Printer Friendly

Short Communication - Characterization of 22 New Polymorphic Microsatellite Loci from the Endangered Buff-Throated Partridge (Tetraophasis szechenyii) by using Next-Generation Sequencing.

Byline: Qin Liu, Feiwei Liu, Xiuyue Zhang, Nan Yang and Jianghong Ran

ABSTRACT

The buff-throated partridge (Tetraophasis szechenyii) is an endemic species which is protected in first-grade state in China. Here, 22 polymorphic tetranucleotide microsatellite markers were isolated from T. szechenyii using a next-generation sequencing technology. The allele number of these loci ranged from two to six in genotyped 35 individuals. Polymorphism information content ranged from 0.2735 to 0.7717 with an average of 0.5149. Observed and expected heterozygosities at each locus ranged from 0 to 0.879 and 0.332 to 0.814, respectively. These markers could be used to better understand the breeding system and protection manage of this species.

Key words

Tetraophasis szechenyii, Tetranucleotide microsatellite, DNA molecular markers, Polymorphism, Next-generation sequencing.

The buff-throated partridge (Tetraophasis szechenyii) is an endemic species in China, which belongs to the family Phasianidae in the Galliformes (Johnsgard, 1988). The species occurs in a narrow zone of Southeast Tibet, South Qinghai, West Sichuan and Northwest Yunnan, and inhabits mainly in mixed coniferous forests, rhododendron shrubs, oak thickets, alpine meadows and rocky ravines at 3350-4600m ASL (Mackinnon et al., 2000). Due to poaching, the habitat destruction or fragmentation as a result of deforestation, the number of its stocks is rapidly decreasing, and it has been considered to be endangered in the Red Book of China and has been classified as a national first-grade protected animal in China. From 2006-2008, we found an interesting cooperative breeding in a wild population of T. szechenyii (Xu et al., 2011; Wang et al., 2017), which is rare in the Galliformes (Cockburn, 2006).

However, the behavioral field data did not allow any conclusions regarding the reproductive contributions of differently ranked males. Therefore, investigations on the kinship and breeding system in buff-throated partridge using molecular data are necessary, and it would provide useful information for conservation management of this endangered species.

As co-dominant molecular marker, microsatellites were powerful tools for genetic identification, parentage and kinship analysis (Christiakov et al., 2006; Henry et al., 2013). Previously, dozens of microsatellite loci were identified and characterized by using cross-amplification and traditional enrichment method (Zhou et al., 2009; Wu et al., 2010; Yan et al., 2011). However, most of these loci were dinucleotide. Compared to tri- and tetra-nucleotide, dinucleotide has been generally to display a high level of stutter bands, which easily and frequently cause scoring errors if the two alleles are closely spaced (Perlin et al., 1995). More, our previous preliminary parentage analysis based on dinucleotide loci indicated that different dinucleotide loci may result in different results. Here, we first report 22 tetranucleotide microsatellite DNA markers isolated for T. szechenyii using the GS Junior (Roche) next-generation sequencer, it would be a great benefit to understand breeding system of this species.

Materials and methods

Blood samples of buff-throated partridge were collected from 35 individuals in a wild population at Pualing Mountain, Yajiang County, Western China, and genomic DNA was extracted using E.Z.N.A. Tissue DNA Kits (Omega, USA). We constructed a shotgun genomic library using ~5ug of genomic from a single individual, which was sequenced using 454 Life Sciences Genome Sequencer FLX Titanium instrument (Roche Applied Science) at Shanghai Majorbio Biopharm Technology Co., Ltd. Over 185,734 unique reads with an average length of 447.7 bp were generated after quality filtering. We screened the high-throughput sequencing data to locate tetra-nucleotide microsatellite loci with at least seven perfect repeats by software MSDB2.4.2 (Du et al., 2013) and the primers were designed using the online software PRIMER.

The PCR reaction mixture had a final volume of 25 uL, which contained 1 uL DNA (50ng/uL), 2.5 uL 10*PCR buffer (plus Mg2+), 1 uL dNTPs (10 mmol/L each), 0.5 uL for each primer (10 uLmol/L), 0.5U rTaq DNA polymerase (Takara, Japan), and 18.7 uL ddH2O. The amplification profiles include an initial denaturation at 95AdegC for 5 min, followed by 35 cycles 30s at 94AdegC, 45s at 59-65.7AdegC, 30s at 72AdegC, and a final extension for 10 min at 72AdegC (Table I). The PCR product size were measured using the ABI PRISM 377 Genetic Analyzer (Applied Biosystems) according each forward primer labeled with fluorescent dyes (FAM, TAMRA or HEX). Polymorphism information, observed and expected heterozygosities were calculated using CERVUS 3.0.3 software (Kalinowski et al., 2007).

TABLE I.- Primer sequences and characteristics of 22 tetranucleotide microsatellite loci isolated in Tetraophasis

Locus/###Primer sequence (5'-3')###Repeat###Tm###N###NA###Size###Ho###He###PIC###PHWE

Accession No.###motif###(AdegC)###(bp)

TSZ-4/###F: GGAACTGGTGGATGCAGTTG###(TTAT)9 59.0 34###3###285-293 0.3824 0.5263 0.4642###0.019

KU236435###R: ACCACACTTAGGGTAACTGGA

TSZ-5/###F: GACAGACTGGGCAGAGATGT###(GGAT)8 61.5 33###5###197-217 0.8788 0.7422 0.6905###0.030

KU236436###R: GGAGCCACGAAGAAAAGCAA

TSZ-6/###F: CTGTCCTGGTTCTGTCCCAT###(GTTT)8 62.0 33###5###174-214 0.3939 0.6541 0.5820###0.011

KU236437###R: TGATGCTCATTTTGACTTTGGGA

TSZ-7/###F: AGCCTAGCCTGTTCAACCAT###(CAAA)8 61.5 34###2###260-264 0.0000 0.3319 0.2735###0

KU236438###R: TGATCATCTTCCAGCCAGCA###(<0.001)

TSZ-8/###F: AGTGACCTGGTGATGGATGG###(CATC)8 61.5 34###6###245-265 0.8529 0.8139 0.7717###0.329

KU236439###R: GGAGTTGTGACACTGAGGGA

TSZ-9/###F: GCTGGCTTTTACGTCACTGG###(CTAT)8 59.0 34###5###172-216 0.2941 0.4175 0.3817###0.089

KU236440###R: GCTGGAGGAGAGGCATATGT

TSZ-10/###F: ACAGCAATTCCAGCCTGTTG###(AAAC)10 64.0 34###5###228-260 0.4412 0.6870 0.6264###0.025

KU236441###R: CGCTTATGAGACCAGTTGCC

TSZ-11/###F: CTGTCCTGGTTCTGTCCCAT###(GTTT)8 59.0 34###3###337-343 0.2647 0.4614 0.4068###0.010

KU236442###R: GACTTGGAAGAGGGAAATGCA

TSZ-14/###F: ACAGGGCAGCTATTGTGTTG###(ATCT)10 60.5 33###5###282-298 0.6667 0.7110 0.6611###0.104

KU236443###R: CACTCTCACAAATGCTGCCA

TSZ-17/###F: GTCCAAGCTCTCCCACTGAT###(CAAA)8 64.0 34###3###150-162 0.7941 0.5088 0.3895###0.0002

KU236444###R: TCTGGGTCGGTAATGCTGTT###(<0.001)

TSZ-19/###F: AAACCTTCCCTGTCTCCCTC###(CAAA)9 62.0 32###6###231-253 0.4688 0.6141 0.5730###0.002

KU236445###R: AGCATGTCCTCTAGTGGCAA

TSZ-20/###F: GCCATTGGTTAGGCTTCAGG###(CAAA)8 64.0 34###2###266-270 0.6765 0.4965 0.3695###0.033

KU236446###R: TCTGGGTCGGTAATGCTGTT

TSZ-22/###F: GCTGTGAGTGTGAACTGTGG###(AAGG)17 60.5 33###6###245-279 0.4242 0.7828 0.7392###0

KU236447###R: TCAGTTCAGCACATAACTCTGT###(<0.001)

SCZ-2/###F: TTCGTGATTGCCTCCTATCC###(AAAT)12 62.5 34###6###200-224 0.7353 0.7243 0.6772###0.268

KU236448###R: CTCTGTGCCATTCATGGAAAT

SCZ-4/###F: TGTTCTACAAATCCCTCTGTACCA###(AAAT)11 62.7 34###3###224-232 0.4412 0.5404 0.4760###0.037

KU236449###R: ATAAGCCCGCCTCCTAAAAA

SCZ-6/###F: CAGGGCAGCTATTGTGTTGA###(TATC)10 63.0 34###5###182-198 0.7059 0.7221 0.6738###0.291

KU236450###R: CTCAGGTATGGGCTTAACAGG

SCZ-9/###F: CCCAGGGACTGTTTCTTCAG###(TTAT)8 63.7 34###4###224-236 0.4706 0.5588 0.4965###0.036

KU236451###R: TGACAACAAACCACACTTAGGG

SCZ-10/###F: ATTCAGAGCCAGGTTTGCTG###(TTAT)8 62.0 34###6###200-224 0.5000 0.6062 0.5320###0.201

KU236452###R: CTTTGGAACTGAAACCCAGAA

SCZ-13/###F: TGAGTGGAAACAGGAAAACAGA###(TTTA)9 65.7 34###3###250-258 0.5000 0.4649 0.4136###0.194

KU236453###R: CCAGTTTGGCAAGCAATAGG

SCZ-18/###F: TTGAAATCTTTACCCTCCCTGA###(AAAC)6 63.5 34###3###145-161 0.3235 0.3376 0.2862###0.409

KU236454###R: GTGGCAGAAAGGTTGGAAAG

SCZ-22/###F: TCCTCTGCCCTGTTTTGCTA###(AATA)7 64.9 34###2###214-218 0.4118 0.3652 0.2951###0.411

KU236455###R: TTGACCAGGATGACTTTGGA

SCZ-24/###F: GCACAACGTGGACTTTCTCA###(ATTT)7 65.5 34###5###266-286 0.6176 0.5944 0.5471###0.648

KU236456###R: GCATCTGCCTTGCACTGAAT

Results and discussion

The 22 loci were subsequently used to screen all of 35 individuals. Using CERVUS 3.0.3 software to analysis, the number of allele in each locus ranged from two to six. The observed and expected heterozygosities (Ho and He) varied from 0 to 0.879 and 0.332 to 0.814, respectively; the PIC values ranged from 0.2735 to 0.7717 with an average of 0.5149 (Table I). Deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were tested using GENEPOP 3.3 (Raymond and Rousset, 1995) and the presence of null alleles was assessed at a 95% confidence interval using MICRO-CHECKER 2.2.3 (Oosterbout et al., 2004). Three of the loci (TSZ-7, TSZ-17 and TSZ-22) showed significant deviation from HWE (P<0.001), suggesting the possibility of null alleles, non-random mating or Wahlund effect. There was no evidence of significant LD for all pairs of loci (P<0.005).

The combined first-parent non-exclusion probability for the 22 markers was 0.00701993, and the second-parent non-exclusion probability was 0.00006956, as calculated by CERVUS 3.0.3 (Kalinowski et al., 2007).

The microsatellite markers described here will be useful for conservation genetic studies of the buff-throat partridge, such as evaluating the genetic diversity, exploring population structure, and understanding the breeding system of the species.

Acknowledgements

This research was financially supported by the National Natural Science Foundation of China (No. 31172105), the National Sci-Tech Support Plan Project (No. 2011BAZ03186).

Statement of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this article

References

Christiakov, D.A., Hellemans, B. and Volckaert, F.A.M., 2006. Aquaculture., 255: 1-29. https://doi.org/10.1016/j.aquaculture.2005.11.031

Cockburn, A., 2006. Proc. R Soc. B-Biol., 273: 1375-1383.

Du, L.M., Li, Y.Z., Zhang, X.Y. and Yue, B.S., 2013. J. Hered., 104: 154-157. https://doi.org/10.1093/jhered/ess082

Henry, I., Antoniazza, S., Dubey, S., Simon, C., Waldvogel, C., Burri, R. and Roulin, A., 2013. PLoS One, 8: e80112. https://doi.org/10.1371/journal.pone.0080112

Johnsgard, P.A., 1988. The quails, partridges, and francolines of the world. Oxfor University Press, New York, USA.

Kalinowski, S.T., Taper, M.L. and Marshall, T.C., 2007. Mol. Ecol., 16: 1099-1106. https://doi.org/10.1111/j.1365-294X.2007.03089.x

Mackinnon, J.R., Phillipps, K. and He, F.Q., 2000. A field guide to the birds of China. Oxford University Press, New York, USA.

Oosterhout, C.V., Hutchinson, W.F., Wills, D.P.M. and Shipley, P., 2004. Mol. Ecol. Notes, 4: 535-538. https://doi.org/10.1111/j.1471-8286.2004.00684.x

Perlin, M.W., Lancia, G. and Ng, S.K., 1995. Am. J. Hum. Genet., 57: 1199-1210.

Raymond, M. and Rousset, F., 1995. J. Hered., 86: 248-249. https://doi.org/10.1093/oxfordjournals.jhered.a111573

Wang, B., Zhang, B., Yang, N., Dou, L. and Ran, J.H., 2017. Pakistan J. Zool., 49: 573-579. http://dx.doi.org/10.17582/journal.pjz/2017.49.2.573.579

Wu, A.L., Zhang, X.Y., Yang, N., Ran, J.H., Yue, B.S. and Li, J., 2010. Conserv. Genet. Resour., 2: 85-87 https://doi.org/10.1007/s12686-010-9187-4.

Xu, Y., Yang, N., Zhang, K., Yue, B.S. and Ran, J.H., 2011. J. Ornithol., 152: 695-700. https://doi.org/10.1007/s10336-011-0651-z

Yan, M., Zhang, X., Yang, N., Xu, Y., Yue, B. and Ran, J., 2011. Russ. J. Genet., 47: 201-204. https://doi.org/10.1134/S1022795410081022

Zhou, X., Xu, Y., Ran, J.H., Yue, B.S., Cao, L.S. and Li, J., 2009. Eur. J. Wildl. Res., 55: 81-83. https://doi.org/10.1007/s10344-008-0217-4
COPYRIGHT 2018 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Liu, Qin; Liu, Feiwei; Zhang, Xiuyue; Yang, Nan; Ran, Jianghong
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9CHIN
Date:Apr 30, 2018
Words:2039
Previous Article:Short Communication - Microsatellite Loci Identified by Cross-Species Amplifications in the Globally Vulnerable Relict Gull, Larus relictus.
Next Article:A Comparative Study of Inhibitory Properties of Saponins (derived from Azadirachta indica) for Acetylcholinesterase of Tribolium castaneum and Apis...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters