Printer Friendly

Short Communication - MIR-378 INDUCES APOPTSIS OF GRANULOSA CELLS DURING FOLLICLE DEVELOPMENT IN CATTLE.

Byline: T. H. Ma, L. Cheng, B. Wang, Y. X. Shi, G. H. Liu, D. M. Lin and B. Liu

ABSTRACT

MicroRNAs (miRNAs) are small endogenous molecules that are involved in diverse cellular processes. However, little is known about the function of miRNAs in bovine ovary development. Previous study in our lab indicated miR-378 is an apoptosis-associated miRNA that participates in the regulation of bovine corpus luteum development. In addition, whether miR-378 regulates the apoptosis of bovine granulosa cells (bGCs) remains undetermined. Accordingly, this study evaluated the expression of miR-378 in granulosa cells (GCs) of dominant and subordinate follicles and analyzed the apoptosis rates of miR-378 mimics and mimics NC-transfected GCs by flow cytometry method. Results revealed that miR-378 was significantly expressed in the subordinate follicles compared with the dominant follicles, and the apoptosis rate and cleaved caspase-3, a hallmark of apoptosis, increased in the miR-378 mimics-transfected GCs in vitro.

This study is the first to report that apoptotic miR-378 plays a regulatory role in bGCs, which will help to find a new way in the research of follicular atresia.

Keywords: miR-378; cattle; granulosa cell; follicle; ovary.

INTRODUCTION

Follicle development in cattle undergoes two or three follicular waves during each estrous cycle, which includes growing follicle recruitment, selection and growth of leading follicles, ovulation of the preovulatory dominant follicle, and degeneration of anovulatory subordinate follicles (Fortune, Sirois, Turzillo, and Lavoir, 1991). During the common growth within a wave, the largest follicle grows as a dominant follicle and becomes ovulatory, whereas all other follicles (subordinate) cease development and undergo atresia. Apoptosis is a major mechanism in the physiological processes of follicular atresia(Hernandez-Coronado et al., 2015; Portela et al., 2015; Yang, Xu, Zhao, and Li, 2012), which is controlled spatio-temporally at the transcriptional level; however, the mechanism of apoptosis at the post-transcriptional level is poorly understood.

miRNAs are a class of small non-coding endogenous RNA molecules (-22 nt in length) that function at the post-transcriptional level and regulate gene expression in a sequence-dependent manner(Ambros, 2001; Bartel, 2004). miRNAs regulate organism development, cellular differentiation and proliferation, and cell apoptosis and death (Andreas et al., 2016; Pan, Toms, Shen, and Li, 2015; Xu, Linher-Melville, Yang, Wu, and Li, 2011).

In cattle, batches of miRNAs are present in the ovary (Hossain et al., 2009), and miRNAs demonstrate spatio-temporal expression in oocytes, granulosa cells (GCs), cumulus cells, and preimplantation embryos (Abd El Naby et al., 2013). Numerous miRNAs, such as human miR-93(Jiang et al., 2015), mouse miR-320(Yin et al., 2014) and miR-224(Yao et al., 2014), porcine miR-378(Toms, Xu, Pan, Wu, and Li, 2015), miR-92a (da Silveira, Carnevale, Winger, and Bouma, 2014) and miR-34a(Tu et al., 2014), have been associated with the apoptosis of GCs.

miRNA transcriptome analysis has been used to identify numerous miRNAs (e.g., GC miRNA) that are differentially expressed during the development of dominant or subordinate bovine follicles (Gebremedhn et al., 2015; Sontakke, Mohammed, McNeilly, and Donadeu, 2014). However, little is known about the specific functions of miRNAs in bovine granulosa cells (bGCs).

Our previous study proved that miR-378 serves an important function in the corpus luteum development of bovines(Ma et al., 2011), However, whether miR-378 also regulates follicle development remains unknown. Thus, the present study explored the expression of miR-378 in dominant and subordinate follicles, and identified whether miR-378 can induce the apoptosis of bGCs.

MATERIALS AND METHODS

GC and CL collection: Simmental heifers were around 18-month old and 450kg. PGF2[alpha] was used to synchronize estrous cycle. Ovaries were obtained from estrous synchronized Simmental heifers and collected by cutting the vaginas. Follicles were isolated from the ovary by blunt dissection using scissors and forceps. The size of each follicle was measured using a caliper, and each follicle was classified as dominant or subordinate depending on the diameter as previously recommended with minor modifications(Ireland, Murphee, and Coulson, 1980). Follicles a$?11 and [greater than or equal to]12 mm in diameter were classified as subordinate and dominant, respectively (Spicer et al., 2011). The oocytes were removed using a mouth-operated micropipette under a microscope, and the GCs were stored at -80 AdegC.

RNA extraction and RT-PCR: Total RNA was extracted from the GCs of bovine dominant and subordinate follicles using the mirVana(tm) miRNA Isolation Kit (Ambion). First-strand cDNA was synthesized by the ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan) in accordance with the manufacturer's protocols. Relative quantification of miR-378 was performed using SYBRA(r) Green Real-time PCR Master Mix (Toyobo: QPK-201) as the standard protocol. U6 small nuclear RNA served as endogenous control. The primers of miRNA-specific RT and Real-time PCR were designated as primer 5 (Table 1).

Table 1. RT-PCR and Real-time PCR primers for miR-378 and U6 detection.

###Annealing###Product

Primer###Sequence (10 pmol/uL)

###Temp (AdegC)###Size (bp)

###RT: 5'-

###GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGA

miR-378###CAGTGTG-3'###59###66

###F: 5'-GGGGTTTGGCAATGGTAGAACT-3'

###R: 5'-GGGGTATGGCACTGGTAGAAT-3'

###F: 5'-GCTTCGGCAGCACATATACTAAAAT-3'

U6###59###89

###R(RT): 5'-CGCTTCACGAATTTGCGTGTCAT-3'

All the bGCs was cultrued in DMEM medium with 10% (V/V) Fetal Bovine Serum in 37 AdegC and 5% CO2 incubator. The cell was passaged when the confluency reach 90%. All the cells in this reserch was within 5 passages. One day before transfection, 0.5-2x105GCs were plated in 12-well culture plate, When the cells reached around 50% confluency, 100uM miR-378 mimics or control from RiboBio (Guangzhou, China) was transfected to bGCs strictly following the Lipofectamine 2000 protocol.After 48 h, the cells were enzymatically digested and washed with PBS. Then, the cells were measured through AnnexinV-FITC/PI double staining using the Annexin V-FITC Apoptosis Detection Kit (BD Biosciences Pharmingen) in accordance with the manufacturer's instructions. Results were analyzed using cell flow cytometry.

Activity assay of activated caspase-3 of GCs

The transfection of miR-378 mimics or control to the GCs is the same as above. After 48 h, the cells were analyzed using the Caspase 3 Activity Assay Kit (Beyotime, China).

Statistical analysis: All experiments for miR-378 or the control were conducted in triplicates. All data are presented as means +- SE, and statistical evaluation of the data was conducted with SPSS 14.0. Statistical analysis was performed with the independent-sample Student's t-test to compare the two groups. Differences at P < 0.05 were considered statistically significant.

RESULTS

Expression analysis of miR-378 in GCs: The expression of miR-378 in the bGCs of dominant and subordinate follicles was detected by real-time RT PCR (Figure 1). miR-378 was significantly upregulated in the subordinate follicles than in the dominant follicles (P < 0.01). Results demonstrated that miR-378 may be involved in the apoptosis of bovine ovarian follicles.

Effects of miR-378 on GC apoptosis: GCs can decide whether the follicles grow further or undergo apoptosis (Matsuda, Inoue, Manabe, and Ohkura, 2012). To test the potential role of miR-378 in GC apoptosis in the bovine follicles, the isolated bGCs were incubated in vitro and transiently transfected with miR-378 mimics. The apoptotic rate was estimated by Annexin V-FITC/PI double staining. Results indicated that miR-378 mimics remarkably increased the apoptosis rate of bGCs compared with the control (P < 0.01, Figure 2), suggesting that miR-378 induced apoptosisin bGCsin vitro. The activated caspase-3 was also estimated by ELISA, and the caspase-3 activity of the GCs was higher in the miR-378 mimics-transfected group than in the control group (P < 0.05, Figure 3).

DISCUSSION

In the present study, the effect of miR-378 on the regulation of bGC apoptosis was investigated.The expression level of miR-378 significantly increased in the subordinate follicle GCs than in the dominants. Flow cytometry was used to evaluate the in vitro effect of miR-378 on the apoptosis of bovine ovarian GCs. Results indicated that the upregulation of miR-378 in bGCs in vitro increased the rate of apoptosis in bGCs, suggesting that miR-378 may induce the apoptosis of bGCs.

miRNAs post-transcriptionally mediate ovary gene expression in farm animals (Gebremedhn et al., 2015). Using Illumina miRNA deep sequencing, Gebremedhn et al. identified 30 miRNAs (e.g., miR-378) that are abundantly expressed in the bGCs of dominant follicles (Gebremedhn et al., 2015), which agrees with the present results. These findings indicate that numerous miRNAs play crucial roles in the regulation of folliculogenesis.In cultured primary porcine GCs, miR-378 overexpression significantly decreased the protein and mRNA levels of PGR. This observation is the first evidence showing that miR-378 functions in porcine ovary and post-transcriptionally regulates the gene expression of progesterone receptor (Toms et al., 2015). In pigs, miR-378 knockdown increased cumulus expansion and oocyte progression to MII and suppressed aromatase (CYP19A1) expression in cumulus cells.

Estradiol can reverse the function of miR-378, indicating that this miRNA may decrease estradiol production by suppressing the gene expression of aromatase to regulate the maturation of cumulus-oocyte complexes (Pan et al., 2015; Xu et al., 2011). Using the TargetScan online tool (www.targetscan.org), 185 transcripts with conserved sites, containing a total of 187 conserved sites and 85 poorly conserved sites were predicted the target gene of miR-378. Within these genes, miR-378 may interact with apoptosis-related gene, like bone morphogenetic protein 2 (BMP2)(Liu et al., 2013), to regulate the cell fate of bGCs. Thus, the target of miR-378 must be identified to explore in depth the functions of miR-378.

In conclusion, miR-378 can induce the apoptosis of bovine ovarian GCs. This study provided insights into the molecular mechanisms of apoptotic miR-378-mediated follicular development.

Acknowledgments: This study was supported by Natural Science Foundation of Hebei province (Grant No. C2016402061), Youth Foundation of Hebei Education Department (Grant No.QN2015012) and Doctoral Scientific Research Foundation, Hebei University of Engineering (Grant No.20120139).

REFERENCES

Abd El Naby, W. S., Hagos, T. H., Hossain, M. M., Salilew-Wondim, D., Gad, A. Y., Rings, F., Cinar, M. U., Tholen, E., Looft, C., Schellander, K., Hoelker, M., and D. Tesfaye (2013). Expression analysis of regulatory microRNAs in bovine cumulus oocyte complex and preimplantation embryos. Zygote. 21(1): 31-51.

Ambros, V. (2001). microRNAs: tiny regulators with great potential. Cell. 107(7): 823-26.

Andreas, E., Hoelker, M., Neuhoff, C., Tholen, E., Schellander, K., Tesfaye, D., and D. Salilew-Wondim (2016). MicroRNA 17-92 cluster regulates proliferation and differentiation of bovine granulosa cells by targeting PTEN and BMPR2 genes. Cell Tissue Res. 366(1): 219-30.

Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116(2): 281-97.

Da Silveira, J. C., Carnevale, E. M., Winger, Q. A., and G. J. Bouma (2014). Regulation of ACVR1 and ID2 by cell-secreted exosomes during follicle maturation in the mare. ReprodBiolEndocrinol. 12: 44.

Fortune, J. E., Sirois, J., Turzillo, A. M., and M. Lavoir (1991). Follicle selection in domestic ruminants. J ReprodFertil Suppl. 43: 187-98.

Gebremedhn, S., Salilew-Wondim, D., Ahmad, I., Sahadevan, S., Hossain, M. M., Hoelker, M., Rings, F., Neuhoff, C., Tholen, E., Looft, C., Schellander, K., and D. Tesfaye (2015). MicroRNA Expression Profile in Bovine Granulosa Cells of Preovulatory Dominant and Subordinate Follicles during the Late Follicular Phase of the Estrous Cycle. PLoS One. 10(5): e0125912.

Hernandez-Coronado, C. G., Guzman, A., Espinosa-Cervantes, R., Romano, M. C., Verde-Calvo, J. R., and A. M. Rosales-Torres (2015). Sphingosine-1-phosphate and ceramide are associated with health and atresia of bovine ovarian antral follicles. Animal. 9(2): 308-12.

Hossain, M. M., Ghanem, N., Hoelker, M., Rings, F., Phatsara, C., Tholen, E., Schellander, K., and D. Tesfaye (2009). Identification and characterization of miRNAs expressed in the bovine ovary. BMC Genomics. 10: 443.

Ireland, J. J., Murphee, R. L., and P. B. Coulson (1980). Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. J Dairy Sci. 63(1): 155-60.

Jiang, L., Huang, J., Li, L., Chen, Y., Chen, X., Zhao, X., and D. Yang (2015). MicroRNA-93 promotes ovarian granulosa cells proliferation through targeting CDKN1A in polycystic ovarian syndrome. J ClinEndocrinolMetab. 100(5): E729-38.

Liu, Z., Castrillon, D.H., Zhou, W., and J.S. Richards (2013). FOXO1/3 depletion in granulosa cells alters follicle growth, death and regulation of pituitary FSH. MolEndocrinol. 27(2): 238-52.

Ma, T., Jiang, H., Gao, Y., Zhao, Y., Dai, L., Xiong, Q., Xu, Y., Zhao, Z., and J. Zhang (2011). Microarray analysis of differentially expressed microRNAs in non-regressed and regressed bovine corpus luteum tissue; microRNA-378 may suppress luteal cell apoptosis by targeting the interferon gamma receptor 1 gene. J Appl Genet. 52(4): 481-86.

Matsuda, F., Inoue, N., Manabe, N., and S. Ohkura (2012). Follicular growth and atresia in mammalian ovaries: regulation by survival and death of granulosa cells. J Reprod Dev. 58(1): 44-50.

Pan, B., Toms, D., Shen, W., and J. Li (2015). MicroRNA-378 regulates oocyte maturation via the suppression of aromatase in porcine cumulus cells. Am J PhysiolEndocrinolMetab. 308(6): E525-34.

Portela, V. M., Dirandeh, E., Guerrero-Netro, H. M., Zamberlam, G., Barreta, M. H., Goetten, A. F., and C. A. Price (2015). The role of fibroblast growth factor-18 in follicular atresia in cattle. BiolReprod. 92(1): 14.

Sontakke, S. D., Mohammed, B. T., McNeilly, A. S., and F. X. Donadeu (2014). Characterization of microRNAs differentially expressed during bovine follicle development. Reproduction. 148(3): 271-83.

Spicer, L. J., Schreiber, N. B., Lagaly, D. V., Aad, P. Y., Douthit, L. B., and J. A. Grado-Ahuir (2011). Effect of resistin on granulosa and theca cell function in cattle. AnimReprod Sci. 124(1-2): 19-27.

Toms, D., Xu, S., Pan, B., Wu, D., and J. Li (2015). Progesterone receptor expression in granulosa cells is suppressed by microRNA-378-3p. Mol Cell Endocrinol. 399: 95-102.

Tu, F., Pan, Z. X., Yao, Y., Liu, H. L., Liu, S. R., Xie, Z., and Q. F. Li (2014). miR-34a targets the inhibin beta B gene, promoting granulosa cell apoptosis in the porcine ovary. Genet Mol Res. 13(2): 2504-12.

Xu, S., Linher-Melville, K., Yang, B. B., Wu, D., and J. Li (2011). Micro-RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase. Endocrinology. 152(10): 3941-51.

Yang, R., Xu, S., Zhao, Z., and J. Li (2012). Fas ligand expression and mediated activation of an apoptosis program in bovine follicular granulosa cells. Gene. 493(1): 148-54.

Yao, G., Liang, M., Liang, N., Yin, M., Lu, M., Lian, J., Wang, Y., and F. Sun (2014). MicroRNA-224 is involved in the regulation of mouse cumulus expansion by targeting Ptx3. Mol Cell Endocrinol. 382(1): 244-53.

Yin, M., Wang, X., Yao, G., Lu, M., Liang, M., Sun, Y., and F. Sun (2014). Transactivation of micrornA-320 by microRNA-383 regulates granulosa cell functions by targeting E2F1 and SF-1 proteins. J Biol Chem. 289(26): 18239-57.
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Article Type:Report
Date:Oct 31, 2017
Words:2563
Previous Article:Short Communication - CYTOTOXIC, ANTIOXIDANT, ANTIMICROBIAL ACTIVITIES OF METHONOL CRUDE EXTRACTS OF CARDIA OBALIQUA (LINN.).
Next Article:EFFECT OF DIETS WITH HIGH METHIONINE LEVELS ON GROWTH PERFORMANCE, HEALTH STATUS, NUTRIENT DIGESTIBILITY AND NITROGEN RETENTION IN ARCTIC FOXES.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters