping and Estimation of Genome Length and Map Coverage

Once polymorphism was detected using the small test panel, markers were then used for genotyping with the entire IRMF panel following standard laboratory protocols. The allele data obtained from the IRMF panel was first entered in an excel file and then analyzed with CRI-MAP version 2.4.using an initial threshold LOD score of 3.0 to identify linkage groups (LG) and determine marker order. A LOD score of 5.0 was later used to address issues associated with ordering of markers. Deviation from expected segregation ratios were tested by chi-square analysis (P < 0.05). Map recombinational distances were calculated in Kosambi's mapping function in centimorgans (cM) (Kosambi 1944) using CRIMAP. Both genome length estimation and map coverage were calculated based on framework markers using a maximum likelihood method for estimating genome length using genetic linkage data (Chakravarti et al. 1991). Observed genotype frequencies were tested against the Mendelian expectations in the IRMF family based on the goodness-of-fit test ([chi square], chi-square analysis).

RESULTS AND DISCUSSION

Microsatellite Polymorphism

A total of 173 primer sets were initially designed and used for optimization of allele amplification conditions using the small test panel. Approximately 150 polymorphic markers were developed and subsequently used for genotyping with the entire IRMF panel. After review of allele data, some markers were discarded because of significant amounts of stuttering bands or lack of reproducible results after analysis using the ABI protocol, providing a total of 100 genetic markers for linkage analysis (83 genomic SSRs and 17 EST-SSRs) in addition to phenotypic sex. The forward and reverse sequences for the microsatellite primer sets are listed on Table 2.

Microsatellite Allele Segregation

Observed genotype frequencies were compared with the Mendelian expectation in this family based on the chi-square goodness-of-fit test. The allele segregation pattern for each marker and the observed segregation patterns are presented in Table 3. Thirteen markers deviated significantly (P < 0.05) from expected 1:1:1:1 and 1:1 segregation ratios and 17 of them were highly (P < 0.001) distorted markers. Nine of the distorted markers (TUMXLv9.28, 5.38, 9.43, 6.3, 9.93, L29.2, 10.208, 10.255, and 10.323) located on to LG4 using LOD score of 3.0 (Fig. 1A), two located on LG6 (8.296, 9.121), and two on LG10 (9.63 and 10.147). This high level of segregation distortion may be because of various reasons, including variation in the mapping family used to construct the map, limited amplification in offspring of mapping population, null alleles caused by mutations in primer sequences, meiotic recombination and chromatin imprinting, genetic rearrangements, genetic duplication, and similar. A summary of the segregation patterns is presented in Table 4. Zhang et al. (2007) also reported that 10% of their segregating markers were distorted in their L. vannamei mapping family, and indicated that markers segregating in 3:1 ratio also showed poor linkage with those segregating in 1:1 ratio. Although some researchers prefer to delete markers with high segregation distortion before linkage analysis is performed (Zhang et al. 2007), we kept these markers for the linkage analysis because some of the same markers (such as 10.208 and 10.220, with similarity to 28s rRNA) were recently mapped to LG29 of the female map of SPF L. vannamei from China, a linkage group that also harbors the sex locus for shrimp (Zhang et al. (2007).

Linkage Analysis

Out of the 100 markers genotyped with the entire IRMF panel, 67 were placed on to 14 linkage groups of ShrimpMap and 34 remained unlinked using CRIMAP with LOD score of 3.0 (Fig. 1A, 1B). Twenty-two of the markers mapped on to LG4 could not be ordered with CRIMAP and were ordered manually (Fig. 1A). Figure 1B shows the ordered markers in the map. Data was also analyzed using LOD values ranging from 3.0-10.0 and variable results in the number of linkage groups and number of markers per linkage groups were observed. When CRIMAP was used with a LOD score of 5.0 (Fig. 2A and 2B) the number of linkage groups was the same but the markers within the linkage groups changed. For instance, the number of markers in LG4 decreased from 29-7. Only 48 markers were placed in 14 linkage groups and 53 were unlinked when CRIMAP with LOD score of 5.0 was used. Considering that most of the linkage groups are very small and a large number of markers remained unlinked, there is a need to develop additional codominant markers to fill these gaps and construct a more accurate framework map for SPF L. vannamei.

A summary of the preliminary linkage map for SPF L. vannamei using CRIMAP with LOD scores of 3.0 and 5.0 is shown on Table 5. On average, there were 3.1 markers per linkage group (2 minimum, 11 maximum) spaced approximately every 22 cM. The maximum length of linkage groups was 367.2 and 419.5 cM using LOD scores of 3.0 and 5.0, respectively, and the observed genome length was 689.1 and 663.0 cM using LOD scores of 3.0 and 5.0, respectively (Table 4). These results should be taken with caution because they could be influenced by the inclusion of all 101 markers in CRIMAP analysis, 17% of which were highly distorted markers that deviated (P < 0.001) from the expected segregation ratios.

Using microsatellite markers only, the estimated genome length of SPF L. vannamei from the USMSFP was 2675.7 and 4025.5 cM using LOD scores of 3.0 and 5.0, respectively. These values are within the range of those reported for various penaeid species using different markers and linkage analysis software (Wilson et al. 2002, Perez et al. 2004, Zhang et al. 2007, Li et al. 2003, Maneeruttanarungroj et al. 2006). For instance, the genome size of Mersapenaeus japonicus was reported at 2,300 cM (Moore et al. 1999), the size of nonSPF L. vannamei was 2,771 cM for the female and 2,116 cM for the male map, with more conservative estimates of 4,445 cM and 3,583 cM, respectively (Perez et al. 2004). Zhang et al. (2007) estimated the genome length of SPF L. vannamei at approximate 5444.6 cM for the female and 4626.2 cM for the male. It is possible that the inflated genome sizes are because of the dominant markers and/or the linkage software and variable LOD values used for linkage analysis.

The results presented here indicate that microsatellites from genomic libraries could be useful for genetic and genomic studies of shrimp (reviewed in Meehan et al. 2003) bur research is needed to understand why such a large number of markers showed segregation distortion. Moreover, the genome coverage obtained with these markers so far is low with only 14 linkage groups identified so far. Because the number of meiotic chromosomes in SPF L. vannamei was confirmed at n = 44 (Alcivar-Warren et al. 2006), the number of linkage groups in ShrimpMap should be approximately the same number. A range of 47-51 linkage groups has been reported in other sex-specific maps of L. vannamei (Perez et al. 2004, Zhang et al. 2006). Availability of additional markers should help place the 37 unlinked markers on to ShrimpMap. It is unclear why the majority of markers developed so far located on to LG4, a linkage group associated with sex locus (see later) and also includes 28s rRNA, nonLTR retrotransposon reverse transcriptase and other markers with no homology to any sequence in the GenBank database. Our map includes the first EST-SSR markers mapped for L. vannamei. Human ESTs also amplified in shrimp DNA and two of them were useful for mapping.

Most of the published linkage maps of shrimp have used either dominant AFLP markers alone (Wilson et al. 2002, Li et al. 2003, Perez et al. 2004) or a combination of mostly AFLP markers and a few genomic SSRs (Moore et al. 1999, Wilson et al. 2002; Zhang et al. 2007), or AFLP plus a few genomic SSRs and expressed microsatellites obtained from expressed sequence tags (EST-SSRs) (Maneeruttanarungroj et al. 2006), or only codominant genomic SSRs and EST-SSRs (this study), using various linkage software programs and variable LOD scores. Considering the variability observed with our CRIMAP analysis, due perhaps to variability in segregation of alleles within the mapping family, segregation distortion in a large number of markers, the composition/structure of the IRMF family itself, a large number of codominant markers (such as EST-SSRs and single nucleotide polymorphism [SNP]), as well as other mapping families, will be used to increase the density and accuracy of ShrimpMap and other published linkage maps for shrimp. A review of the family and microsatellites used in this preliminary map of L. vannamei as well as accuracy of data from some of the AFLP-based linkage maps is warranted. We are already testing these 100 markers in 4 resource mapping families constructed to identify genes associated with resistance to TSV. The information should be useful to help clarify the expected genome size of penaeid shrimp species. It is recommended that future codominant markers be developed from end-sequencing of bacterial artificial chromosome (BAC) library clones to facilitate linkage, physical, and comparative mapping of shrimp.

Some of the linked markers reported here were also placed on to various linkage groups of the L. vannamei map published by Zhang et al. (2007) and should facilitate efforts to merge these linkage maps. No detailed information was presented by Zhang et al. (2006) about the actual origin of the SPF L. vannamei family used to construct their linkage map, and it is difficult to determine how closely related their animals are to the stocks of the USMSFP's breeding program (Moss & Arce 2003) to assess the percentage of microsatellite markers that will transfer easily to new crosses or lines. Allele segregation data from other families will also be valuable for providing a more accurate rate of microsatellite mutation rates in shrimp. Zhang et al. (2007) reported that out of 100 microsatellite loci they tested (from Meehan et al. [2003] and Ball et al. [1998]), only 30 were found informative in their SPF mapping family, and 29 of these were from our laboratory (Meehan et al. 2003). This suggests that a very large number of markers need to be developed to develop a highly saturated map. Only 19 new genomic microsatellites have been developed for L. vannamei (Jia et al. 2007, Freitas et al. 2007) because we published the first genomic microsatellites for SPF L. vannamei (Garcia et al. 1996, Meehan et al. 2003, Alcivar-Warren et al. 2006). However, considering the high number of sequences homologous to reverse transcriptase-like and other transposable elements, caution should be taken about using genomic libraries for marker development with this IRMF family.

[FIGURE 1 OMITTED]

Mapping EST-SSRs From SPF L. vannamei

We report here the first EST-SSR markers placed on to a linkage map of L. vannamei. Using conservative estimates for linkage at LOD score of 5.0, the following EST-SSR markers were mapped onto ShrimpMap: (a) EF-hand motif of Myosin light chain, isolated from a cDNA library of shrimp challenged with WSSV, was mapped on to LG7, (b) ShIL1.21, which contain an AT-rich element associated with stress in vertebrates and was isolated by direct RT-PCR and sequencing from TSV-challenged shrimp, located on to LG 14, (c) H26.1, which was cloned by mRNADD from a high-surviving family after challenge with TSV and showed no homology to other sequences in Genbank database, was mapped on to LG14, (d) L16. la, which was cloned from an individual of a low-surviving family after challenge with TSV, located on to LG5, and (e) L29.2, also from an individual of a low-surviving family after challenge with TSV, was mapped to LG4 of ShrimpMap.

Mapping Human EST-SSRs in ShrimpMap

As part of our efforts to develop shrimp markers associated with environmental pollutants such as Cd, we have used sequences of Cd-related genes from other species for marker development. Eleven (23%) out of 48 primer sets designed from genes known to be affected by Cd in other species (human, fish, mouse, and other arthropods) amplified in shrimp DNA with the small test panel (Delaney et al. 2006, and unpublished data). Seven markers were polymorphic, 4 were monomorphic and the remaining primers either did not amplify at all or amplified many bands suggesting that amplification conditions need to be further optimized. Five of the seven polymorphic markers were tested with the entire IRMF panel and 2 of these (D28118 U26403) were used for CRIMAP analysis (Table 2) and remain unlinked.

This is the first report of amplification of human genes in shrimp DNA for mapping purposes. Marker D28118 corresponds to DB1 gene that has a putative transcriptional repressor regulating G2/M transition and functions as a zinc finger protein that binds to the interleukin-3 promoter (it contains 6 C2/H2-type zinc finger motifs). Marker U26403 is the receptor tyrosine kinase ligand LERK-7 precursor (EPLG7) that functions as a ligand for tyrosine kinases hek, elk, and eck. Although these human EST-SSRs remained unlinked, they will be placed on the map once additional markers are developed. Thirty-six ESTs have also been included in the new version of the linkage map for P. monodon (Maneeruttanarungroj et al. 2006). Mapped EST-SSRs will provide valuable functional comparative genomic links not only between L. vannamei and other penaeid species but also between shrimp and other invertebrate and vertebrate genomes.

Segregation of EST-SSRs

In this study, most of the EST-SSR alleles segregated in the pedigree and mapping panel as expected from the parental alleles and followed Mendelian inheritance, demonstrating that EST-SSRs will be an efficient approach to increase density in ShrimpMap. High frequency of null alleles (approx. 22% of markers) was observed in expressed shrimp microsatellites but data should be taken with caution because of the limited number of expressed microsatellites developed so far. Only one of the EST-SSRs (L29.2) located on to the current map showed null alleles. Some of the offspring genotyped with L29.2 (a marker located at the end of LG4 where sex locus is located) may be homozygous for null alleles. Though we could not amplify the parental alleles of some of the human ESTs, we were able to amplify them in approximate 50% of the offspring. Work is underway to optimize PCR amplification conditions for these markers using different primer sets to place them on ShrimpMap. The mapped EST-SSRs increase the value of ShrimpMap by providing anchor loci for integration of linkage and physical maps, and provide functional information of potential candidate genes associated with resistance or susceptibility to viral diseases, or tolerance to heavy metal bioaccumulation.

Considering the difficulties in transferring genomic microsatellite data across families, lines and populations, we developed EST-SSR markers using the EST sequences obtained from cDNA libraries cloned with RNA isolated from the same SPF shrimp that our mapping panel originated from. Preliminary work indicated that the efficiency to develop polymorphic markers from cDNA libraries is slightly higher (26%) than the 18% observed from sequences of genomic libraries (Alcivar-Warren et al. unpublished) but more markers need to be tested before making final conclusions. Results showed that primers flanking single or multiple SSRs from vertebrate and invertebrate genes are an efficient approach to quickly develop markers useful for linkage mapping. Future work will attempt to place the published polymorphic EST-SSR markers of L. vannamei that have not been mapped (Perez et al. 2005) as well as those developed from other penaeid species. Our efforts will focus on development of additional EST-SSRs from our unique resource of approximately 6,000 sequences isolated from cDNA libraries of TSV-, WSSV- and cadmium-challenged shrimp that are currently in Tufts' EST database (ShrimpESTbase). Research is urgently needed to increase density of ShrimpMap using not only multiallelic EST-SSR but also biallelic SNP markers (Glenn et al. 2005) that would directly sample variation in the transcribed regions of the shrimp genome and enhance their utility in comparative and evolutionary genomics, as well as for conservation and exploitation of shrimp genetic resources. Access to a BAC library will greatly facilitate development of a sequence-tagged high-density genetic map for L. vannamei, integration of physical and linkage maps, and begin enumerating shrimp chromosomes using FISH and other molecular/ cytogenetic technologies.

[FIGURE 2 OMITTED]

Sex-linked Microsatellite Markers--28s rRNA and Reverse Transcriptase-like Motifs

The sex of the IRMF progeny was treated as a marker and analyzed using CRIMAP with LOD scores of 3.0 and 5.0. Sex was mapped on to LG4 of ShrimpMap, regardless of the LOD score used to perform the linkage analysis, but the order of markers varied somewhat (Fig. 1B & 2B). Sex was tightly linked to marker TUMXLv3.1. Sex was also tightly mapped to seven markers (3 microsatellites and 4 AFLPs) on LG29 of the L. vannamei female map of Zhang et al. (2007). These researchers indicated that none of the 200 microsatellite markers available for L. vannamei had been mapped. However, we reported information indicating that microsatellites TUMXLv10.208 and TUMXLv10.220, homologs of 28s rRNA gene, located on to the same linkage group where Sex locus was located on

ShrimpMap. In this study, we also mapped four other microsatellite markers (TUMXLv3.1, TUMXLv9.43, TUMXLv6.3, TUMXLv5.38) close to Sex on LG4 (Figs. 1B and 2B). Marker TUMXLv3.1 was also placed next to Sex in L. vannamei female map of Zhang et al. (2007). Thus, our markers TUMXLv3.1, TUMXLv10.208, and TUMXLv10.220 are the same three microsatellites reported as tightly linked to Sex on LG29 of the L. vannamei female map reported by Zhang et al. (2006). We have used the IRMF panel of ShrimpMap to locate additional markers associated with sex determination and determination in shrimp (Valentine 2006, unpublished).

Because the 28s rRNA gene is known to be the site of introgression of nonLTR retrotransposons in arthropods (reviewed in Alcivar-Warren et al. 2006), and some 28s rRNA-related sequences have been mapped close to Sex locus (Zhang et al. 2007, this study), it is tempting to postulate that the Sex locus is either homologous to or located near to transposable elements of shrimp. Some preliminary evidence for this hypothesis originate from bioinformatics analysis of genomic microsatellite sequences (Warren et al. unpublished) and by mapping L. vannamei nonLTR retrotransposons such as reverse transcriptase on to ShrimpMap using CRIMAP with LOD score of 3.0 (e.g., TUMXLv8.296, Figure 1A). However, we need access to a good BAC library to fine map and sequence the loci responsible for sex and nonLTR retrotransposons of L. vannamei and begin to understand the organization of the shrimp genome.

The distribution of microsatellites across the linkage groups suggests a possible excess of repetitive sequences on LG4 harboring the Sex locus. No sex chromosome has been observed in penaeids (Campos-Ramos 1997, Xiang et al. 1993) and no environmental factors are known to influence sex determination (Benzie 1998 & references therein). Sexual dimorphism for size has been reported in SPF L. vannamei from the USMSFP breeding program but little is known about the genes involved in sex differentiation and determination (reviewed in Valentine 2006). Production of a monosex population would be advantageous for shrimp breeders to provide some protection of valuable germplasm (Argue & Alcivar-Warren 1999, Argue et al. 2002). Research is needed to identify the genes involved in sex differentiation and determination in L. vannamei to facilitate production of all-female shrimp and increase basic knowledge on evolution of sex-determining genes.

Null Alleles and Mutation Rate of Microsatellites Mapped Onto ShrimpMap

Results showed a high frequency of null alleles of genomic microsatellites, with 25% of the microsatellites from the genomic libraries containing null alleles. Close analysis of data using the sex-linked marker TUMXLv3.1 showed many offspring with homozygous null alleles. Similar results were observed with M1 and other markers mapped on to LG4. This high frequency of null alleles could potentially limit their use for linkage mapping because of a low number of informative meiosis. It is unclear if these null alleles are a result of high mutation rate reported in L. vannamei (Xu et al. 2004) or caused by the intensity of selection and subsequent inbreeding observed in some breeding programs (Donato et al. 2005). Table 2 shows the parental origin of microsatellite mutations of linked markers only. Research is urgently needed to use the current pedigree of the USMSFP lines to understand the molecular mechanisms involved in the creation of new mutations and evolution of shrimp microsatellites.

In summary, we report here a preliminary low-density, microsatellite-based linkage map (ShrimpMap) for SPF L. vannamei of the USMSFP breeding program and adds to two other genetic maps reported for nonSPF (Perez et al. 2004) and putative SPF (Zhang et al. 2006) L. vannamei using mostly dominant AFLP markers that are known to be mostly family-specific. Out of 101 polymorphic microsatellites developed, 67 and 48 were grouped in 14 linkage groups using CRIMAP with a LOD score of 3.0 and 5.0, respectively. Work is underway to increase the density of multiallelic (microsatellites, EST-SSRs) and biallelic (SNPs) markers in ShrimpMap to develop a highly saturated framework map that could be used not only across pedigrees and penaeid species bur also facilitate the integration of physical and linkage maps. The ultimate goal of ShrimpMap is to prevent diseases, search for genes and mutations associated with fitness traits in wild and cultured shrimp, and increase the rate of genetic improvement in breeding programs through marker-assisted selection. Considering that shrimp is the most favored seafood of Americans, more genomic resources should be immediately directed at the construction of BAC maps and 2-fold sequence coverage, develop comprehensive full-length cDNA libraries to allow functional annotation, and complete integration of genetic linkage and physical maps for the L. vannamei genome, similar to the resources requested for other agricultural species (Green et al. 2007).

ACKNOWLEDGMENTS

The authors thank Maura Faggart, Julie Gonsalves, and Kelly Johnson for assistance with DNA extraction; Dr. Will Carr, Jim Sweeney, Fernanda Calderon, Steve Arce and all the technical staff at the Oceanic Institute in Honolulu, Hawaii for provision of SPF shrimp. The authors are also grateful to Mr. William B. Warren for assistance with bioinformatics analysis of the shrimp EST database (ShrimpESTbase) to identify SSRs and Dr. Paramananda Das for providing useful comments to an earlier draft of the manuscript. This work was supported in part by a grant #98-388-1424 from the United States Department of Agriculture to the US Marine Shrimp Farming Program Consortium (A-W), the Department of Environmental and Population Health at Cummings School of Veterinary Medicine at Tufts University (A-W), the Rockefeller Brothers Fund Inc NY (A-W) and NOAA National Sea Grant College Program Office, Department of Commerce, under grants No. NA90-AA-D-SG480, Woods Hole Oceanographic Institution Sea Grant Project No. R/A-28-PD-New Initiatives Program (A-W).

LITERATURE CITED

Alcivar-Warren, A., R. Overstreet, A. K. Dhar, K. Astrofsky, W. Carr, J. Sweeney & J. Lotz. 1997. Genetic susceptibility of cultured shrimp (Penaeus vannamei) to Infectious Hypodermal and Hematopoeitic Necrosis Virus and Baculovirus penaei: Possible relationship with growth status and metabolic gene expression. J. Invert. Path. 70:190-197.

Alcivar-Warren, A. 2001. ShrimpMap: a genetic approach to understand immune response and disease resistance in shrimp. In: C. L. Browdy & D. E. Jory, editors. The new wave. Proceedings of the Special Session on Sustainable Shrimp Culture, Aquaculture 2001, Baton Rouge, LA: The World Aquaculture Society. pp. 174-189.

Alcivar-Warren, A., Z. Xu, D. Meehan, Y. Fan & L. Song. 2002. Shrimp genomics: development of a genetic map to identify QTLs responsible for economically important traits in Litopenaeus vannamei. In: N. Shimizu, T. Aoki, I. Hirono & F. Takashima, editors. Aquatic genomics: steps toward a great future. Tokyo, Japan: Springer-Verlag. pp. 61-72.

Alcivar-Warren, A., D. Meehan-Meola, Y. Wang, X. Guo, L. Zhou, J. Xiang, S. Moss, S. Arce, W. Warren, Z. Xu & K. Bell. 2006a. Isolation and mapping of telomeric pentanucleotide [(TAACC).sub.n] repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescent in situ hybridization. Mar. Biotechnol. (NY) 8:467-480.

Alcivar-Warren, A., L. Song, D. Meehan, B. Poulus, D. Lightner, J. Xiang & Z. Xu. 2007. Mapping simple sequence repeat markers identified in ESTs from a subtracted cDNA library of White Spot Virus-challenged shrimp Litopenaeus vannamei. J. Shellfish Res. 26:1247-1258.

Alcivar-Warren, A., D. Meehan-Meola & Z. Xu. 2006b. ShrimpTest12--a panel of genetic markers for genetic analysis of cultured and wild shrimp. Book of abstracts, aquaculture America 2006, Las Vegas, February 13-17, 2006. Abstr. 400.

Argue, B. J. & A. Alcivar-Warren. 1999. Genetics and breeding applied to the penaeid shrimp farming industry. In: R. A. Bullis & G. D. Pruder, editors. Controlled and biosecure production systems. Proceedings of a special session on evolution and integration of shrimp and chicken models at the World Aquaculture Society Meeting, April 27-30, Sydney, Australia. pp. 29-54.

Argue, B. J., S. M. Arce, J. M. Lotz & S. M. Moss. 2002. Selective breeding of Pacific white shrimp Litopenaeus vannamei for growth and resistance to Taura Syndrome Virus. Aquaculture 204:447-460.

Bagshaw, J. & M. Bucholt. 1997. A novel satellite/microsatellite combination in the genome of the marine shrimp, Penaeus vannamei. Gene 184:211-214.

Ball, A. O. & R. W. Chapman. 2003. Population genetic analysis of white shrimp, Litopenaeus setiferus, using microsatellite genetic markers. Mol. Ecol. 12:2319-2330.

Ball, A. O., S. Leonard & R. W. Chapman. 1998. Characterization of (GT)n microsatellites from native white shrimp (Penaeus setiferus). Mol. Ecol. 7:1251-1253.

Benzie, J. A. H. 1998. Penaeid genetics and biotechnology. Aquaculture 164:23-47.

Brooker, A. L., J. A. H. Benzie & D. Blair. 2000. Population structure of the giant tiger prawn Penaeus monodon in Australian waters determined using microsatellite markers. Mar. Biol. 136: 149-157.

Carr, W. H., K. T. Fjalestad, D. Godin, J. Swingle, J. N. Sweeney & T. Gjedrem. 1997. Genetic variation in weight and survival in a population of specific pathogen-free shrimp, Penaeus vannamei. In: T. W. Flegel & I. H. MacRae, editors. Diseases in Asian aquaculture III, Fish health section. Asian Fisheries Society, Manila. pp. 265-271.

Campos-Ramos, R. 1997. Chromosome studies on the marine shrimps Penaeus vannamei and Penaeus californiensis (Decapoda). J. Crustac. Biol. 17:666-673.

Chakravarti, A., L. K. Lasher & J. E. Reefer. 1991. A maximum likelihood method for estimating genome length using linkage data. Genetics 128:175-182.

Chow, S., W. J. Dougherty & P. Sandifer. 1990. Meiotic chromosome complements and nuclear DNA contents of four species of shrimps of the genus Penaeus. J. Crustacean Biol. 10:20-36.

Cruz, P., A. M. Ibarra, H. Mejia-Ruiz, P. M. Gaffney & R. Perez-Enriquez. 2004. Genetic variability assessed by microsatellites in a breeding program of Pacific white shrimp (Litopenaeus vannamei). Mar. Biotechnol. (NY) 6:157-164.

Cruz, P., C. H. Mejia-Ruiz, R. Perez-Enriquez & A. M. Ibarra. 2002. Isolation and characterization of microsatellites in Pacific white shrimp Penaeus (Litopenaeus) vannamei. Mol. Ecol. Notes 2:239-241.

Delaney, M., D. Meehan-Meola & A. Alcivar-Warren. 2007. Comparative genomics: using human genes for linkage mapping in shrimp. Book of abstracts. World Aquaculture Society meeting, San Antonio, Texas USA, February 26 to March 2. Abstr.

Dhar, A., Y. Fan, E. Murayama-Kayano, T. Rayano, R. Meisner, W. Carr, V. Breland & J. Lotz. 2000. Isolation of expressed sequence tags (ESTs) from Taura Syndrome Virus (TSV)-challenged shrimp (Litopenaeus vannamei) by mRNA differential display. Book of Abstracts, Plant & Animal Genome VIII, The International Conference on the Status of Plant and Animal Genome Research. January 7-12, 2000. Town and Country Hotel, San Diego, CA., P601. pp. 202.

Dhar, A. K., D. Meehan-Meola, V. Breland, J. M. Lotz, W. H. Carr & A. Alcivar-Warren. 2007. Linkage mapping of developmentally expressed cDNAs containing AT-rich elements in shrimp [Litopenaeus vannamei]: differential expression after challenge with taura syndrome virus. J. Shellfish Res. 26:1217-1224.

Donato, M. D., R. Manrique, R. Ramirez, L. Mayer & C. Howell. 2005. Mass selection and inbreeding effects on a cultivated strain of Penaeus (Litopenaeus) vannamei in Venezuela. Aquaculture 247:159-167.

Fan, Y., L. Song & A. Alcivar-Warren. 2001. New expressed sequence tags isolated from Taura Syndrome Virus (TSV)-challenged shrimp Litopneaeus vannamei using mRNA differential display. Book of Abstracts, Aquaculture 2001, January 21-25, Disney's Coronado Springs Resort, Lake Buena Vista, Florida. pp. 12.

Freitas, P. D., C. M. Jesus & P. M. Galetti, Jr. 2007. Isolation and characterization of new microsatellite loci in the Pacific white shrimp Litopenaeus vannamei and cross-species amplification in other penaeid species. Mol. Ecol. Notes 7:324-320.

Garcia, D. K., M. A. Faggart, L. Rhoades, J. A. Wyban, W. H. Carr, J. N. Sweeney, K. M. Ebert & A. Alcivar-Warren. 1994. Genetic diversity of cultured Penaeus vannamei shrimp using three molecular genetic techniques. Mol. Mar. Biol. Biotechnol. 3:270-280.

Garcia, D. K., A. K. Dhar & A. Alcivar-Warren. 1996. Molecular analysis of a RAPD marker (B20) reveals two microsatellites and differential mRNA expression. Mol. Mar. Biol. Biotechnol. 5: 71-83.

Garcia, D. K. & A. Alcivar-Warren. 2007. Characterization of 35 new microsatellite genetic markers for the Pacific whiteleg shrimp, Litopenaeus vannamei: their usefulness for studying genetic diversity of wild and cultured stocks, tracing pedigree in breeding programs and linkage mapping. J. Shellfish Res. 26:1203-1216.

Glenn, K. L., L. Grapes, T. Suwanasopee, D. L. Harris, Y. Li, K. Wilson & M. F. Rothschild. 2005. SNP analysis of AMY2 and CTSL genes in Litopenaeus vannamei and Penaeus monodon shrimp. Anim. Genet. 36:235-236.

Green, R. D., M. A. Qureshi, J. A. Long, P. J. Burfening & D. L. Hamernik. 2007. Identifying the future needs for long-term USDA efforts in agricultural animal genomics. Int. J. Biol. Sci. 3: 114-120.

Jia, Z. Y., X. W. Sun, L. Q. Liang, D. Y. Li & Q. Q. Lei. 2007. Isolation and characterization of microsatellite markers from Pacific white shrimp (Litopenaeus vannamei). Mol. Ecol. Notes 6:1282-1284.

Keating, J., M. Delaney, D. Meehan-Meola, W. Warren, A. Alcivar & A. Alcivar-Warren. 2007. Histological findings, cadmium bioaccumulation, and isolation of expressed sequence tags (ESTs) in cadmium-exposed, specific pathogen-free shrimp, Litopenaeus vannamei postlarvae. J. Shellfish Res. 26:1225-1237.

Kosambi, D. D. 1944. The estimation of map distances from recombination values. Ann. Eugen. 12:172-175.

Li, Y. T., K. Byrne, E. Miggiano, V. Whan, S. Moore, S. Keys, P. Crocos, N. Preston & S. Lehnert. 2003. Genetic mapping of the kuruma prawn Penaeus japonicus using AFLP markers. Aquaculture 219:143-156.

Li, Y., L. Dierens, K. Byrne, E. Miggiano, S. Lehnert, N. Preston & R. Lyons. 2003. QTL detection of production traits for the Kuruma prawn Penaeus japonicus (Bate) using AFLP markers. Aquaculture 25:198-210.

Lightner, D. V., R. M. Redman, B. T. Poulus, L. M. Nuna, J. L. Mari & K. W. Hasson. 1997. Risk of spread of penaeid shrimp viruses in the Americas by the international movement of live and frozen shrimp. Rev. Sci. Tech. Off. Int. Epiz. 16:146-160.

Lotz, J. M., C. L. Browdy, W. H. Carr, P. P. Frelier & D. V. Lightner. 1995. USMSFP suggested procedures and guidelines for assuring the specific pathogen status of shrimp broodstock and seed. In: C. L. Browdy, J. S. Hopkins, editors. Swimming Through Troubled Waters. Proceedings of the special session on shrimp farming, World Aquaculture Society, Baton Rouge, LA, USA pp. 60-75.

Maggioni, R., A. D. Rogers & N. Maclean. 2003. Population structure of Litopenaeus schmitti (Decapoda: Penaeidae) from the Brazilian coast identified using six polymorphic microsatellite loci. Mol. Ecol. 12:3213-3217.

Maneeruttanarungroj, C., S. Pongsomboon, S. Wuthisuthimethavee, S. Klinbunga, K. J. Wilson, J. Swan, Y. Li, V. Whan, K. H. Chu, C. P. Li, J. Tong, K. Glenn, M. Rothschild, D. Jerry & A. Tassanakajon. 2006. Development of polymorphic expressed sequence tagderived microsatellites for the extension of the genetic linkage map of the black tiger shrimp (Penaeus monodon). Anim. Genet. 37: 363-368.

Meehan, D., X. Xu, G. Zuniga & A. Alcivar-Warren. 2003. High frequency and large number of polymorphic microsatellites in cultured shrimp Penaeus (Litopenaeus) vannamei. [Crustacea:Decapoda]. Mar. Biotechnol. (NY) 5:311-330.

Moore, S. S., V. A. Whan, G. P. Davis, K. Byrne, D. J. S. Hetzel & N. Preston. 1999. The development and application of genetic markers for the kuruma prawn Penaeus japonicus. Aquaculture 173: 19-32. Moss, S. M. & S. M. Arce. 2003. SPF Defined--Pathogen free status of shrimp limited. Global Aquacult. Advoc. December:86-87.

Moss, S. M., B. J. Argue & S. M. Arce. 1999. Genetic improvement of the Pacific white shrimp Litopenaeus vannamei, at the Oceanic Institute. Global Aquacult. Advoc. 2:41-43.

Perez, F., C. Erazo, M. Zhinaula, F. Volckaert & J. Calderon. 2004. A sex-specific linkage map of the white shrimp Penaeus (Litopenaeus) vannamei base don AFLP markers. Aquaculture 242:105-118.

Perez, F., J. Ortiz, M. Zhinaula, C. Gonzabay, J. Calderon & F. A. Volckaert. 2005. Development of EST-SSR markers by data mining in three species of shrimp: Litopenaeus vannamei, Litopenaeus stylirostris, and Trachypenaeus birdy. Mar. Biotechnol. (NY) 7:554-569.

Pongsomboon, S., V. Whan, S. S. Moore & A. Tassanakajon. 2000. Characterization of tri- and tetranucleotide microsatellites in the black tiger prawn, Penaeus monodon. Science Asia 26:1-8.

Sugaya, T., M. Ikeda, H. Mori & N. Taniguchi. 2002. Inheritance mode of microsatellite DNA markers and their use for kinship estimation in kuruma prawn Penaeus japonicus. Fish. Sci. 68:299-305.

Supungul, P., P. Sootanan, S. Klinbunga, W. Kamonrat, P. Jarayabhand & A. Tassanakajon. 2000. Microsatellite polymorphism and the population structure of the black tiger shrimp (Penaeus monodon) in Thailand. Mar. Biotechnol. 2:339-347.

Tassanakajon, A., A. Tiptawonnukul, P. Supungul, V. Rhimphanitchayakit, D. Cook, P. Jarayabhand, S. Klinbunga & V. Boonsaeng. 1998. Isolation and characterization of microsatellite markers in the black tiger prawn Penaeus monodon. Mol. Mar. Biol. Biotechnol. 7:55-0l.

Valentine, H. 2006. Searching for sex determining genes of shrimp. Report to the National Institute of Health (NIH) Short Training Grant Program. Cummings School of Veterinary Medicine at Tufts University.

Valles-Jimenez, R., P. Cruz & R. Perez-Enriquez. 2004. Population genetic structure of Pacific white shrimp (Litopenaeus vannamei) from Mexico to Panama: microsatellite DNA variation. Mar. Biotechnol. 6:475-484. (NY).

Vonau, V., M. Ohresser, N. Bierne, C. Delsert, I. Beuzart, E. Bedier & F. Bonhomme. 1999. Three polymorphic microsatellites in the shrimp Penaeus stylirostris. Anim. Genet. 30:234-235.

Wang, H., F. Li & J. Xiang. 2005. Polymorphic EST-SSR markers and their mode of inheritance in Fenneropenaeus chinensis. Aquaculture 249:107-114.

Wilson, K., Y. Li, V. Whan, S. Lehnert, K. Byrne, S. Moore, S. Pongsomboon, A. Tassanakajon, G. Rosenberg, E. Ballment, Z. Fayazi, J. Swan, M. Kenway & J. Benzie. 2002. Genetic mapping of the black tiger shrimp Penaeus monodon with amplified fragment length polymorphism. Aquaculture 204:297-309.

Wolfus, G. M., D. K. Garcia & A. Alcivar-Warren. 1997. Application of the microsatellite technique for analyzing genetic diversity in shrimp breeding programs. Aquaculture 152:35-47.

Wuthisuthimethavee, S., P. Lumubol, A. Vanavichit & S. Tragoonrung. 2003a. Development of microsatellite markers in black tiger shrimp (Penaeus monodon Fabricius). Aquaculture 224:39-50.

Wuthisuthimethavee, S., P. Lumubol, A. Vanavichit & S. Tragoonrung. 2003b. Linkage map construction in the black tiger shrimp (Penaeus monodon Fabricius) by SSLP markers. Book of abstracts. Plant and Animal Genome (PAG XI) conference, Town and Country Hotel, San Diego, Jan. 11-15. Abstr. P. 645:235.

Xiang, J. H., R. Y. Liu & L. H. Zhou. 1993. Chromosomes of marine shrimps with special reference to different techniques. Aquaculture 111:321.

Xu, Z. & A. Alcivar-Warren. 2007. Reverse transcriptase-like sequences and other transposable elements in the genomes of black tiger shrimp (Penaeus monodon) and Pacific whiteleg shrimp (Litopenaeus vannamei)--potential utility for linkage mapping, population genetics and traceability studies. J. Shellfish Res. (This issue).

Xu, Z., A. K. Dhar, J. Wyrzykoswki & A. Alcivar-Warren. 1999. Identification of abundant and informative microsatellite from shrimp (Penaeus monodon) genome. Anim. Genet. 30:1-7.

Xu, Z., J. H. Primavera, L. D. de la Pena, P. Pettit, J. Belak & A. Alcivar-Warren. 2001. Genetic diversity of wild and cultured Black Tiger Shrimp (Penaeus monodon) in the Philippines using microsatellites. Aquaculture 199:13-40.

Xu, Z., J. Wyrzykowski, A. Alcivar-Warren, B. J. Argue, J. M. Moss, S. M. Arce, M. Traub, F. R. O. Calderon, J. Lotz & V. Breland. 2003a. Genetic analyses for TSV-susceptible and TSV-resistant shrimp (Litopenaeus vannamei) using MI microsatellite. J. World Aqua Soc. 34:332-343.

Xu, Z., D. Meehan & A. Alcivar-Warren. 2003b. High mutation rates at microsatellite loci in shrimp, Penaeus (Litopenaeus) vannamei. Book of abstracts. Plant and Animal Genome (PAG XI) conference, Town and Country Hotel, San Diego, Jan 11-15. Abstr. P642235 pp.

Xu, Z., J. Alcivar & A. Alcivar-Warren. 2004. Transposable elements identified in the genome of black tiger shrimp (Penaeus monodon). Book of abstracts. World Aquaculture Society meeting, Honolulu, Hawaii, March 1-5, 2004. Abstr 657 pp.

Zhang, L.-S. & J. Xiang. 2005. A preliminary study on the inheritance of microsatellite in two selective breeding families of shrimp (Litopenaeus vannamei). Hereditas (Beijing) (in Chinese, abstract and tables in English) 27:919-924.

Zhang, L., C. Yang, T. Zhang, L. Li, X. Zhang, Q. Zhang & J. Xiang. 2007. A genetic linkage map of Pacific white shrimp (Litopenaeus vannamei): sex-linked microsatellite markers and high recombination rates. Genetica 131:37-49.

ACACIA ALCIVAR-WARREN, (1,2) * DAWN MEEHAN-MEOLA, (1) SE WON PARK, (1) ZHENKANG XU, (1) ([dagger]) MARTHA DELANEY (1) AND GLADYS ZUNIGA (1)

(1) Environmental and Comparative Genomics Section; (2) International Marine Shrimp Environmental Genomics Initiative (IMSEGI), Department of Environmental and Population Health, Cummings School of Veterinary Medicine at Tufts University, 200 Westboro Road, North Grafton, Massachusetts 01536

* Corresponding author. E-mail: acacia.warren@tufts.edu

([dagger]) Current address: Department of Biology and Biochemistry, University of Houston, Houston, Texas 77204
TABLE 1.
Animals used to produce the International Reference Mapping
Family (IRMF) to develop a linkage map for shrimp (ShrimpMap).

Animal
  ID     Relationship    Generation #        Population Origin

  1      Maternal        Hybrid of 8th       Hybrid (Sinaloa,
           grandfather     and 4th             Mexico X Ecuador)
  2      Maternal        4th                 Sinaloa, Mexico X
           grandmother                         Sinaloa, Mexico
  3      Paternal        3rd                 Oaxaca, Mexico X
           grandfather                         Oaxaca, Mexico
  4      Paternal        3rd                 Oaxaca, Mexico X
           grandmother                         Oaxaca, Mexico
  5      Dam (P12)       Hybrid of           [(Ecuador X Sinaloa,
                           animals 1 and 2     Mexico) X Sinaloa,
                                               Mexico]
  6      Sire (R68)      Hybrid of           [Oaxaca, Mexico X
                           animals 3 and 4     Oaxaca, Mexico]

TABLE 2.
Primer sequences and repeat motifs of microsatellites from genomic
and cDNA libraries of Litopenaeus vannamei genotyped with the
International Reference Mapping Family (IRMF) for linkage analysis.
Only microsatellites that were placed on to ShrimpMap using CRIMAP
with LOD score of 3.0 or 5.0 are listed.

Marker ID (a)            Forward & Reverse Primers 5'->3'

Genomic microsatellites
  A population-specific marker isolated by RAPD (Garcia et al. 1996)
    M1 (B20 locus)       R:  GTGTGTTGCGGAATCGAA

  From a genomic library constructed using ovary DNA
    (Garcia & Alcivar-Warren 2007)
    TUGAPv1-3.132        F: CCGCCATCATCATCAACA
                         R: TCATTCGGGTTCGAGACTC
    TUGAPv3-5.213        F: CCCAGAACCATGTGATTGC
                         R: GTGAAGGGGGAATTATCCA
    TUGAPv1-3.271        F: CCACCCAACGTTTAAATAAC
                         R: GTCAGAGGATTGTATGATGT
    TUGAPv7-9.94         F: GCGCTGTCCTGTTATGTGAAAG

                         R: CACAGACAACCCGAAAGCTAAA
    TUGAPv7-9.95         F: GATCCTGCGAGTCACTTTATCTC

                         R: TTTATTGCGTATCCCAGAAGC
    TUGAPv7-9.179        F: GCTGTCTGGCAGTCATTAA
                         R: TGAGGAAAGGATGGCTGAA

  From genomic libraries ovary DNA (Meehan et al. 2003 &
    Alcivar-Warren et al. 2006)
    TUMXLv3.1 (c)        F: TAAAACCGAAAGACAATGCCG

                         R: CTGACATTGCGTTATGATTGG
    TUMXLv5.16 (c)       F:  AATGAATCTGACCGGTTTCG
                         R: TGGGTCGCTGGTGTGTATAG
    TUMXLv5.38           F:  CCTTTATGACTTCCCCCGAC
                         R: CCGTACAGAAACGGAACGTC
    TUMXLv5.45 (c)       F:  TTTGTCGTTTGTCTTTCTCC
                         R: AGTAACTTACGTGAATGCTTGG
    TUMXLv5.79           R:  TAAGCGAGTGCCTTCTGATG
    TUMXLv6.3
    TUMXLv6.5            R:  GATCTCCTAGGGAATGCCTG
    TUMXLv6.63           F:  TGTGAAGGTGTGTGAACGTG

                         R: CTGCAACCTTTGGTCTTGC
    TUMXLv6.107
    TUMXLV7.91
    TUMXLv7.102          F: TTTGGGAAGTAAGGCTGGAG
                         R: GGAGTAGACGGTTAAGGAGCAG

    TUMXLv7.138          F: AGACACATACAGACGCACGC
                         R: GAGTTGCTCCCAAACGCTAC
    TUMXLv8.2 (c)        F: CCTCCTGTCCATTCAGCAG
                         R: GGTCAGATATGTATTGGAGTTCGG
    TUMXLv8.24
    TUMXLv8.80
    TUMXLv8.106          R: CTGCCAAAGCATTGCGTG
    TUMXLv8.132
    TUMXLv8.179          F: CGCATTTCAAGTGCTCAAGG
                         R: TCATGCGCTATTGTGGACAG
    TUMXLv8.204
    TUMXLv8.205
    TUMXLv8.213
    TUMXLv8.256          F: GGACTCACACTTCTGGTTC
                         R: GGCTGCACCTTGTAAGTC
    TUMXLv8.296
    TUMXLv8.310 (d)
    TUMXLv8.312
    TUMXLv9.10
    TUMXLv9.28           F: CTTCACCTCCCCTCTCACAC
                         R: CAATCATCACCGGTCCTACC
    TUMXLv9.43 (c)       F: GAGAGCAAATAAGAAAGGGC
                         R: AGGATGCAAATGATAACGAG

    TUMXLv9.63
    TUMXLv9.90
    TUMXLv9.93           F: CACCACCGAAAAGGTAGGAG
                         R: TGGGAGAGGTTAGTCATGGG
    TUMXLv9.94
    TUMXLv9.109          R: CTTGTCAAGCGCAACTTCAG
    TUMXLv9.113 (c)
    TUMXLv9.116          F: GATGACCTGCCTTTCTCTGC
                         R: GGGAGAGATGATGGGAAGAAG
    TUMXLv9.121
    TUMXLv9.149          F: CTGGGAATATCCCATGAAGG
                         R: GACAGCAGAGAAACTGACTGC
    TUMXLv9.165
    TUMXLv9.178          F: CATTGAAAACGGAATCCTCG
                         R: GATATTCCCATCAACACAGCG
    TUMXLv9.188
    TUMXLv10.15
    TUMXLv10.27          F: GATCGGAAAGGACCGATAC
                         R: CAATGGGAATTTCGCAAGAC
    TUMXLv10.33          F: CGAAGAGATTTATCCAGGG
                         R: CGTGCATTATTATCCTTTCC
    TUMXLv10.147         F: CTATCCTTTCCACCTCCTTC
                         R: GACCTGGAGGAGAATAGAGC
    TUMXLv10.176         F: TTGCGTTTCTGTCCTTTATG
                         R: AGAAATGGAGAACGCAGTAG
    TUMXLv10.201         F: ATGCTGCATCATCTCTGAC
                         R: AGGAAAAGACGGTGAAATAG
    TUMXLv10.208         F: TGGAGGTCGAGAGGACAC
                         R: GTTGGCATCTCAAGAAAAC
    TUMXLv10.220         F: CGGAGTAAGGTACGGACTG
                         R: GTGGAGGTCGAGAGGACAC
    TUMXLv10.238
    TUMXLv10.255         F: CTAAATAAATCACGGGTTGGG
                         R: CCTTCTGGTTTACTGTTGAGGC
    TUMXLv10.278
    TUMXLv10.312         F: ATACGAAACACCCCATCCC
                         R: GTGGTCTTACCTCGTGGCTC
    TUMXLv10.323 (c)     F: CACCATTACTCTTATCCTTAC
                         R: GGAGGTGATTTTAAGATGTGC

    TUMXLv10.343         F: CTTCCACATTCCCTATCTTTC
                         R: CATTCTTACATTCGACTGAGC
    TUMXLv10.411         F: AGCACCTAGCACTTGCTGAAC

Annonymous marker (amplified with primers for a mitochondrial
  DNA sequence
  TUDWPvD20              F: CTTGGCTGCCGCTCTATAAC
                         R: CACATATTCACGAACATGCAC

Expressed microsatellites (EST-SSRs)
  EST-SSRs from TSV-challenged shrimp using mRN ADD
    (Dhar et al. 2000, Fan et al. 2001)
    TUYFLvL29.2          F: AGATAACAACAACAGCACCA
                         R: CCATTTTACATAAAGGACGG
    TUYFLvL16.1a         F: ATGGCACAAATAGGATCTTG
                         R: GACTGGAAGAGCACTGATTC
    TUYFLvH23.1          F: CCACTGTACATCACGTTCAC
                         R: AATTAGTGCTTGAAACGGTG
    TUYFLvH26.1          F: GTTAAAGTGTCGTTGGTTGG
                         R: CAAACATACAAGCAAGCAAG

  EST-SSR from WSSV-challenged shrimp (Alcivar-Warren et al. 2007)
    TUSWLvSU233          F: CCCGACTTGGCTTTTAGTTG
                         R: GAGATTGCTATCCTCGGCTG

  EST-SSR from cDNA library TSV2A obtained after per os challenge
    of shrimp with TSV (Dhar et al. 2000)
    TSV2A002.C2

AT-rich elements amplified by RT-PCR (Dhar et al. 2007)
  TUDLvShIL1.21
  TUDLvShIL1.28

Marker ID (a)            Repeat motifs (b)

Genomic microsatellites
  A population-specific marker isolated by RAPD (Garcia et al. 1996)
    M1 (B20 locus)

  From a genomic library constructed using ovary DNA
    (Garcia & Alcivar-Warren 2007)
    TUGAPv1-3.132        ...[(GA).sub.3]...[(CAT).sub.3]....
                         [(TC).sub.3]GG[(TC).sub.25...]

    TUGAPv3-5.213        ...[(ATC).sub.3]...[(TTA).sub.3]...
                         [(GA).sub.49]...

    TUGAPv1-3.271        ...[(GA).sub.50]...

    TUGAPv7-9.94         ...[(CA).sub.5]...[(CA).sub.14]
                         [(CATA).sub.3][(TA).sub.27]...[(TA).sub.3]...
                         [(TA).sub.4]...[(G).sub.14]...[(GA).sub.15]
                         ...[(GA).sub.3]...

    TUGAPv7-9.95         ...[(TC).sub.3]...[(AT).sub.3]...
                         [(AG).sub.3]...[(TC).sub.13]...[(AT).sub.24]
                         G[(TA).sub.5]TG[(TA).sub.4]TG[(TA).sub.4]
                         ...[(AT).sub.3]...[(AT).sub.24]

    TUGAPv7-9.179        ...[(TC).sub.25]...

  From genomic libraries ovary DNA (Meehan et al. 2003 &
    Alcivar-Warren et al. 2006)
    TUMXLv3.1 (c)        ...[(GT).sub.3]...[(A).sub.20]...
                         [(TG).sub.6]... [(AC).sub.3]...[(CA).sub.6]
                         CGCTCTN[(TC).sub.10]...[(TC).sub.4]TN
                         [(TC).sub.4][(TA).sub.9]

    TUMXLv5.16 (c)       ...[(ATT).sub.3]...[(CT).sub.3] ... (f)
                         [(AC).sub.3]...

    TUMXLv5.38           ...[(TC).sub.8]...[(CT).sub.4]...
                         [(TC).sub.4]...

    TUMXLv5.45 (c)       [(TC).sub.3]...[(TC).sub.4]C[(CT).sub.3] ...
                         [(CT).sub.3]...[(TA).sub.4]...[(ATCC).sub.4]
                         ...[(TC).sub.3]...
    TUMXLv5.79
    TUMXLv6.3
    TUMXLv6.5
    TUMXLv6.63           ...[(AT).sub.3]... (f)[(GT).sub.3] ...
                         [(GT).sub.6]ATC[(TG).sub.8]...[(GT).sub.3]...
                         [(GT).sub.4]...[(TG).sub.3]...[(TA).sub.3]...

    TUMXLv6.107
    TUMXLV7.91
    TUMXLv7.102          ...[(CCT).sub.4]...[(CTT).sub.3][(TC).sub.3]
                         ...[(CCT).sub.3]...[(TCT).sub.3]...
                         [(CTT).sub.3]...[(TCC).sub.3]...[(CT).sub.5]
                         TT[(CTC).sub.4]...[(CG).sub.3]...
                         [(AAC).sub.3]...[(ATA).sub.3]...
                         [(AAT).sub.3]...[(AAT).sub.3]...

    TUMXLv7.138          ...[(CA).sub.6]TAG[(AC).sub.3]GC[(AC).sub.3]
                         ...[(AC).sub.3]...[(CA).sub.19]...
                         [(CA).sub.7]...

    TUMXLv8.2 (c)        ...[(AT).sub.3]...[(AT).sub.3]...
                         [(AT).sub.3]...[(AT).sub.3]...[(AT).sub.3]...
                         (AC).sub.3]...[(AT).sub.3]...[(AT).sub.3]...
                         [(AT).sub.3]...[(AT).sub.3]

    TUMXLv8.24
    TUMXLv8.80
    TUMXLv8.106
    TUMXLv8.132
    TUMXLv8.179          ...[(TGG).sub.3]...[(AT).sub.4]...
                         [(TTTTA).sub.3]...[(TAT).sub.6]...

    TUMXLv8.204
    TUMXLv8.205
    TUMXLv8.213
    TUMXLv8.256          ...[(AAT).sub.4]...

    TUMXLv8.296
    TUMXLv8.310 (d)
    TUMXLv8.312
    TUMXLv9.10
    TUMXLv9.28           ...[(CCT).sub.3]...[(ATC).sub.3] ...
                         [(CT).sub.3]...[(CTTTT).sub.3]TTT
                         [(CTT).sub.3]...

    TUMXLv9.43 (c)       ...[(TG).sub.4]C[(GT).sub.4]TC[(GT).sub.6]
                         [(GC).sub.3]...[(GT).sub.3]TTA[(TG).sub.4]...
                         [(GGA).sub.3] ... (f)[(GA).sub.3]...
                         [(CT).sub.3]CC[(CT).sub.3]CC[(CCCT).sub.6]
                         [(CT).sub.10]...[(TC).sub.6]...[(TC).sub.3]
    TUMXLv9.63
    TUMXLv9.90
    TUMXLv9.93           ...[(TG).sub.5]ATG[(GT).sub.4] ...
                         [(AG).sub.9]...

    TUMXLv9.94
    TUMXLv9.109
    TUMXLv9.113 (c)      ...[(TG).sub.16]

    TUMXLv9.116          ...[(TTC).sub.3]...[(CTT).sub.3] ...
                         [(CT).sub.3]...[(CTT).sub.3]...
                         [(GT).sub.3]T[(TCC).sub.3]...[(TCC).sub.3]
                         ...[(CT).sub.3]...

    TUMXLv9.121
    TUMXLv9.149          ...[(TA).sub.3]...[(TA).sub.3]...

    TUMXLv9.165
    TUMXLv9.178          ...[(GC).sub.3]...[(CT).sub.5]...

    TUMXLv9.188
    TUMXLv10.15
    TUMXLv10.27          ...[(AC).sub.4]...[(AC).sub.7] ...
                         [(TA).sub.3]ATTACAA[(AC).sub.3]AT
                         [(AC).sub.3]AAG[(CA).sub.4]TA[(CA).sub.3]
                         TACACG[(TA).sub.3]...

    TUMXLv10.33          ...[(TTC).sub.3]...[(ATA).sub.3]...
                         [(AAT).sub.3]...[(AAT).sub.4]...[(GA).sub.3]
                         ...[(ATC).sub.3]...

    TUMXLv10.147         ...[(TC).sub.3]...[(TC).sub.3] ...
                         [(TTC).sub.3]C(TTC).sub.2]CTT(TC).sub.3]...
                         [(TC).sub.4]...

    TUMXLv10.176         ...[(TC).sub.3]...[(GT).sub.4] ...
                         [(TTC).sub.3]...[(TA).sub.4]...[(CA).sub.6]
                         TCTATC[(TA).sub.4]...[(TG).sub.4]
                         [(AC).sub.46]...

    TUMXLv10.201         ...[(CTC).sub.6]TTTCTCT[(TCC).sub.5] ...
                         [(TTC).sub.3][(CTC).sub.3]...[(CTTT).sub.3]
                         ...[(TC).sub.3][(CTT).sub.3]...

    TUMXLv10.208         ...[(CGC).sub.4]...[(GGT).sub.3]...

    TUMXLv10.220         ...[(GCG).sub.4]...

    TUMXLv10.238
    TUMXLv10.255         ...[(AT).sub.3]...

    TUMXLv10.278
    TUMXLv10.312         ...[(AG).sub.30]...[(AG).sub.5]...

    TUMXLv10.323 (c)     ...[(TTA).sub.3]...[(ATT).sub.4] ...
                         [(TTA).sub.3]...[(ATT).sub.4] ...
                         [(TTA).sub.3](TCA).sub.3]TTATT
                         [(ATCATT).sub.3]...[(AAAC).sub.3] ...
                         [(AAAT).sub.3]...[(AC).sub.5]...
                         [(TAT).sub.4]...[(CT).sub.8]...[(CT).sub.15]

    TUMXLv10.343         ...[(TTC).sub.4]...[(TTC).sub.4] ...
                         [(GT).sub.4]...
    TUMXLv10.411         ...[(TC).sub.3]...[(AAT).sub.3] ...
                         [(TAA).sub.12]C[(AAT).sub.4]...
Annonymous marker (amplified with primers for a mitochondrial
  DNA sequence
  TUDWPvD20              ...[(GT).sub.3]ATTT[(GTGTAT).sub.2]TTAT
                         (GTGTAT).sub.3][(GT).sub.8]
                         TT(GT)TT[(GT).sub.7]...

Expressed microsatellites (EST-SSRs)
  EST-SSRs from TSV-challenged shrimp using mRN ADD
    (Dhar et al. 2000, Fan et al. 2001)
    TUYFLvL29.2          ...[(ACA).sub.4]AAA[(ACA).sub.4] ...
                         [(ACA).sub.5]AAA[(ACA).sub.3]...
                         [(ACA).sub.6]...
    TUYFLvL16.1a         ...[(AAT).sub.4]...[(AC).sub.3]...

    TUYFLvH23.1          ...[(AG).sub.3]...

    TUYFLvH26.1          ...[(GTTT).sub.3]...[(GTTT).sub.3] ...
                         [(TGTT).sub.3]...[(TGCT).sub.3]...

  EST-SSR from WSSV-challenged shrimp (Alcivar-Warren et al. 2007)
    TUSWLvSU233          ...(TGA)3ATG(GA)3...(GA)4AGTA(AGC)3...

  EST-SSR from cDNA library TSV2A obtained after per os challenge
    of shrimp with TSV (Dhar et al. 2000)
    TSV2A002.C2

AT-rich elements amplified by RT-PCR (Dhar et al. 2007)
  TUDLvShIL1.21
  TUDLvShIL1.28

                          ShrimpMap      ShrimpMap
                          LG with        LG with
                          LOD score      LOD score
Marker ID (a)             of 3.0         of 5.0

Genomic microsatellites
  A population-specific marker isolated by RAPD (Garcia et al. 1996)
    M1 (B20 locus)        LG4            LG4

  From a genomic library constructed using ovary DNA
    (Garcia & Alcivar-Warren 2007)
    TUGAPv1-3.132         U *            LG6
    TUGAPv3-5.213         LG5            LGS
    TUGAPv1-3.271         U *            U
    TUGAPv7-9.94          U *            U
    TUGAPv7-9.95          LG14           LG14
    TUGAPv7-9.179         LG13           LG13

  From genomic libraries ovary DNA (Meehan et al. 2003 &
    Alcivar-Warren et al. 2006)
    TUMXLv3.1 (c)         LG4            LG4
    TUMXLv5.16 (c)        U *            LG6
    TUMXLv5.38            LG4            LG4
    TUMXLv5.45 (c)        LG12           LG12
    TUMXLv5.79            LG3            LG3
    TUMXLv6.3             U *            LG4
    TUMXLv6.5             LG10           U
    TUMXLv6.63            LG3            LG3
    TUMXLv6.107           LGl            U
    TUMXLV7.91            LG3            U
    TUMXLv7.102                          LG1
    TUMXLv7.138           U *            LG6
    TUMXLv8.2 (c)         U *            LG4
    TUMXLv8.24            LG7            LG7
    TUMXLv8.80            U *            U
    TUMXLv8.106           LG11           LG11
    TUMXLv8.132           U              LG3
    TUMXLv8.179           LG6            U
    TUMXLv8.204           LG2            LG2
    TUMXLv8.205           LG9            U
    TUMXLv8.213           LG3            U
    TUMXLv8.256           LG1            U
    TUMXLv8.296           U *            LG6
    TUMXLv8.310 (d)       LG3            U
    TUMXLv8.312           LG3            U
    TUMXLv9.10            LG6            U
    TUMXLv9.28            U *            LG4
    TUMXLv9.43 (c)        U *            LG4
    TUMXLv9.63            U*             LG10
    TUMXLv9.90
    TUMXLv9.93            U*             LG4
    TUMXLv9.94            LG13           LG13
    TUMXLv9.109           LG10           U
    TUMXLv9.113 (c)
    TUMXLv9.116           LG3            LG1
    TUMXLv9.121           U *            LG6
    TUMXLv9.149           LG8            LG8
    TUMXLv9.165           LG3
    TUMXLv9.178           LG8            LG8
    TUMXLv9.188           LG12           LG12
    TUMXLv10.15           LG9            LG9
    TUMXLv10.27           LG3            LG1
    TUMXLv10.33           LG11           LG11
    TUMXLv10.147          LG4            LG10
    TUMXLv10.176          LG9            LG9
    TUMXLv10.201          U *            U
    TUMXLv10.208          U *            U *
    TUMXLv10.220          U *
    TUMXLv10.238
    TUMXLv10.255          U *            U *
    TUMXLv10.278
    TUMXLv10.312          LG2            LG2
    TUMXLv10.323 (c)      U *            U *
    TUMXLv10.343          U *            LG10
    TUMXLv10.411          LG2            LG2

Annonymous marker (amplified with primers for a mitochondrial
  DNA sequence
  TUDWPvD20               U *            LG4

Expressed microsatellites (EST-SSRs)
  EST-SSRs from TSV-challenged shrimp using mRN ADD
    (Dhar et al. 2000, Fan et al. 2001)
    TUYFLvL29.2           LG4            LG4
    TUYFLvL16.1a          LG5            LG5
    TUYFLvH23.1           LG4            U
    TUYFLvH26.1           LG14           LG14

  EST-SSR from WSSV-challenged shrimp (Alcivar-Warren et al. 2007)
    TUSWLvSU233           LG7            LG7

  EST-SSR from cDNA library TSV2A obtained after per os challenge
    of shrimp with TSV (Dhar et al. 2000)
    TSV2A002.C2           U *            U *

AT-rich elements amplified by RT-PCR (Dhar et al. 2007)
  TUDLvShIL1.21           LG14           LG14
  TUDLvShIL1.28           LG3            U

                          # of
                          mutations
                          (parental           GenBank
Marker ID (a)             origin)             Accession #

Genomic microsatellites
  A population-specific marker isolated by RAPD (Garcia et al. 1996)
    M1 (B20 locus)        2 (1 maternal,
                          1 unable)
  From a genomic library constructed using ovary DNA
    (Garcia & Alcivar-Warren 2007)
    TUGAPv1-3.132                             AY376917
    TUGAPv3-5.213         1 (paternal)        AY376934
    TUGAPv1-3.271                             AY376941
    TUGAPv7-9.94                              AY376979
    TUGAPv7-9.95                              AY376980
    TUGAPv7-9.179         1 (both)            AY376990

  From genomic libraries ovary DNA (Meehan et al. 2003 &
    Alcivar-Warren et al. 2006)
    TUMXLv3.1 (c)                             AF360017
    TUMXLv5.16 (c)                            AF360020
    TUMXLv5.38                                AF360024
    TUMXLv5.45 (c)                            AF360025
    TUMXLv5.79
    TUMXLv6.3
    TUMXLv6.5
    TUMXLv6.63            1 (paternal)        AF360040
    TUMXLv6.107
    TUMXLV7.91            1 (maternal)
    TUMXLv7.102           U                   AF360042
    TUMXLv7.138                               AF360048
    TUMXLv8.2 (c)                             AF360070
    TUMXLv8.24            1 (1 paternal)
    TUMXLv8.80
    TUMXLv8.106
    TUMXLv8.132
    TUMXLv8.179                               AF360065
    TUMXLv8.204
    TUMXLv8.205
    TUMXLv8.213
    TUMXLv8.256                               AF360076
    TUMXLv8.296
    TUMXLv8.310 (d)
    TUMXLv8.312
    TUMXLv9.10
    TUMXLv9.28            4 (3 maternal,      AF360108
                          1 paternal)
    TUMXLv9.43 (c)        1 (unable)          AF360109
    TUMXLv9.63                                na
    TUMXLv9.90
    TUMXLv9.93                                AF360115
    TUMXLv9.94
    TUMXLv9.109           1 (maternal)
    TUMXLv9.113 (c)                           AF360093
    TUMXLv9.116                               AF360094
    TUMXLv9.121
    TUMXLv9.149           1 (maternal)        AF360099
    TUMXLv9.165           1 (paternal)
    TUMXLv9.178                               AF360105
    TUMXLv9.188
    TUMXLv10.15           2 (maternal)
    TUMXLv10.27                               AF359979
    TUMXLv10.33           1 (both)            AF359992
    TUMXLv10.147                              AF359950
    TUMXLv10.176                              AF359952
    TUMXLv10.201                              AF359959
    TUMXLv10.208                              AF359964
    TUMXLv10.220                              AF359969
    TUMXLv10.238
    TUMXLv10.255                              AF359977
    TUMXLv10.278
    TUMXLv10.312                              AF359989
    TUMXLv10.323 (c)                          AF359993
    TUMXLv10.343                              AF359996
    TUMXLv10.411                              AF360004

Annonymous marker (amplified with primers for a mitochondrial
  DNA sequence
  TUDWPvD20                                   na

Expressed microsatellites (EST-SSRs)
  EST-SSRs from TSV-challenged shrimp using mRN ADD
    (Dhar et al. 2000, Fan et al. 2001)
    TUYFLvL29.2
    TUYFLvL16.1a
    TUYFLvH23.1
    TUYFLvH26.1

  EST-SSR from WSSV-challenged shrimp (Alcivar-Warren et al. 2007)
    TUSWLvSU233

  EST-SSR from cDNA library TSV2A obtained after per os challenge
    of shrimp with TSV (Dhar et al. 2000)
    TSV2A002.C2                               na

AT-rich elements amplified by RT-PCR (Dhar et al. 2007)
  TUDLvShIL1.21                               U094689
  TUDLvShIL1.28                               U094690

(a) Nomenclature for microsatellites is as reported in Meehan et al.
(2003). Genomic microsatellites in bold indicate they were also
placed on to the linkage map of Zhang et al. (2007).

(b) Different microsatellites within a clone are separated by (...).
Motifs in bold = indicate repeats flanked by the primers selected for
analysis.

(c) There was not enough flanking sequences to design primers for all
the motifs included in the sequence. However, primers may have been
designed from a single or combined motifs within the sequence.

(d) This genomic clone shows partial homology (nt 113-223) to motifs
(nt 820-856) of Y testis-determining factor protein.

(e) Alleles amplified with markers originally designed for
mitochondrial DNA.

(f) Part of this motif was included in the design of the primer.

(g) There were too many Ns in middle of sequence--only partial
sequence was submitted to GenBank (Meehan et al. 2003).

U = unlinked markers with LOD score of 3.0 or 5.0:  TUMXLv5.42,
5.66, 6.124, 7.9, 7.32, 8.48, 8.75, 8.101, 8.184, 8.191, 8.193,
8.206, 8.216, 8.224, 9.60, 9.77, 9.78, 9.103, 9.180, 10.204, 10.238,
10.278, 10.284, H16.1, GW7-9.226, GWS-7-284.2, GW3-5.271, gw7-9.94,
SU352, SU508, TSV2A003.H2, TSV2A002.F8, TSV2A003.F2, TSV2A003.A4,
D28118, 026403

U * = unlinked, refers to some of the 29 markers that located on to
linkage group 4 using CRIMAP with LOD score of 3.0, but were unable
to order them.

TABLE 3.
Allelic inheritance and segregation pattern for genomic and expressed
microsatellites genotyped with the IRMF panel for linkage analysis
using CRIMAP version 2.4 with LOD score of 5.0.

                  ShrimpMap             Parental
                   Linkage              Genotype            Segregation
Markers           Group (LG)          (Dam x Sire)          Pattern (a)

M1 (B20)             LG4             198/202 x 218/N          1:1:1:1
                                        a/b x c/o            a,b,ac,bc
TUMXLv5.42                           349/353 x 347/N          1:1:1:1
                                        a/b x c/o            a,b,ac,bc
TUMXLv5.79           LG3             174/179 x 177/N          1:1:1:1
                                        a/b x c/o            ac,a,bc,b
TUMXLv10.33          LG10            190/235 x 256/N          1:1:1:1
                                        a/b x c/o            ac,a,bc,b
TUMXLv3.1            LG4             137/N2 x 136/N1          1:1:1:1
                                        a/o x b/o            ab,a,b,o
TUMXLv6.63           LG3             185/N1 x 183/N2          1:1:1:1
                                        a/o x b/o            ab,a b,o
TUMXLv7.138          LG6             273/N1 x 277/N2          1:1:1:1
                                        a/o x b/o             a, ab,b
TUMXLv8.184                          248/N1 x 308/N2          1:1:1:1
                                        a/o x b/o            a,b,ab,o
TUMXLv8.216                          154/N1 x 151/N2          1:1:1:1
                                        a/o x b/o            ab,a,b,o
TUMXLv9.28#          LG4             151/N1 x 163/N2          1:1:1:1
                                        a/o x b/o            a,b,ab,o
TUMXLv9.43#          LG4             221/N1 x 206/N2          1:1:1:1
                                        a/o x b/o            a,b,ab,o
TUMXLv9.93#          LG4             307/N1 x 325/N2          1:1:1:1
                                        a/o x b/o            ab,a,b,o
TUMXLv9.103                          255/N1 x 214/N2          1:1:1:1
                                        a/o x b/o            ab,a,b,o
TUGAPv3-5.271#                       122/N1 x 130/N2          l:la:l
                                        a/o x b/o            a,b,ab,o
TUGAPv7-9.94#                        300/N1 x 304/N2          l:la:l
                                        a/o x b/o            a,ab,b,o
TUYFLvL29.2#         LG4             125/N1 x 129/N2          1:1:1:1
                                        a/o x b/o            a,b,ab,o
TSV2A003.H2                          139/N1 x 181/N2          1:1:1:1
                                        a/o x b/o            a,b,ab,o
TUMXLv5.38#          LG4            203/208 x 208/209         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv5.66#                         249/252 x 246/249         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv6.3#           LG4            180/188 x 188/189         l:1:l:l
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv6.107#                        281/282 x 280/282         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv8.132          LG3            188/189 x 185/189         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv8.191#                        190/200 x 200/201         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv9.63#          LG10           293/296 x 293/294         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv9.78                          286/287 x 287/288         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv9.149          LG8            248/249 x 247/248         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv9.188          LG12           201/202 x 196/202         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv10.15          LG9            152/165 x 153/165         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv10.147#        LG10           182/189 x 189/195         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv10.238                        206/209 x 209/210         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv10.312#        LG2            182/184 x 181/184         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUGAPv7-9.226                         80/82 x 79/80           1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
ShIL1.28                            307/309 x 297/309         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUYFLvH23.1#                        108/110 x 108/11          1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TULSLvSu352                         375/378 x 378/385         1:1:1:1
                                        a/b x b/c           ab,ac,bb,bc
TUMXLv5.45           LG12            169/N x 166/171          1:1:1:1
                                        a/o x b/c            ab,ac,b,c
TUMXLv8.204          LG2             291/N x 284/286          1:1:1:1
                                        a/o x b/c            ab,ac,b.c
TUMXLv8.213                          238/N x 221/233          1:1:1:1
                                        a/o x b/c            ab,ac,b,c
TUMXLv9.77                           211/N x 206/213          1:1:1:1
                                        a/o x b/c            ab,ac,b,c
TUMXLv10.201                         165/N x 155/157          1:1:1:1
                                        a/o x b/c            ab,ac,b,c
TUGAPv3-5.213#       LG5             228/N x 192/197          1:1:1:1
                                        a/o x b/c            ab,ac,b,c
TUMXLv8.2            LG4            229/239 x 242/245         1:1:1:1
                                        a/b x c/d           ac,ad,bd,bd
TUMXLv9.109                         318/336 x 320/350         1:1:1:1
                                        a/b x c/d           ac,ad,bd,bd
TUMXLv'9.180                        296/298 x 295/297         1:1:1:1
                                        a/b x c/d           ac,ad,bd,bd
TUMXLv10.284                        207/208 x 204/209         1:1:1:1
                                        a/b x c/d           ac,ad,bd,bd
TUMXLv10.411         LG2            188/190 x 182/195         1:1:1:1
                                        a/b x c/d           ac,ab,bc,bd
TUGAPv5-7.284                       117/119 x 109/129         1:1:1:1
                                        a/b x c/d           ac,ad,bc,bd
TUMXLv5.16           LG6            193/200 x 193/193           1:1
                                        a/b x a/a              aa,ab
TUMXLv6.5                           142/145 x 145/145           1:1
                                        a/b x a/a              aa,ab
TUMXLv7.9                           273/288 x 273/273           1:1
                                        a/b x a/a              aa,ab
TUMXLv7.32                          121/123 x 121/121           1:1
                                        a/b x a/a              aa,ab
TUMXLv7.91                          102/105 x 102/102           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.75                          199/200 x 199/199           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.80#                         208/216 x 216/216           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.101#                        121/161 x 161/161           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.106          LG10           293/294 x 293/293           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.179                         189/196 x 196/196           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.206                         274/282 x 282/282           1:1
                                        a/b x a/a              aa,ab
TUMXLv8.296#         LG6            175/192 x 192/192           1:1
                                        a/b x a/a              aa,ab
TUMXLv9.10                          105/120 x 120/120           1:1
                                        a/b x a/a              ab,aa
TUMXLv'9.60                         306/308 x 306/306           1:1
                                        a/b x a/a              aa,ab
TUMXLv10.343         LG10           249/252 x 252/252           1:1
                                        a/b x a/a              aa.ab
TUGAPv7-9.95         LG14           281/283 x 283/283           1:1
                                        a/b x a/a              aa,ab
TUDWPvD20            LG4            192/201 x 192/192           1:1
                                        a/b x a/a              aa,ab
ShIL1.21             LG14           269/282 x 282/282           1:1
                                        a/b x a/a              aa,ab
TUYFLvH16.1                           89/92 x 92/92             1:1
                                        a/b x a/a              aa,ab
TUYFLvH26.1          LG14           138/141 x 138/138           1:1
                                        a/b x a/a              aa,ab
TSV2A003.F2                    238 (e) /242 (e) x 238/238       1:1
                                        a/b x a/a              aa,ab
TULSLvSu233          LG7            182/184 x 184/184           1:1
                                        a/b x a/a              aa,ab
TULSLvSu508                         158/159 x 159/159           1:1
                                        a/b x a/a              aa,ab
TUMXLv6.124                         162/170 x 162/170          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv8.310#                        156/160 x 156/160          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv9.121#         LG6            134/137 x 134/137          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv10.204#                       211/213 x 211/213          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv10.208#        LG4            119/122 x 119/122          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv10.220#                       168/171 x 168/171          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv10.255#        LG4            216/221 x 216/221          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLvl0.278                        220/229 x 220/229          1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv10.323#        LG4            212/222 x 212/222          1:2:1
                                        a/b x a/b            aa.ab.bb
TSV2A002.C2#         LG4            221/22 x 221/222           1:2:1
                                        a/b x a/b            aa,ab,bb
TUMXLv7.102                         315/315 x 315/318           1:1
                                        a/a x a/b              aa.ab
TUMXLv8.205                         204/204 x 202/204           1:1
                                        a/a x a/b              aa,ab
TUMXLv8.224#                        302/302 x 300/302           1:1
                                        a/a x a/b              aa,ab
TUMXLv9.94           LG13           273/273 x 271/273           1:1
                                        a/a x a/b              aa,ab
TUYFLvL16.1a         LG5            179/179 x 176/179           1:1
                                        a/a x a/b              aa,ab
TSV2A002.F8                         179/179 x 179/181           1:1
                                        a/a x alb              aa,ab
TSV2A003.A4                         182/182 x 173/182           1:1
                                       a/a x a /b              aa,ab
TUMXLv8.24           LG7            129/131 x 130/130           1:1
                                        a/b x c/c              ac,bc
TUMXLv9.165                         394/398 x 397/397           1:1
                                        a/b x c/c              ac,bc
TUMXLv9.178          LG8            195/197 x 196/196           1:1
                                        a/b x c/c              ac,bc
TUMXLv8.48                           275/N x 250/250            1:1
                                        a/o x b/b              ab,b
TUMXLv8.193#                         176/176 x 180/N            1:1
                                        a/a x b/o              ab,a
TUMXLv8.256                         156/156 x 161/167           1:1
                                        a/a x b/c              ab,ac
TUMXLv9.116          LG1            147/147 x 158/159           1:1
                                        a/a x b/c              ab,ac
TUMXLv10.27#         LG1            256/256 x 287/297           1:1
                                        a/a x b/c              ab,ac
TUMXLv10.176         LG9            242/242 x 225/240           1:1
                                        a/a x b/c              ab,ac
TUGAPv1-3.132        LG6            110/116 x 114/114           1:1
                                        a/b x c/c              ac,bc
TUGAPv7-9.179        LG13              N/N x 61/69              1:1
                                         o x a/b                a,b
D28118 (f)                                n.a.                  n.a

U26403 (f)                                n.a.                  n.a

                                 Observed #
                            of Offspring in Each
Markers                       Genotypic Class

M1 (B20)         198/218     198/N     202/218      202/N
                   20         25         21          19
TUMXLv5.42       347/349     349/N     347/353      353/N
                    7          7          3           8
TUMXLv5.79       174/177    177/179     174/N       179/N
                    7         10          9           9
TUMXLv10.33      190/256     190/N     235/256      235/N
                   27         15         20          21
TUMXLv3.1        136/137    137/N1     136/N2       N1/N2
                   23         14         30          21
TUMXLv6.63       183/185    185/N2     183/N1       N1/N2
                   14         24         13        17 (d)
TUMXLv7.138      273/277    273/N2     277/N1       N1/N2
                   24         15         17       18.67 (d)
TUMXLv8.184      248/308    248/N2     308/N1       N1/N2
                    8         12          9        9.7 (d)
TUMXLv8.216      151/154    154/N2     151/N1       N1/N2
                    7          5          9        9.7 (d)
TUMXLv9.28#      151/163    151/N2     163/N1       N1/N2
                    2         21          7        10 (d)
TUMXLv9.43#      206/221    206/N1     221/N2       N1/N2
                    0         31         31       20.67 (d)
TUMXLv9.93#      307/325    307/N2     325/N1       N1/N2
                    0         38          6       14.67 (d)
TUMXLv9.103      214/255    255/N2     214/N1       N1/N2
                   18         25         14        19 (d)
TUGAPv3-5.271#   122/130    122/N2     130/N1       N1/N2
                   23         10         33          23
TUGAPv7-9.94#    300/304    300/N2     304/N1       N1/N2
                   23         38         15          13
TUYFLvL29.2#     125/129    125/N2     129/N1       N1/N2
                    0         40         36          13
TSV2A003.H2      139/181    139/N2     181/N1       N1/N2
                   25         20         22          21
TUMXLv5.38#      203/208    203/209    208/208     208/209
                   16          0          0           8
TUMXLv5.66#      246/249    249/249    246/252     249/252
                   17         18         29          11
TUMXLv6.3#       180/188    180/189    188/188     188/189
                   13          0          0          14
TUMXLv6.107#     280/281    281/282    280/282     282/282
                    6          6          0          11
TUMXLv8.132      185/188    188/189    185/189     189/189
                   21         11         13          21
TUMXLv8.191#     190/200    190/201    200/200     200/201
                   12          9         20           7
TUMXLv9.63#      293/293    293/294    293/296     294/296
                    0         37          1          33
TUMXLv9.78       286/287    286/288    287/287     287/288
                   17         18         24          11
TUMXLv9.149      247/248    248/248    247/249     248/249
                   21         19         15          16
TUMXLv9.188      196/201    201/202    196/202     202/202
                   20         17         23          24
TUMXLv10.15      152/153    152/165    153/165     165/165
                   12         12         13          16
TUMXLv10.147#    182/189    182/195    189/189     189/195
                    0         35          0          42
TUMXLv10.238     206/209    209/209    209/210     206/210
                   25         21         10          22
TUMXLv10.312#    181/182    181/184    182/184     184/184
                   12          2         12           7
TUGAPv7-9.226     79/80      80/80      79/82       80/82
                    7          8         14          18
ShIL1.28         297/307    307/309    297/309     309/309
                    1          3          6           7
TUYFLvH23.1#     108/108    108/111    108/110     110/111
                    8         13         44          12
TULSLvSu352      375/378    375/385    378/378     378/385
                   18         21         13          15
TUMXLv5.45       166/169    169/171     166/N       171/N
                   25         21         15          17
TUMXLv8.204      284/291    286/291     284/N       286/N
                   10         11         11          18
TUMXLv8.213      221/238    233/238     221/N       233/N
                    7          8          9           6
TUMXLv9.77       206/211    211/213     206/N       213/N
                    6          9          9           5
TUMXLv10.201     155/165     155/N     157/165      157/N
                    7         14         12          10
TUGAPv3-5.213#   192/228    197/228     192/N       197/N
                    7         14         22          21
TUMXLv8.2        229/242    239/242    229/245     239/245
                    8         11          7          11
TUMXLv9.109      318/320    318/350    320/336     336/350
                   19         13         15          11
TUMXLv'9.180     295/296    296/297    295/298     297/298
                   20         13         23          20
TUMXLv10.284     204/207    207/209    204/208     208/209
                    7          6          3           6
TUMXLv10.411     182/188    188/195    190/195     182/190
                   19         22         19          21
TUGAPv5-7.284    109/117    117/129    109/119     119/129
                   12         12         11          23
TUMXLv5.16                  193/193    193/200
                              36         35
TUMXLv6.5                   142/145    145/145
                              45         36
TUMXLv7.9                   273/273    273/288
                              47         35
TUMXLv7.32                  121/121    121/123
                              34         45
TUMXLv7.91                  102/102    102/105
                              35         48
TUMXLv8.75                  199/199    199/200
                              34         40
TUMXLv8.80#                 208/216    216/216
                              13         44
TUMXLv8.101#                121/161    161/161
                              27         10
TUMXLv8.106                 293/293    293/294
                              33         25
TUMXLv8.179                 189/196    196/196
                              40         41
TUMXLv8.206                 274/282    282/282
                              21         34
TUMXLv8.296#                175/192    192/192
                              68         13
TUMXLv9.10                  105/120    120/120
                              45         38
TUMXLv'9.60                 306/306    306/308
                              37         38
TUMXLv10.343                249/252    252/252
                              41         27
TUGAPv7-9.95                281/283    283/283
                              25         40
TUDWPvD20                   192/192    192/201
                              43         36
ShIL1.21                    269/282    282/282
                              49         34
TUYFLvH16.1                  89/92      92/92
                              48         38
TUYFLvH26.1                 138/138    138/141
                              34         32
TSV2A003.F2                 238/242    238/238
                              30         40
TULSLvSu233                 182/184    184/184
                              35         39
TULSLvSu508                 158/159    159/159
                              19         18
TUMXLv6.124      162/162    162/170    170/170
                   20       43 (x)       23
TUMXLv8.310#     156/156    156,/160   160/160
                   22       29 (x)        3
TUMXLv9.121#     134/134    134/137    137/137
                   52       30 (x)        2
TUMXLv10.204#    211/211    211/213    213/213
                    0       35 (x)       16
TUMXLv10.208#    119/119    119/122    122/122
                    0       78 (x)        3
TUMXLv10.220#    168/168    168/171    171/171
                    7       44 (x)       19
TUMXLv10.255#    216/216    216/221    221/221
                    3       64 (x)        0
TUMXLvl0.278     220/220    220/229    229/229
                   19       48 (x)       19
TUMXLv10.323#    212/212    212/222    222/222
                    0       85 (x)        0
TSV2A002.C2#     221/221    221/222    222/222
                   15         25         28
TUMXLv7.102                 315/315    315/318
                              14         12
TUMXLv8.205                 202/204    202/204
                              21         30
TUMXLv8.224#                300/302    302/302
                              27         44
TUMXLv9.94                  271/273    273/273
                              42         37
TUYFLvL16.1a                176/179    179/179
                              41         44
TSV2A002.F8                 179/179    179/181
                              37         35
TSV2A003.A4                 173/182    182/182
                              31         37
TUMXLv8.24                  129/130    130/131
                              35         33
TUMXLv9.165                 394/397    397/398
                              21         21
TUMXLv9.178                 195/196    196/197
                              16         11
TUMXLv8.48                  250/275     250/N
                              23         31
TUMXLv8.193#                176/180     176/N
                              22         43
TUMXLv8.256                 156/161    156/167
                              34         51
TUMXLv9.116                 147/158    147/159
                              45         31
TUMXLv10.27#                256/287    256/297
                              46         29
TUMXLv10.176                225/242    240/242
                              44         41
TUGAPv1-3.132               110/114    114/116
                              43         38
TUGAPv7-9.179                61/N       69/N
                              37         39
D28118 (f)                  120/120    120/216
                              16         25
U26403 (f)       183/188    188/188    183/183
                   16         17          9

                 Expected        Total
                 in Each         # of
Markers           Class       Meiosis (b)    [[chi square].sup.g]

M1 (B20)          21.25           85                0.977

TUMXLv5.42         6.25           25                2.360

TUMXLv5.79         8.75           35                0.543

TUMXLv10.33       20.75           83                3.506

TUMXLv3.1         22.00           88                5.909

TUMXLv6.63        17.00           51                4.353

TUMXLv7.138       18.67           56                2.392

TUMXLv8.184        9.70           29                0.894

TUMXLv8.216        7.00           21                1.143

TUMXLv9.28#       10.00           30               19.400 **

TUMXLv9.43#       20.67           62               25.833 **

TUMXLv9.93#       14.67           44               56.896 **

TUMXLv9.103       19.00           57                3.263

TUGAPv3-5.271#    22.25           89                9.966 *

TUGAPv7-9.94#     22.25           89               17.382 **

TUYFLvL29.2#      22.25           89               48.753 **

TSV2A003.H2       22.00           88                0.636

TUMXLv5.38#        6.00           24               29.333 **

TUMXLv5.66#       18.75           75                9.000 *

TUMXLv6.3#         6.75           27               27.074 **

TUMXLv6.107#       5.75           23               10.565 *

TUMXLv8.132       16.50           66                5.030

TUMXLv8.191#      12.00           48                8.167 *

TUMXLv9.63#       17.75           71               67.535 **

TUMXLv9.78        17.50           70                4.857

TUMXLv9.149       17.75           71                1.282

TUMXLv9.188       21.00           84                1.429

TUMXLv10.15       13.25           53                0.811

TUMXLv10.147#     19.25           77               78.270 **

TUMXLv10.238      19.50           78                6.615

TUMXLv10.312#      8.25           33                8.333 *

TUGAPv7-9.226     11.75           47                6.872

ShIL1.28           4.25           17                5.353

TUYFLvH23.1#      19.25           77               43.156 **

TULSLvSu352       16.75           67                2.194

TUMXLv5.45        19.50           78                3.026

TUMXLv8.204       12.50           50                3.280

TUMXLv8.213        7.50           30                0.667

TUMXLv9.77         7.25           29                1.759

TUMXLv10.201      10.75           43                2.488

TUGAPv3-5.213#    16.00           64                9.125 *

TUMXLv8.2          9.25           37                1.378

TUMXLv9.109       14.50           58                2.414

TUMXLv'9.180      19.00           76                2.842

TUMXLv10.284       5.50           22                1.636

TUMXLv10.411      20.25           81                0.333

TUGAPv5-7.284     14.50           48                6.690

TUMXLv5.16        35.50           71                0.014

TUMXLv6.5         40.50           81                1.000

TUMXLv7.9         41.00           82                1.268

TUMXLv7.32        39.50           79                1.532

TUMXLv7.91        41.50           83                2.036

TUMXLv8.75        37.00           74                0.487

TUMXLv8.80#       28.50           57               16.860 **

TUMXLv8.101#      18.50           37               7.8108 *

TUMXLv8.106       29.00           58                1.103

TUMXLv8.179       40.50           81                0.012

TUMXLv8.206       27.50           55                3.073

TUMXLv8.296#      40.50           81               37.346 **

TUMXLv9.10        41.50           83                0.590

TUMXLv'9.60       37.50           75                0.013

TUMXLv10.343      34.00           68                2.882

TUGAPv7-9.95      32.50           65                3.462

TUDWPvD20         39.50           79                0.620

ShIL1.21          41.50           83                2.711

TUYFLvH16.1       43.00           86                1.163

TUYFLvH26.1       33.00           66                0.061

TSV2A003.F2       35.00           70                1.429

TULSLvSu233       37.00           74                0.216

TULSLvSu508       18.50           37                0.027

TUMXLv6.124       21.50           86                0.209
                  43.0 (x)
TUMXLv8.310#      13.50           54               13.665 *
                  27.00 (x)
TUMXLv9.121#      21.00           84               66.379 **
                  42.0 (x)
TUMXLv10.204#     12.75           51               17.117 **
                  25.50 (x)
TUMXLv10.208#     20.25           81               69.666 **
                  40.50 (x)
TUMXLv10.220#     17.50           70                8.742 *
                  35.00 (x)
TUMXLv10.255#     16.75           67               55.805 **
                  33.5 (x)
TUMXLvl0.278      21.50           86                1.161
                  43.0 (x)
TUMXLv10.323#     21.25           85               85.000 **
                  42.50 (x)
TSV2A002.C2#      17.00           68                9.735 *
                  34 (x)
TUMXLv7.102       13.00           26                0.154

TUMXLv8.205       25.50           51                1.588

TUMXLv8.224#      35.50           71                4.070 *

TUMXLv9.94        39.50           79                0.317

TUYFLvL16.1a      42.50           85                0.106

TSV2A002.F8       36.00           72                0.056

TSV2A003.A4       34.00           68                0.529

TUMXLv8.24        34.00           68                0.059

TUMXLv9.165       21.00           42                0.000

TUMXLv9.178       13.50           27                0.926

TUMXLv8.48        27.00           54                1.185

TUMXLv8.193#      32.50           65                6.785 *

TUMXLv8.256       42.50           85                3.400

TUMXLv9.116       38.00           76                2.579

TUMXLv10.27#      37.50           75                3.853 *

TUMXLv10.176      42.50           85                0.105

TUGAPv1-3.132     40.50           81                0.309

TUGAPv7-9.179     38.00           76                0.053

D28118 (f)          na            41                  na

U26403 (f)          na            42                  na

(a) Segregation pattern, na = not available. Markers in bold show
segregation distortion

(b) Total number of meiosis = number of animals that amplified
alleles.

(x) Expected number of this class is twice because the segregation
pattern is 1:2:1.

(d) Samples showing N1/N2 genotype cannot be distinguished from
unamplified samples. Therefore, we assume the number of N1/N2
genotypes are the same with the expected number in each class.

(e) Inferred from offsprings.

(f) These are human EST sequences. Markers did not amplify parental
alleles, so they cannot be tested for segregation analysis.

(g) Expected segregation ratio at P = 0.05, * 0.001 < P < 0.05;
** P <0.001.

Note: Markers in bold show segregation distortion indicated with #.

TABLE 4.
Summary of the segregation patterns of microsatellites in parents and
offspring of the mapping family used to construct the linkage map for
SPF L. vannamei.

Parent
Genotype
                Progeny          Segregation   # of
Dam    Site     Genotype           Pattern     Loc

aa X   ab       a, ab                  1:1        7
ab X   aa       a, ab                  1:1       15
ab X   ml       ac, bc                 1:1        3
ao X   bb       ab, b                  1:1        1
aa X   bo       ab, a                  1:1        1
aa X   bc       ab, ac                 1:1        4
ab X   co       a, b, ac, bc       1:1:1:1        4
ab X   cd       ac, ad, bc, bd     1:1:1:1        5
ao X   bc       ab, ac, b, c       1:1:1:1        5
ab X   bc       ab, ac, bb, bc     1:1:1:1       14
ao X   bo       a, ab, b, o        1:1:1:1       13
ab X   ab       aa, ab, bb           1:2:1        9

Total number of loci analyzed.

TABLE 5.
Summary of the linkage map for SPF Litopenaeus vannamei
(ShrimpMap) (a).

                                LOD Score   LOD Score
                                 of 3.0      of 5.0

Total # of markers placed
  in CRIMAP                     101         101
Total # of Linkage
  Groups (LG)                    14          14 (b)
Total # of linked markers        67          48
Total # of ordered markers       45          44
Total # of unordered markers     22 (c)       4
Total # of unlinked markers      34          53
Average # of markers
  per group                       3.2         3.1
Minimum # of markers
  per group                       2           2
Maximum # of markers
  per group                      10          11
Average marker spacing (cM)      22.2        22.1
Maximum length of linkage
  group (cM)                    367.2       419.5
Observed genome length (cM)     689.1       663
Estimated genome length of     2675.7      4025.5
  P. vannamei (cM) (d)

(a) Using CRIMAP software at LOD score of 3.0 and 5.0.

(b) Different markers within LGs from the analysis
using LOD score of 3.0.

(c) All 22 are in LG4.

(d) Calculated according to Chakravarti et al. (1991).
COPYRIGHT 2007 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Park, Se Won; Xu, Zhenkang; Delaney, Martha; Zuniga, Gla
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:1USA
Date:Dec 1, 2007
Words:15372
Previous Article:Characterization and mapping of expressed sequence tags isolated from a subtracted cDNA library of Litopenaeus vannamei injected with white spot...
Next Article:The Olympia oyster, Ostrea lurida Carpenter 1864 along the west coast of North America.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |