Printer Friendly

Sequence analysis of CYP21A1P in a German population to aid in the molecular biological diagnosis of congenital adrenal hyperplasia.

Congenital adrenal hyperplasia is one of the most common autosomal recessive diseases causing adrenal insufficiency. About 95% of cases are caused by deficiency in 21-hydroxylase, a cytochrome P450 enzyme encoded by the CYP21A2 [3] (cytochrome P450, family 21, subfamily A, polypeptide 2) gene (MIM 201910; GeneID, 1589) (1, 2). The CYP21A2 gene is located in the HLA gene-encoding regions on the short arm of chromosome 6 (6p21.3) and is approximately 3.2 kb in length (3). 21-Hydroxylase is responsible for the efficient production of 2 vital adrenal steroid hormones, cortisol and aldosterone. Deficient production of these hormones causes disruption of hormonal balance. Deficiency of 21-hydroxylase prevents the conversion of 17-hydroxyprogesterone to 11-deoxycorticosterone, leading to excessive production of androgens, which ultimately affects several stages of growth and development (4).

A pseudogene [CYP21A1P (cytochrome P450, family 21, subfamilyA, polypeptide 1 pseudogene; GeneID, 1590] occurs about 30 kb upstream of CYP21A2. Inactivating mutations prevent it from producing an active enzyme. In humans, these 2 genes are located very close to the 3' end of the 2 genes encoding the fourth component of serum complement, C4A [complement component 4A (Rodgers blood group)] and C4B [complement component 4B (Chido blood group)]. The homology between CYP21A2 and CYP21A1P is up to 98% in exons and 96% in introns (5). CYP21A2 and CYP21A1P interact in 2 ways to produce 21-hydroxylase deficiency: unequal crossing-over during meiosis, which causes complete deletion ofC4B and produces a fusion gene with a 5' end similar to CYP21A1P and a 3' end similar to CYP21A2 (known as the "30-kb deletion"), and gene-conversion events during mitosis that transfer CYP21A1P inactivating mutations to CYP21A2 (6).

Investigators have developed a large number of methods that can detect mutations and single-nucleotide polymorphisms in CYP21A2, such as the amplification-created restriction site approach (7), multiplex minisequencing (8), and direct gene sequencing (9, 10). In addition, functional and expression studies have been used in vitro assays to search for novel mutations (11-14). The identification of large chromosomal rearrangements and gene dosage analyses have mostly been performed with Southern blot techniques (15-17), quantitative real-time PCR methods (18-20), and, recently, multiplex ligation-dependent probe amplification (MLPA) (21).

The very high homology between CYP21A2 and CYP21A1P is the biggest source of risk in both CYP21A2 mutation screening and quantification experiments. To overcome this complication requires that gene variants and their frequencies be known for both CYP21A1P and CYP21A2. With this requirement in mind, we analyzed both the active and inactive genes from unrelated 200 individuals in the study, including 198 bp upstream of the 5' promoter region and 441 bp downstream of the 3' end.

Materials and Methods

BLOOD SAMPLES

We used 200 anonymized and unrelated blood samples from individuals of the German population (not necessarily of German ethnicity). Following doctor referral, all individuals agreed to a genetic test for CYP21A2 at the Bioglobe molecular genetics laboratory. Genomic DNA was isolated from blood samples with the QIAmp DNA Mini Kit (Qiagen) according to the manufacturer's manual.

CYP21A2 AND CYP21A1P AMPLIFICATION

We used long-range PCR for separate and specific amplification of CYP21A2 and CYP21A1P. For this purpose, we designed gene-specific forward primers. Because the 3' ends of the 2 genes are subject to mutation, we implemented a reverse primer mix (Table 1). This strategy also ensured the amplification of possible hybrid genes. We increased PCR specificity by modifying the last 5 bases of the 3' end with thiophosphate bonds, which prevent miscorrection by the proofreading activity of the DNA polymerase. All oligonucleotides were obtained from Metabion. The 50-[micro]L PCR mix consisted of the buffer provided in the Platinum Taq DNA Polymerase High Fidelity kit (1X final concentration; Invitrogen), 0.2 mmol/L of each deoxynucleoside triphosphate (Roche Diagnostics), 0.75 [micro]mol/L of one of the forward primers (Cyp21A2_Fs or Cyp21A1P_Fs), 0.5 [micro]mol/L each of both reverse primers (Cyp21A2_Rs and Cyp21A1P_Rs), 2 mmol/L MgS[O.sub.4] (Invitrogen), 0.5 [micro]L DMSO (Merck), 0.75 U Platinum Taq DNA Polymerase High Fidelity (Invitrogen), 0.8 g/L BSA (New England Biolabs), and 2.5 [micro]L genomic DNA (approximately 100 ng). The PCR thermocycling program was 2 min at 94 [degrees]C; 35 cycles of 35 s at 94 [degrees]C, 45 s at 62 [degrees]C, and 4 min at 68 [degrees]C; and 10 min at 68 [degrees]C. PCR yield was analyzed visually on a 10 g/L agarose gel.

PCR PURIFICATION AND BigDye[TM] TERMINATION CYCLING

The product of the long-range PCR was purified with the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's manual. We used 2 [micro]L of the purified product as template in BigDye termination cycle sequencing reaction in a 15-[micro]L total volume. Universal primers for CYP21A2 and CYP21A1P were used in this second cycling step (Table 2). The 15-[micro]L reaction mix contained 5x Sequencing Buffer (Applied Biosystems) (0.5x final concentration), 1.2 [micro]mol/L primer (forward or reverse), 3 [micro]L BigDye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems), and 2 [micro]L purified long-range PCR product. The thermocycling program consisted of an initial denaturation step of 2 min at 96 [degrees]C followed by 35 cycles of 10 s at 96 [degrees]C, 10 s at 53 [degrees]C, and 4 min at 60 [degrees]C. The products of BigDye termination cycling were purified with the illustra Sephadex G-50 Fine DNA Grade (GE Healthcare).

DNA SEQUENCING AND MLPA

Sequence determination was performed on a Mega-BACE 1000 DNA Analysis System (GE Healthcare) under the following conditions: injection voltage, 2 kV; injection time, 75 s; run voltage, 8 kV; run time, 110 min. Data were aligned against the manually curated Ensembl transcript ENST0000448314 from Havana/Vega matching to the Ensembl genebuild ENSG00000198457, and identified variations were documented. The results were analyzed with Sequence Analyzer 4.0 (GE Healthcare) and Sequencher 4.5 (Gene Codes Corporation) software. We used SALSA MLPA Kit P050-B2 CAH (MRC-Holland) for quantitative analysis when necessary. Probe hybridization and MLPA PCR were carried out according to the manufacturer's manual. Results were analyzed with the free software Gene Marker 1.6.

Results

The CYP21A2 and CYP21A1P genes of 200 unrelated individuals were specifically amplified by long-range PCR. The following crosswise primer combinations were used to ensure that possible hybrid genes also were amplified: Cyp21A2_Fs with Cyp21A2_Rs and Cyp21A1P_Rs; Cyp21A1P_Fs with Cyp21A2_Rs and Cyp21A1P_Rs.

MLPA was performed for samples that produced no amplification of CYP21A2 and/or CYP21A1P, and for samples that possessed a hybrid gene. One sample produced no amplification in the long-range PCR of CYP21A2. MLPA in this case produced no signals for CYP21A2-specific probes from exon 1 to exon 8. MLPA analysis of this sample indicated that 2 CYP21A1P copies were present. CYP21A1P amplification produced no products for 18 samples, 16 of which had a complete CYP21A1P deletion; MLPA analysis showed that the remaining 2 samples exhibited deletion of the 5' end of CYP21A1P.

We detected 2 samples possessing a hybrid gene produced by the aforementioned 30-kb deletion. This gene had a CYP21A1P-like 5' end and a CYP21A2like 3' end. In both samples, the breakpoint was in exon 3, between the 8-bp deletion and c.515T>A (p.Ile172Asn). Both samples had 1 CYP21A2 copy in addition to the hybrid gene.

Pseudogene-specific variations, which are known to have accumulated during evolution, were confirmed for all samples in this study. Table 3 lists the CYP21A1P variants with a frequency of 1.0. Complete frequency data are presented in Table 1 in the Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol57/issue3. In addition to conserved genotypes, we detected base changes not previously reported for CYP21A2 or CYP21A1P. Table 4 lists these variants, together with their locations and frequencies.

CYP21A1P had 5 mutation haplotypes in our sample set. Genotypes of 3 positions in 1 case and genotypes of 2 positions in 4 cases were in linkage disequilibrium and formed a haplotype structure. These positions are located as far as 2484 bp apart. Table 5 lists 5 CYP21A1P mutation haplotypes, together with their frequencies and locations. No similar linkage disequilibrium was observed in CYP21A2.

Discussion

We analyzed the CYP21A2 and CYP21A1P genes of 200 individuals to better understand this complicated chromosomal region. Our study has demonstrated that simultaneous CYP21A1P analysis is also necessary for a better quantitative analysis of CYP21A2 analysis and to minimize the potential for false diagnosis.

Depending on the method of gene amplification and the CYP21A1P variants present, one could obtain results that do not reflect the real situation. Sample 84 in our set, for example, had the 8-bp deletion in only one of its CYP21A1P alleles. If we had used the technique of amplification of overlapping fragments, in which the forward primer for the second fragment binds to the 8-bp sequence, the CYP21A1P allele possessing this 8-bp sequence would be amplified along with the CYP21A2 allele. This would, of course, produce the wrong genotype.

In our study, we discovered 5 mutation haplotypes in CYP21A1P with specific genotype patterns but observed no such haplotype formation in CYP21A2. The linkage disequilibria were not exceptional despite the large distances between the bases. The distance between the involved genotypes was 264 bp in the closest linkage disequilibrium and 2484 bp in the farthest. Because we studied the pseudogene, we cannot assess the clinical impact of these mutation groups. It would, however, be worth using computational-modeling approaches to investigate how these mutation haplotypes would alter protein structure and, ultimately, enzyme concentration if they were transferred to CYP21A2 simultaneously.

[FIGURE 1 OMITTED]

Concolino et al. used MLPA and evaluated its performance for CYP21A2 and CYP21A1P quantification (21). Concordantly, we determined that CYP21A1P genotypes interfere with quantitative analysis of CYP21A2 by MLPA to a certain extent. For samples with the wild-type allele in homozygous or heterozygous form at position c.515T>A (p.Ile172Asn) in CYP21A1P, 3 CYP21A2 copies were reported. The frequency of the absence ofp.Ile172Asn in CYP21A1P was 0.036 in our sample set. Without a parallel CYP21A1P analysis, one would falsely infer a heterozygous duplication of CYP21A2 with a risk of 3.6%. Yet another unreliable position is in exon 8, where the gene copy number is determined with the mutation c.952C>T (p.Gln318X) as the ligation site. In our sample set, the frequency of the wild-type allele at this position in CYP21A1P was 0.085. This result indicates that, owing to a lack of CYP21A1P genotype data, one would falsely infer a duplication of the CYP21A2 gene in approximately 8.5% of the cases.

A consensus sequence for CYP21A1P for the German population was developed by calculating allele frequencies for the 200 samples. We recommend that these data be used by researchers who are interested in further investigating the CYP21A1P gene (see Table 2 in the online Data Supplement).

We observed the pseudogene to be more conserved upstream of the breakpoint (between the 8-bp deletion and p.Ile172Asn) until the position where the 30-kb deletion usually occurs. On the other hand, the active gene was more conserved in the sequence downstream of the breakpoint (Fig. 1). This observation is in agreement with the mechanism of chimeric gene formation that has been proposed for this region (5). Because of recombinations during meiosis, a 30-kb segment that encompasses the 3' end of CYP21A1P, all of the adjacent C4B gene, and the 5' end of CYP21A2 can be completely deleted or duplicated. This region, where both genes are not conserved, contains most of the polymorphisms and mutations. For instance, the polymorphism rs6463 (c.289 + 33C>A) is never detected in CYP21A1P; however, its frequency in CYP21A2 is 0.69. The polymorphism rs12525076 (c.648 + 35G>A), on the other hand, is present at a frequency of 0.04 in CYP21A2 and 0.88 in CYP21A1P.

We observed different rates of transfer of the variants between the 2 genes. The introduction of variations can often occur via transfer from one gene to the other, but transfer in the opposite direction seldom occurs or not at all. Throughout our sample, we found genetic transfer between CYP21A2 and CYP21A1P to occur more frequently via previously established directions, e.g., from CYP21A1P to CYP21A2, rather than from CYP21A2 to CYP21A1P. The reason why one direction is preferred over the other remains unknown.

In conclusion, our results show that to have a complete and accurate CYP21A2 analysis, CYP21A1P results, as mentioned above, should be taken into consideration when designing any kind of assay for sequencing, genotyping, and, especially, gene copy number evaluation.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.

Authors' Disclosures or Potential Conflicts of Interest: No authors declared any potential conflicts of interest.

Role of Sponsor: The funding organizations played no role in the design of study, choice of enrolled patients, review and interpretation of data, or preparation or approval of manuscript.

References

(1.) White PC, New MI, Dupont B. Structure of human steroid 21-hydroxylase genes. Proc Natl Acad Sci USA 1986;83:5111-5.

(2.) White PC, Vitek A, Dupont B, New MI. Characterization of frequent deletions causing steroid 21-hydroxylase deficiency. Proc Natl Acad Sci U S A 1988;85:4436-40.

(3.) Rodrigues NR, Dunham I, Yu CY, Carroll MC, Porter RR, Campbell RD. Molecular characterization of the HLA-linked steroid 21-hydroxylase B gene from an individual with congenital adrenal hyperplasia. EMBO J 1987;6:1653-61.

(4.) New MI, Levine LS. Recent advances in 21hydroxylase deficiency. Annu Rev Med 1984;35: 649-63.

(5.) White PC, Speiser PW. Congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Endocr Rev 2000;21:245-91.

(6.) Tusie-Luna MT, White PC. Gene conversions and unequal crossovers between CYP21 (steroid 21hydroxylase gene) and CYP21P involve different mechanisms. Proc Natl Acad Sci USA 1995;92: 10796-800.

(7.) Lee HH, Chao HT, Ng HT, Choo KB. Direct molecular diagnosis of CYP21 mutations in congenital adrenal hyperplasia. J Med Genet 1996;33: 371-5.

(8.) Krone N, Braun A, Weinert S, Peter M, Roscher AA, Partsch CJ, et al. Multiplex minisequencing of the 21-hydroxylase gene as a rapid strategy to confirm congenital adrenal hyperplasia. Clin Chem 2002;48:818-25.

(9.) Kosel S, Burggraf S, Fingerhut R, Dorr HG, Roscher AA, Olgemoller B. Rapid second-tier molecular genetic analysis for congenital adrenal hyperplasia attributable to steroid 21-hydroxylase deficiency. Clin Chem 2005;51:298-304.

(10.) Jeske YW, McGown IN, Harris M, Bowling FG, Choong CS, Cowley DM, et al. 21-hydroxylase genotyping in Australasian patients with congenital adrenal hyperplasia. J Pediatr Endocrinol Metab 2009;22:127-41.

(11.) Soardi FC, Barbaro M, Lau IF, Lemos-Marini SH, Baptista MT, Guerra-Junior G, et al. Inhibition of CYP21A2 enzyme activity caused by novel missense mutations identified in Brazilian and Scandinavian patients. J Clin Endocrinol Metab 2008; 93:2416-20.

(12.) Araujo RS, Mendonca BB, Barbosa AS, Lin CJ, Marcondes JA, Billerbeck AE, et al. Microconversion between CYP21A2 and CYP21A1P promoter regions causes the nonclassical form of 21hydroxylase deficiency. J Clin Endocrinol Metab 2007;92:4028-34.

(13.) Grischuk Y, Rubtsov P, Riepe FG, Grotzinger J, Beljelarskaia S, Prassolov V, et al. Four novel missense mutations in the CYP21A2 gene detected in Russian patients suffering from the classical form of congenital adrenal hyperplasia: identification, functional characterization, and structural analysis. J Clin Endocrinol Metab 2006; 91:4976-80.

(14.) Barbaro M, Lajic S, Baldazzi L, Balsamo A, Pirazzoli P, Cicognani A, et al. Functional analysis of two recurrent amino acid substitutions in the CYP21 gene from Italian patients with congenital adrenal hyperplasia. J Clin Endocrinol Metab 2004;89:2402-7.

(15.) Lobato MN, Aledo R, Meseguer A. High variability of CYP21 gene rearrangements in Spanish patients with classic form of congenital adrenal hyperplasia. Hum Hered 1998;48:216-25.

(16.) Baumgartner-Parzer SM, Nowotny P, Waldhausl W, Vierhapper H. A rare duplicated 21hydroxylase haplotype and a de novo mutation: a family analysis. J Clin Endocrinol Metab 2003;88: 2794-6.

(17.) Concolino P, Mello E, Minucci A, Giardina E, Zuppi C, Toscano V, et al. A new CYP21A1P/ CYP21A2 chimeric gene identified in an Italian woman suffering from classical congenital adrenal hyperplasia form. BMC Med Genet 2009;22: 10:72.

(18.) Parajes S, Quinteiro C, Dommguez F, Loidi L. High frequency of copy number variations and sequence variants at CYP21A2 locus: implication for the genetic diagnosis of 21-hydroxylase deficiency. PloS One 2008;3:e2138.

(19.) Olney RC, Mougey EB, Wang J, Shulman DI, Sylvester JE. Using real-time, quantitative PCR for rapid genotyping of the steroid 21-hydroxylase gene in a north Florida population. J Clin Endocrinol Metab 2002;87:735-41.

(20.) Wu YL, Savelli SL, Yang Y, Zhou B, Rovin BH, Birmingham DJ, et al. Sensitive and specific real-time polymerase chain reaction assays to accurately determine copy number variations (CNVs) of human complement C4A, C4B, C4-long, C4-short, and RCCX modules: elucidation of C4 CNVs in 50 consanguineous subjects with defined HLA genotypes. J Immunol 2007;179:3012-25.

(21.) Concolino P, Mello E, Toscano V, Ameglio F, Zuppi C, Capoluongo E. Multiplex ligation-dependent probe amplification (MLPA) assay for the detection of CYP21A2 gene deletions/duplications in congenital adrenal hyperplasia: first technical report. Clin Chim Acta 2009;402: 164-70.

Cumhur Canturk, [1] Ulrike Baade, [1] Ramona Salazar, [1] Niels Storm, [1] Ralf Portner, [2] and Wolfgang Hoppner [1] *

[1] Bioglobe GmbH, Hamburg, Germany; [2] Department of Bioprocess and Biochemical Engineering, Hamburg University of Technology, Hamburg, Germany.

[3] Human genes: CYP21A2, cytochrome P450, family 21, subfamily A, polypeptide 2; CYP21A1P, cytochrome P450, family 21, subfamily A, polypeptide 1 pseudogene; C4A, complement component 4A (Rodgers blood group); C4B, complement component 4B (Chido blood group).

* Address correspondence to this author at: Bioglobe GmbH, Grandweg 64, D-22529 Hamburg, Germany. Fax +49-40-429-346-10; e-mail hoeppner@bioglobe.net.

Received September 17, 2010; accepted November 24, 2010.

Previously published online at DOI: 10.1373/clinchem.2010.156893
Table 1. Specific primers used for CYP21A2 and CYP21A1P
amplification.

Primer name Sequence (5' [right Position (b)
 arrow] 3') (a)

Cyp21A2_Fs CCTTGCTTCTTGATGGGT-G-A-T-C c.1-220 [right arrow]
 c.1-199
Cyp21A1P_Fs CCTTGCTTCTCGATGGGT-G-A-T-T c.1-220 [right arrow]
 c.1-199
Cyp21A2_Rs GCCTCAATCCTCTGC-A-G-C-G c.1486+440 [right arrow]
 c.1486+458
Cyp21A1P_Rs GCCTCAATCCTCTGC-G-G-C-A c.1486+440 [right arrow]
 c.1486+458

(a) Bases that are different in CYP21A2and CYP21A1Pare in boldface.
Hyphens indicate thiophosphate bonds.

(b) Position numbers are assigned according to the Ensembl transcript
ENST0000448314. The adenine of the start codon is referenced as base
no. 1 (c.1).

Table 2. Universal forward and reverse sequencing primers for
CYP21A2 and CYP21A1P.

Name Sequence (5' [right Position
 arrow] 3')

Ex1F GGGATGGCTGGGGCTCTTG c.1-60 [right arrow] c.1-42
Ex2F GCTGCAAGGTGAGAGGCTGAT c.192 [right arrow] c.199+13
Ex3F GCCCAGGCTGGTCTTAAATTC c.289+69 [right arrow] c.289+89
Ex4F AAGCCCACAAGAAGCTCACC c.350 [right arrow] c.369
Ex5/6F GATCAAGGTGCCTCACAGCC c.540 [right arrow] c.546+13
Ex7F AGGCAGCACAAGGTGGGGAC c.724 [right arrow] c.735+8
Ex8F TTTTTTTGCTTCACCACCCTG c.914 [right arrow] c.934
Ex9F CACCACACGGCCCAGCAGG c.1098 [right arrow] c.1115+1
Ex10F CCTGCCGTGAAAATGTGGTGG c.1219+20 [right arrow] c.1219+40
Ex1R GAGGACCCTCTCCGTCACC c.200-33 [right arrow] c.199+47
Ex2R CTTGAGGCTGAGGTGGGAG c.289+124 [right arrow] c.289+106
Ex3R AGCCCAGCCTTACCTCAC c.444+13 [right arrow] c.440
Ex4R CAGGACAAGGAGAGGCTCAG c.547-31 [right arrow] c.546+39
Ex5/6R GCAATGCTGAGGCCGGTAGC c.735+67 [right arrow] c.735+48
Ex7R GCCAGGTTGCTGGGAAGGAG c.936 + 45 [right arrow] c.936+26
Ex8R GCTGGAGTTAGAGGCTGGC c.1116-10 [right arrow] c.1116-28
Ex9R GGTGGGTGGGGAGGCGTTC c.1120-18 [right arrow] c.1120-36
Ex10R GCGATCTCGCAGCACTGTGT c.1486+100 [right arrow] c.1486+81

Table 3. Bases conserved in CYP21A1P with
a frequency of 1.0. (a)

Region Position Variation
 (b)

5' promoter c.1-210 T>C
5' promoter c.1-199 C>T
5' promoter c.1-190 insT
5' promoter c.1-126 C>T
5' promoter c.1-113 G>A
5' promoter c.1-110 T>C
5' promoter c.1-103 A>G
Exon 1 c.115 T>C
Exon 1 c.135 A>C
Intron 2 c.289+45 insTGT
Intron 2 c.289+46 A>T
Intron 2 c.289+56 T>G
Intron 2 c.289+84 A>G
Intron 2 c.289+92 A>G
Intron 2 c.289+100 A>G
Intron 2 c.289+127 T>G
Intron 2 c.289+138 T>C
Intron 2 c.289+139 insG
Intron 2 c.290-139 A>T
Intron 2 c.290-129 insTCC

 Region Position Variation
 (b)

Intron 2 c.290-123 C>A
Intron 2 c.290-96_94 GGT>TCA
Intron 2 c.290-91 G>A
Intron 2 c.290-88_87 GA>AG
Intron 2 c.290-79 G>T
Intron 2 c.290-74 G>A
Intron 2 c.290-67 G/C>A
Intron 2 c.290-48 A>G
Intron 2 c.290-44 G>T
Intron 2 c.290-39_38 CA>GG
Intron 2 c.290-13 A/C>G
Intron 4 c.547-15 C>A
Intron 4 c.547-8 T>C
Exon 5 c.549 C>G
Exon 6 c.702 T>C
Exon 6 c.707 T>A
Exon 6 c.716 T>A
Intron 6 c.735 + 12_13 AC>GT
Exon 7 c.920 insT
Intron 7 c.936+11 G>C

(a) Hybrid genes are excluded.

(b) Genotypes are shown as changes from
CYP21A2 to CYP21A1P (i.e., CYP21A2
genotype>CYP21A1P genotype).

Table 4. New variants detected in CYP21A1P.

Region Position Variation Frequency
 in CYP21A1P

Intron 2 c.290-136 C>T 0.036
Intron 2 c.290-130 C>T 0.019
Intron 2 c.290-115 C>G 0.006
Exon 4 c.507 C>T 0.003
Intron 5 c.649-5 C>T 0.008
Exon 6 c.709_711 delGTG 0.030
Exon 7 c.874 G>A 0.011
Intron 9 c.1219+22 T>C 0.006
Intron 9 c.1220-21 C>T 0.019
Exon 10 c.1317 C>T 0.003
Exon 10 c.1394 C>G 0.006
3' UTR (a) c.1484+88 G>A 0.003
3' UTR c.1484+114 T>C 0.006
3' UTR c.1484+119 C>T 0.006

(a) UTR, untranslated region.

Table 5. Mutation haplotypes found in linkage
disequilibrium in CYP21A1P.

Position Genotype Cases, n

c.289+116/c.708/c.803 G-G/C-C/G-G 149
c.289+116/c.708/c.803 G-A/C-G/G-C 26
c.289+116/c.708/c.803 A-A/G-G/C-C 7
c.444+39/c.631 A-A/A-A 17
c.444+39/c.631 A-G/A-G 40
c.444+39/c.631 G-G/G-G 125
c.648+30/c.819 A-A/C-C 2
c.648+30/c.819 A-G/C-T 7
c.648+30/c.819 G-G/T-T 173
c.185/c.1448 T-T/C-C 10
c.185/c.1448 A-T/G-C 22
c.185/c.1448 A-A/G-G 150
c.290-130/c.444+38 T-T/T-T 1
c.290-130/c.444+38 C-T/C-T 5
c.290-130/c.444+38 C-C/C-C 176
COPYRIGHT 2011 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Canturk, Cumhur; Baade, Ulrike; Salazar, Ramona; Storm, Niels; Portner, Ralf; Hoppner, Wolfgang
Publication:Clinical Chemistry
Date:Mar 1, 2011
Words:3863
Previous Article:Use of genotype frequencies in medicated groups to investigate prescribing practice: APOE and statins as a proof of principle.
Next Article:Concordance study of 3 direct-to-consumer genetic-testing services.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters