Printer Friendly

Self-interaction chromatography and human osteoprotegrin.

ABSTRACT

Bone is in a constant state of remodeling, a lifelong maintenance program of resorption of old bone followed by formation of new bone. The process is regulated by an intricate network of cytokines and hormones. Osteoprotegerin (OPG), the receptor activator of nuclear factor-[kappa]B (RANK), and RANK ligand (RANKL) comprise a system of proteins that play a key role in regulating bone remodeling and are well known as targets for developing therapeutics to treat osteoporosis. Recent studies suggest that OPG may also play a role in preventing apoptosis of osteoclasts by the sequestration of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a potential negative side effect of therapeutic treatment with OPG. Here we report baculovirus expression and purification of full-length native human OPG and the use of self-interaction chromatography (SIC) to identify excipients that increase the solubility and stability of OPG in aqueous solutions.

INTRODUCTION

Bone undergoes continuous remodeling with approximately 10% of the skeleton replaced each year. The delicate balance of bone resorption followed by bone formation must be maintained to sustain healthy bone. It is a dynamic process that is maintained by complex interactions between osteoclasts, bone resorption cells, and osteoblasts, bone forming cells. Osteoprotegerin (OPG), receptor activator of nuclear factor-[kappa]B (RANK), and RANK ligand (RANKL), are proteins that regulate osteoclast formation and differentiation (Lacey et al., 1998, Hofbauer, 1999, Teitelbaum, 2000, Feng, 2005, Luo et al., 2006). Primarily secreted from osteoblasts and bone marrow stromal cells, OPG acts as a decoy receptor that, once bound to RANKL, prevents binding to RANK, subsequently preventing the differentiation of the osteoclast (Theoleyre et al., 2006). Proper balance of the RANK-RANKL-OPG system is crucial to healthy bone metabolism (Lopez, 2000, Lemer, 2004). Since its discovery in the late 1990's, imbalance of the system has been linked with many metabolic bone diseases, such as osteoporosis, rheumatoid arthritis (RA), multiple myeloma (MM), lytic bone metastases, and juvenile Pagent's disease. Denusomab (Prolia, Xgeva--Amgen), a human anti-RANKL antibody, was approved by the FDA in 2010 to treat osteoporosis and bone metastasis (Pageau, 2009). AMGN-0007, a recombinant peptide of OPG (amino acids 22-194) fused to the Fc domain of human IgGl, has been shown to suppress bone resorption in MM and breast cancer patients (Wright et al., 2009). Recently published crystal structures of the ectodomains of murine RANK in complex with RANKL (Liu et al., 2010) and separately, human RANKL in complex with OPG (amino acids 22-194) (Luan et al., 2012) provide a molecular basis for OPG's anti-osteolytic activity and role as "bone protector." However, native OPG (amino acids 22-401) has been shown to neutralize not only RANKL, but also TNF-related apoptosis-inducing ligand (TRAIL), counteracting the "death-inducing ligand's" antitumor activity (Zauli et al., 2009). The molecular basis for this independent biological property is of particular interest given the fact that some types of breast cancer cells over express OPG and have been shown to have a higher bone metastatic potential in vivo. Studies suggest that the two death-domain homologous regions of OPG, amino acids 186-361 for which there is no crystal structure, are involved in blocking TRAIL from inducing apoptosis in mature osteoclasts.

Protein solubility and physical stability are important factors for both pharmaceutical products and scientific study. Regarding pharmaceutical products, therapeutic proteins require an injectable route of administration and therefore must have high solubility in order to reduce the volume necessary for a therapeutic dose (Shire et al., 2004). Physical stability is also necessary in pharmaceutical proteins to ensure aggregates that can cause adverse immune reactions will not be injected (Rosenberg, 2006). For scientific study, increased physical stability allows for more consistent characterization of the protein, and increased solubility enables a wider variety of characterization techniques. A measure of protein-protein interactions known as the osmotic second virial coefficient, or [B.sub.22] value, is indicative of both physical stability and maximum solubility of a protein formulation (Neal et al., 1998). [B.sub.22] value is a thermodynamic quantity that is a sum of all attractive and repulsive forces between protein molecules at all orientations and distances. Increased [B.sub.22] values are associated with protein repulsions and allow for increased protein solubility and physical stability.

Self-Interaction Chromatography (SIC) is a technique used to measure [B.sub.22] value that is easily automated and requires relatively little protein (Tessier et al., 2002). It is an affinity chromatography technique that measures the protein-protein interactions by first covalently binding the protein of interest to column media. The column is equilibrated with a given formulation. A bolus of protein is injected over the column and interacts with the media-bound protein in the presence of the formulation. Increased interactions between the mobile and static proteins require a larger elution volume, and [B.sub.22] value is quantified by comparing the protein elution volume to a non-interacting marker elution volume. In this study, we evaluate individual additives using self-interaction chromatography to identify a formulation that increases [B.sub.22] value and results in a higher maximum concentration of the human OPG (amino acids 23-401) protein in solution.

MATERIALS AND METHODS

Cloning

A human prostate carcinoma cell line (PC-3) was subjected to a standard RT-PCR protocol. The primers were as follows:

(forward primer) AT G A AC A AGT-TGCTGTGCT GCGCGCTCGT GTTT CTG, (reverse primer) CAGGTCCAATCAGTAAAAA-TAAGCTGCTTATAACTG, (RT-primer) CCTCACAATTGGCGAGATCC.

The resulting cDNA was amplified by polymerase chain reaction (PCR) using the following primers:

GGG-ATCCACGTTTCCTCCAAAGTACC, GGCGGCCGCTT ATA AGC AGCTTATTTTT ACT GA-TT G.

The PCR product encoding all except the signal sequence of hOPG (residues 23-401 of NCBI Reference Sequence accession NG_012202.1) was cloned into a pCR-Blunt (Invitrogen) vector, propagated using competent E.coli cells (XL 10-Gold, Stratagene) and purified using Quiagen's Miniprep kit according to the manufacturer's instructions. The purified plasmid was digested at 37[degrees]C with BamHI and Notl restriction endonuclease enzymes and subsequently cloned into the baculovirus transfer vector pAcGP67-B BamHI- Notl sites.

Baculovirus co-transfection

The baculovirus transfer vector with the human OPG gene insert was co-transfected with baculovirus linearized DNA with the GFP (green fluorescent protein) insert by adding 0.5[micro]g BaculoGold Bright linearized DNA (BD Biosciences) and 2[micro]g Baculovirus pAcGP67-B recombinant transfer vector in a microcentrifuge tube, gently mixing well, and letting sit for five minutes before adding 1mL Graces insect media with 20[micro]L Insectin-Plus liposomes (Invitrogen). The old media was aspirated from Spodoptera frugiperda (S/9) insect cell monolayer in a T25 tissue culture flask (Sardstedt #83.1810) at approximately seventy percent confluency, and the liposome mixture was dropped over the cell surface. After the cells incubated at room temperature for 4 hours, the co-transfection mixture was aspirated and replaced with 3 mL ExCell 420 insect media (Sigma-Aldrich). The cells were placed in an incubator at 27[degrees]C and checked daily for the presence of GFP using a fluorescent microscope. Virus-infected cells appeared within 48 to 72 hours of co-transfection. After five days, the medium was harvested and kept as the primary virus stock. The virus titer was increased through four rounds of amplification using BD Biosciences Baculovirus amplification protocol. Plaque assays performed in 1E3, 1E5, and 1E6 dilutions showed that the hOPG baculovirus stock titer was ~1E6 pfu/mL (Dulbecco and Vogt, 1953).

Mutagenesis

The point mutation error in the DNA encoding OPG (A [right arrow] G at bp 1092 of NCBI Reference Sequence accession NG_012202.1) (Figure 1) was corrected by overlap extension PCR using synthetic oligonucleotide primers. Strategene's Quikchange II XL Site-directed mutagenesis kit was used according to the manufacturer's suggested protocol along with the forward and reverse thirty-two base pair oligonucleotides (Sigma-Aldrich, Genosys).

Expression and purification

Human OPG (23-401) was expressed in a 2L, 5 day culture of High Five insect cells (Invitrogen) and ExCell 405 insect media (JRH Bioscience) infected with 15mL/L of high titer viral stock and grown at 22[degrees]C. The media containing the secreted OPG was separated from the insect cells using centrifugation (4[degrees]C and 2,200rpm). OPG was allowed to bind to SP sepharose by batch method, 20mL SP Sepharose beads with 2L of supernatant plus protease inhibitors left to stir overnight at 4[degrees]C. The OPG bound SP Sepharose was separated by decanting and handpacked into a glass column. Using an AKTA Purifier 10 at 4[degrees]C, the column was equilibrated with buffer A, 50mM 4-(2-hydroxyethyl)-lpiperazineethanesulfonic acid (HEPES) pH 7, 50mM NaCl, 0.1M L-arginine (L-Arg) and L-glutamic acid (L-Glu), 0.2M trehalose, ImM Tris-(2-carboxyethyl)phosphine, hydrochloride (TCEP), and 0.5mM ethylenediaminetetraacetic acid (EDTA). OPG was eluted via ion exchange with buffer B (buffer A plus 1M NaCl) with a 0-100% buffer B linear gradient for 40 minutes at 2.5mL/min. The fractions were pooled according to results from SDS-PAGE analysis and dialyzed against buffer A. The sample was filtered and the concentration determined using UV spectroscopy ([A.sub.280nm,0.1%] = 1.1) (Gasteiger et al, 2005). Five milligrams of OPG was injected onto a lmL Mono S column equilibrated with buffer A. OPG was eluted with a 0-100% buffer B gradient for five minutes at 1mL/min. The fractions were pooled based on results from SDS-PAGE analysis, dialyzed against GF buffer (50mM HEPES pH7, 0.25M NaCl, 0.1M L-arginine, 0.1M L-glutamic acid, 0.2M trehalose, ImM TCEP), and concentrated to 5 mg/mL using a 4mL, lOkDa molecular weight cut off (MWCO) spin concentrator. The concentrated OPG sample was further purified by gel filtration using a Superdex 75 16/60 column equilibrated with GF buffer. The fractions were pooled based on results from sodium dodecyl sulfate poly-acrylamide gel electrophoresis (SDS-PAGE) analysis, and the sample was stored at 4[degrees]C.

Self-interaction chromatography

Self-interaction chromatography, a form of affinity chromatography by which the protein of interest is bound to the column media, was used to study the interactions of OPG with itself in various solution formulations. Before binding, purified OPG was buffer exchanged to GF buffer no TCEP and concentrated to 5mg/mL. Separately, 30mg of Tosoh Haas Tresyl beads were rinsed three times with GF buffer no TCEP. The rinse process consisted of adding 1ml of buffer, agitating the solution until the beads are suspended, spinning the beads for 30 seconds with a bench-top centrifuge, and removing excess buffer from the mixture. Next, 1mL of hOPG and the rinsed beads were combined and allowed to incubate on a rocker for 24 hours at 4[degrees]C. The next day, the protein-bound-media was rinsed three times with GF buffer containing TCEP and allowed to incubate on a rocker for 12 hours at 4 [degrees]C to cap any active groups that were not bound by the protein. After capping, the protein-bound-beads were packed manually into a 22cm long, 0.762mm i.d. Teflon FEP tubing (IDEX) with a 2 micron stainless steel frit on each end. After packing, two 1.1 cm lengths of packed tubing and excess empty tubing were removed, and a frit was added resulting in an 18cm long column. The 1.1cm lengths of packed tubing were assayed using Pierce's BCA assay, a colorimetric assay (absorbance at 562nm) used to determine the concentration of proteins or peptides that are three or more amino acids in length, and the bound-hOPG concentration was determined to be 3.5mg/mL. The column was connected to a Shimadzu HPLC, and GF buffer was pumped over the column at a rate of 60[micro]L/min for 15 minutes (11 column volumes) to allow the absorbance measurement to equilibrate. The equilibration step was performed each time a new formulation was pumped over the column. After equilibration, 1[micro]L of 1 mg/mL hOPG in GF buffer was injected over the column, and the retention time measured as the peak of elution. All measurements were performed in triplicate, and the results are summarized in Figures 5-9. The relation between protein retention time and [B.sub.22] value is given in Equation 1 (Tessier et al., 2002).

[B.sub.22] = ([N.sub.A]/[MW.sup.2])([B.sub.HS] - k'/[phi][rho]) (1)

where k' = ([V.sub.r]-[V.sub.o])/[V.sub.o]

In this equation, [B.sub.HS] is the contribution from the hard sphere volume of the protein, [phi] is the phase ratio (ratio of volume to surface area of the packed column media), and [rho] is the protein bound per unit surface area. These variables are fixed for a given column. The remaining variable, k', is retention factor, a standard chromatographic parameter describing the relationship between the retention volume of the protein, [V.sub.r], and the retention volume of a non-interacting species, [V.sub.o], determined by using a 1[micro]L injection of 3% (v/v) acetone (Valente et al., 2005).

RESULTS

Human osteoprotegerin production and purification

Figure 1. cDNA encoding osteoprotegerin amino acids 23-401;
restriction sites BamHI and Notl along with stop codon
(gray); corrected point mutation error (highlighted)

GGATCCACGTTTCCTCCAAAGTACCTTCATTATGACGAAGAAACCTCTCATCAG
CTGTTGTGTGACAAATGTCCTCCTGGTACCTACCTAAAACAACACTGTACAGCA
AAGTGGAAGACCGTGTGCGCCCCTTGCCCTGACCACTACTACACAGACAGCTG
GCACACCAGTGACGAGTGTCTATACTGCAGCCCCGTGTGCAAGGAGCTGCAGT
ACGTCAAGCAGGAGTGCAATCGCACCCACAACCGCGTGTGCGAATGCAAGGAA
GGGCGCTACCTTGAGATAGAGTTCTGCTTGAAACATAGGAGCTGCCCTCCTGG
ATTTGGAGTGGTGCAAGCTGGAACCCCAGAGCGAAATACAGTTTGCAAAAGAT
GTCCAGATGGGTTCTTCTCAAATGAGACGTCATCTAAAGCACCCTGTAGAAAAC
ACACAAATTGCAGTGTCTTTGGTCTCCTGCTAACTCAGAAAGGAAATGCAACAC
ACGACAACATATGTTCCGGAAACAGTGAATCAACTCAAAAATGTGGAATAGAT
GTTACCCTGTGTGAGGAGGCATTCTTCAGGTTTGCTGTTCCTACAAAGTTTACG
CCTAACTGGCTTAGTGTCTTGGTAGACAATTTGCCTGGCACCAAAGTAAACGCA
GAGAGTGTAGAGAGGATAAAACGGCAACACAGCTCACAAGAACAGACTTTCCA
GCTGCTGAAGTTATGGAAACATCAAAACAAAGCCCAAGATATAGTCAAGAAGA
TCATCCAAGATATTGACCTCTGTGAAAACAGCGTGCAGCGGCACATTGGACAT
GCTAACCTCACCTTCGAGCAGCTTCGTAGCTTGATGGAAAGCTTACCGGGAAA
GAAAGTGGGAGCAGAAGACATTGAAAAAACAATAAAGGCATGCAAACCCAGTG
ACCAGATCCTGAAGCTGCTCAGTTTGTGGCGAATAAAAAATGGCGACCAAGAC
ACCTTGAAGGGCCTAATGCACGCACTAAAGCACTCAAAGACGTACCACTTTCCC
AAAACTGTCACTCAGAGTCTAAAGAAGACCATCAGGTTCCTTCACAGCTTCACA
ATGTACAAATTGTATCAGAAGTTATTTTTAGAAATGATAGGTAACCAGGTCCAA
TCAGTAAAAATAAGCTGCTTATAAGCGGCCGC


Sequencing showed that the original PCR product encoding OPG (23-401) had a point mutation at base pair number 1092 (Figure 1) which encodes Arg332 (Figure 2). The error was corrected using a thirty-two base pair oligonucleotide and Strategene's Quick Change Kit. After the resulting DNA plasmid was sequenced using baculovirus forward and reverse primers and the DNA plasmid was verified to be error free, it was co-transfected into the Baculovirus expression vector system (BEVS). The virus was amplified using sf9 insect cells, and the high titer viral stock was used to infect two 1L cultures of High Five insect cells. After 5 days, OPG was harvested and purified using cation exchange chromatography followed by size exclusion chromatography. The identity of the purified protein was verified using western blot analysis (data not shown).

Figure 2. Native human osteoprotegerin amino acid sequence,
N-terminal signaling peptide (gray)

1 mnkllccalv fldisikwtt qetfppkylh ydeetshqll cdkcppgtyl
kqhctakwkt

61 vcapcpdhyy tdswhtsdec lycspvckel qyvkqecnrt hnrvceckeg
ryleiefclk

121 hrscppgfgv vqagtpernt vckrcpdgff snetsskapc rkhtncsvfg
llltqkgnat

181 hdnicsgnse stqkcgidvt lceeaffrfa vptkftpnwl svlvdnlpgt
kvnaesveri

241 krqhssqeqt fqllklwkhq nkdqdivkki iqdidlcens vqrhighanl
tfeqlrslme

301 slpgkkvgae diektikack psdqilklls lwrikngdqd tlkglmhalk
hsktyhfpkt

361 vtqslkktir flhsftmykl yqklflemig nqvqsvkisc 1


Purified hOPG functional assessment via OPG--RANKL complex formation

The structural integrity of the recombinant hOPG was assessed by complex formation with RANKL. A glutathione S-transferase (GST) murine RANKL fusion protein (GST-mRANKL, a generous gift from Dr. Xu Feng, University of Alabama, Department of Pathology) was incubated at a 3:2 molar ratio with hOPG overnight at 4[degrees]C. The next day the mixture was passed over a GST affinity column. Fractions eluted with reduced glutathione showed two bands on SDS-PAGE (Figure 3). Mass spectrometry analysis verified the top band is hOPG and the lower band is GST-mRANKL. The complex formation with RANKL demonstrates that the recombinant hOPG (Figure 4) is functionally active.

Exploring the use of excipients to increase solubility of hOPG

In typical aqueous solutions, OPG has limited stability and solubility, leading to protein aggregate formation, thus rendering the sample unsuitable for protein crystallization. It has been shown that excipients such as L-arginine, L-glutamic acid, and trehalose can increase the solubility and long-term stability of proteins in solution while decreasing the tendency of proteins to form aggregates (Chi et al., 2003). There are three general classes of excipients: those that block hydrophobic patches (i.e. arginine, glutamic acid) on the surface of proteins, thereby decreasing non-specific aggregation (Arakawa and Timasheff, 1985, Timasheff, 1998, Chi et al., 2003, Tsumoto, 2005); those that stabilize protein conformation (i.e. trehalose, sorbitol, mannitol) by their effect on the structure and properties of solvent water (Kendrick, 1997, Kaushik and Bhat, 2003, Lins et al., 2004); and those that modify ionic interactions. Inorganic salts act (along with pH) to modify ionic interactions of the protein. Each of these classes of excipients was tested for the ability to increase the solubility of hOPG using self-interaction chromatography.

Self-Interaction Chromatography (SIC) of hOPG

SIC is a method that has been shown to assess protein-protein interactions. Using SIC to measure changes in [B.sub.22] value, as described in the methods, has been shown to correlate with protein solubility in aqueous solutions (Demoruelle et al., 2002, Tessier et al., 2002). For example, positive increases in the [B.sub.22] value indicate increases in protein solubility. Therefore, SIC was used to determine changes in the [B.sub.22] value of hOPG with the addition of five common excipients to assess the solubility of hOPG in aqueous solutions. [B.sub.22] values for hOPG were determined and plotted as a function of excipient concentration for the following: glycerol, L-arginine HCl and L-glutamic acid, trehalose, sodium chloride (NaCl), and ammonium sulfate (Figure 5-9).

Interestingly, each of the five excipients tested increased the [B.sub.22] value for hOPG with trehalose having the most positive effect. The effect of glycerol on the [B.sub.22] value of OPG in 50mM HEPES pH7, 10mM NaCl, 50mM L-Arg and Glu, 0.1M trehalose was measured (Figure 5). Without glycerol, [B.sub.22] value is close to zero, but the addition of 10% glycerol increased the value to +12.3 x [10.sup.-4] mol x ml x [g.sup.-2]. Similarly, the effect of the excipients L-Arg and L-Glu on the solubility of OPG was evaluated using SIC. Decreasing the concentration of the two amino acids from 50mM to 25mM each results in a negative [B.sub.22] value, whereas increasing the concentration to 0.1M increases the value to +5.6 x [10.sup.-4] mol x ml x [g.sup.-2] (Figure 6). The excipient trehalose also had a positive effect on the [B.sub.22] value. Without the sugar, [B.sub.22] value of OPG in 50mM HEPES pH7, 10mM NaCl, 0.1M L-Arg & Glu is very negative, but in the presence of 0.2M trehalose, the [B.sub.22] value equals +5.5 x [10.sup.-4] mol x mL x [g.sup.-2] (Figure 7).

The effects of sodium chloride and ammonium sulfate (AS) on the [B.sub.22] value of hOPG were also assessed using SIC. Increasing the concentration of NaCl from 0.01M to 0.3M in 50mM HEPES pH7, 50mM L-Arg & Glu, 0.1M trehalose increased [B.sub.22] value from around zero to +6.6 x [10.sup.-4] mol x mL x [g.sup.-2] (Figure 8). The [B.sub.22] values of hOPG as a function of AS concentration (0, 0.5M, and 1.0M) in 50mM HEPES pH7, 10mM NaCl, 50mM L-Arg & Glu, 0.1M trehalose were measured (Figure 9). A salting-in effect increases the solubility of hOPG when the concentration of AS changes from 0 to 0.5M. At the higher 1M [AS], the [B.sub.22] value decreases indicating a salting-out effect. In conclusion, self-interaction chromatography was able to predict solubility trends for full-length human OPG.

The positive [B.sub.22] values suggested that all excipients tested increased the solubility of OPG in solution. To verify these results, three solutions were chosen, and the relative solubility of hOPG in each was estimated by spin concentrating the protein in each solution. Briefly, 4 mL of 1 mg/mL hOPG was buffer exchanged and concentrated using a 4mL lOKDa MWCO spin concentrator spinning at 2,000 rpm and 4[degrees]C and inverting the concentrator at 10min intervals to minimize supersaturation zones near the bottom of the concentrator. The concentrated solutions were filtered, the UV absorbance at 280 nm measured, and the protein concentration calculated using an extinction coefficient of 1.1 [A.sub.280nm, 0.1%] calculated from its amino acid sequence (Gasteiger et al., 2005). The results summarized in Table 1 show that hOPG is more soluble with the additives than in buffer alone.

DISCUSSION

Osteoprotegerin (OPG) has potential therapeutic efficacy (Yano et al., 2001, Body et al., 2003), but poor solubility and stability in aqueous solutions has hampered efforts to fully characterize the native protein. In this study, the hypothesis was tested to see whether any of the excipients routinely used for stabilizing proteins in solution could be useful with hOPG. Because previous research and drug development studies have had little success in establishing optimal solution conditions for OPG, this work uses the specialized technique of self-interaction chromatography (SIC) to aid in solution formulation. Specifically, SIC was used to measure the second virial coefficient, [B.sub.22] value, as an indication of hOPG's solubility in the presence of select excipients in hopes of formulating a suitable purification and storage solution for the protein. All the excipients tested increased hOPG solubility to varying degrees. The addition of 10% glycerol showed the largest increase while 5% glycerol provided only a modest increase. The addition of lOOmM trehalose increased the solubility significantly, but no further improvement was achieved by doubling the concentration to 200mM. Data from SIC measurements also showed that the addition of 50mM L-Arg and L-Glu was insufficient. Instead, lOOmM of the amino acids were needed to effectively block hydrophobic patches on protein surface.

The data gained from SIC provided a systematic approach to solution formulation for native hOPG. No doubt some of the information could have been generated by trial and error as is often the case. However, by using SIC, general solubility trends for each excipient were used to guide the formulation process toward a condition where native hOPG is more soluble.

ACKNOWLEGEMENTS

This work was supported by an NIH T32 institutional training grant (2T32 AR04751206) sponsored by UAB's Center for Metabolic Bone Disease and awarded by P.I. Jay McDonald. DNA sequencing was done at UAB's Center for AIDS Research and Comprehensive Cancer Center DNA Sequencing Core. Self-Interaction Chromatography was performed at The Structural Biology Shared Facility, a part of the Center for Biophysical Sciences and Engineering and supported by the Comprehensive Cancer Center Core Support Grant, NIH-National Cancer Institute (P30 CA 013148). Dr. W. William Wilson and Dr. Lawrence J. DeLucas, co-authors of this publication, have equity ownership in, and serve on the board of directors and as advisors for Soluble Therapeutics, Inc., a company developing products related to the research being reported. The terms of this arrangement have been reviewed and approved by the University of Alabama at Birmingham and Mississippi State University in accordance with their academic policies on conflict of interest in research.

REFERENCES

Arakawa, T., and S. N. Timasheff. 1985. The stabilization of proteins by osmolytes. Biophysical Journal. 47: 411-414.

Body, J.J., P. Greipp, R. E. Coleman, T. Facon, F. Geurs, and J. P. Fermand. 2003. A phase I study of AMGN-0007, a recombinant osteoprotegerin construct, in patients with multiple myeloma or breast carcinoma-related bone metastases. Cancer. 97: 887-892.

Chi, E. Y., S. Krishnan, T. W. Randolph, and J. F. Carpenter. 2003. Physical stability of proteins in aqueous solution: mechanism and driving forces in normative protein aggregation. Pharmaceutical Research. 20(9): 1325-1336.

Demoruelle, K., B. Guo, S. Kao, H. M. McDonald, D. B. Nikic, S. C. Holman, and W. W. Wilson. 2002. Correlation between the osmotic second virial coefficient and solubility for equine serum albumin and ovalbumin. Acta Crystalographica D. 58: 1544-1548.

Dulbecco, R., and M. Vogt. 1953. Some problems of animal virology as studied by the plaque technique. Cold Spring Harbor Symposium Quantitative Biology. 18: 273-279.

Feng, X. 2005. Regulatory roles and molecular signaling of TNF family members in osteoclasts. Gene, 250: 1-13.

Gasteiger, E., C. Hoogland, A. Gattiker, S. Duvaud, M. R. Wilkins, R. D. Appel, and A. Bairoch. 2005. Protein identification and analysis tools on the ExPASy server. In J. M. Walker [ed.], The Proteomics Protocols Handbook, 571-607. Humana Press, Clifton, New Jersey, USA.

Hofbauer, L. 1999. Osteoprotegerin ligand and osteoprotegerin: novel implications for osteoclast biology and bone metabolism. European Journal of Endocrinology. 141: 195-210.

Kaushik, J. K. and R. Bhat. 2003 Why is trehalose an exceptional protein stabilizer? Journal of Biological Chemistry. 278: 26458-26465.

Kendrick, B. S., B. S. Chang, T. Arakawa, B. Peterson, T. W. Randolph, M. C. Manning, and J. F. Carpenter. 1997. Preferential exclusion of sucrose from recombinant interleukin-1 receptor antagonist: role in restricted conformational mobility and compaction of native state. Proceedings of the National Academy of Science USA. 94(22): 11917-11922.

Lacey, D., E. Timms, H. Tan, M. Kelley, C. Dunstan, T. Burgess, G. Elliot, S. Scully, H. Hsu, J. Sullivan, N. Hawkins, E. Davy, C. Capparelli, A. Eli, Y. Qian, S. Kaufman, I. Sarosi, V. Shalhoub, G. Senaldi, J. Guo, J. Delaney, and W. Boyle. 1998. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell. 93: 165-176.

Lerner, U. H. 2004. New molecules in the tumor necrosis factor ligand and receptor superfamilies with importance for physiological and pathological bone resorption. Critical Reviews Oral Biology and Medicine. 15(2): 64-81.

Lins, R. D., C. S. Pereira, and P. H. Hunenberger. 2004. Trehalose-protein interaction in aqueous solution. Proteins: Structure, Function and Bioinformatics 55: 177-186.

Liu, C., T. S. Walter, P. Huang, S. Zhang, X. Zhu, Y. Wu, L. R. Wedderbum, P. Tang, R. J. Owens, D. I. Stuart, J. Ren, and B. Gao. 2010. Structural and functional insights of RANKL-RANK interaction and signaling. Journal of Immunology. 184: 6910-6919.

Lopez, F. 2000. New approaches to the treatment of osteoporosis. Current Opinion in Chemical Biology. 4: 383-393.

Luan, X., Q. Lu, Y. Jiang, S. Zhang, Z. Wang, H. Yuan, W. Zhao, J. Wang, and X. Wang. 2012. Crystal structure of human RANKL complexed with its decoy receptor osteoprotegerin. Journal Immunology. 189(1): 245-52.

Luo, X. H., L. J. Guo, H. Xie, L. Q. Yuan, X. P. Wu, H. D. Zhou, and E. Y. Liao. 2006. Adiponectin stimulates RANKL and inhibits OPG expression in human osteoblasts through the MAPK signaling pathway. Journal of Bone Mineral Research. 21: 1648-1656.

Neal, B. L., D. Asthagiri, and A. M. Lenhoff. 1998. Molecular origins of osmotic second virial coefficients of proteins. Biophysical Journal. 75: 2469-2477.

Pageau, S. C. 2009. Denosumab. mAbs. 1(3): 210-215.

Rosenberg, A. S. 2006. Effects of protein aggregates: an immunologic perspective. American Association of Pharmaceutical Scientists Journal. 8: E501-E507.

Shire, S. J., Z. Shahrokh, and J. Liu. 2004. Challenges in the development of high protein concentration formulations. Journal of Pharmaceutical Sciences. 93: 1390-1402.

Teitelbaum, S.L. 2000. Bone resorption by osteoclasts. Science. 289: 1504-1508.

Tessier, P. M., A. M. Lenhoff, and S. I. Sandler. 2002. Rapid measurement of protein osmotic second virial coefficients by self-interaction chromatography. Biophysical Journal. 82: 1620-1631.

Theoleyre, S., S. Tat, P. Vusio, F. Blanchard, J. Gallagher, S. Ricard-Blum, Y. Fortun, M. Padrines, F. Redini, and D. Heymann. 2006. Characterization of osteoprotegerin binding to glycosaminoglycans by surface plasmon resonance: role in the interactions with receptor activator of nuclear factor [kappa]B ligand (RANKL) and RANK. Biochemical Biophysical Research Communications. 347: 460-467.

Timasheff, S. N. 1998. Control of protein stability and reactions by weakly interacting cosolvents: the simplicity of the complicated. Advances in Protein Chemistry. 51: 355-432.

Tsumoto, K., D. Ejima, Y. Kita, and T. Arakawa. 2005. Review: why is arginine effective in suppressing aggregation? Protein and Peptide Letters. 12: 613-619.

Valente, J. J., K. S. Verma, M. C. Manning, W. W. Wilson, and C. S. Henry. 2005. Second virial coefficient studies of cosolvent-induced protein self-interaction. Biophysical Journal. 89: 4211-4218.

Wright, H.L., H. S. McCarthy, J. Middleton, and M. J. Marshall. 2009. RANK, RANKL, and osteoprotegerin in bone biology and disease. Current Reviews Musculoskeletal Medicine. 2: 56-64.

Yano, K., O. Shibata, A. Mizuno, F. Kobayashi, K. Higashio, T. Morinaga, and E. Tsuda. 2001. Immunological study on circulating murine osteoprotegerin/osteoclastogenesis inhibitory factor (OPG/OCIF): possible role of OPG/OCIF in the prevention of osteoporosis in pregnancy. Biochemical and Biophysical Research Communications. 288: 217-223.

Zauli, G., E. Melloni, S. Capitani, and P. Secchiero. 2009. Role of full-length osteoprotegerin in tumor cell biology. Cell and Molecular Life Sciences. 66(5): 841-851.

Heather M. McDonald (1,2), Kevin Macon (1), David Johnson (1,3), Debbie McCombs (1), Mike Teale (1), Stephanie B. Wall (1), W. William Wilson (4) and Lawrence J. DeLucas (1,3)

(1) Center for Biophysical Sciences and Engineering, University of Alabama at Birmingham, 1720 2nd Ave. S, Birmingham, AL 35294

(2) Department of Physical Sciences, University of West Alabama, Livingston, Alabama 35470

(3) Soluble Therapeutics, 1500 1st Avenue North, Birmingham, AL 35203

(4) Department of Chemistry, Mississippi State University, MSU, MS 39762

Correspondence: Heather McDonald (hmcdonald@uwa.edu)

TABLE 1. Estimated solubility of human osteoprotegerin in select
solution formulations

Solution Formulation                                    Solubility
                                                        (mg/mL)

50mM HEPES pH 7, 10mM NaCl                              1.0
50mM HEPES pH 7, 0.2M NaCl, 0.1M L-Arg & L-Glu, 0.2M    4.5
  trehalose
50mM HEPES, pH 7, 0.2M NaCl, 0.15M trehalose, 10%       11
  glycerol

Figure 5. [B.sub.22] value versus % glycerol, osteoprotegerin in 50mM
HEPES pH7, 10mM sodium chloride, 50mM L-arginine and L-glutamic acid,
0.1M trehalose

Glycerol Concentration (%)

% glyc   [B.sub.22]   SD
            value

  0         0.6       0.5
  5         1.9       0.3
  10        12.3      0.3

Figure 6. [B.sub.22] value versus L-arginine and L-glutamic acid
concentration, osteoprotegerin in 50mM HEPES pH7, 10mM sodium
chloride, 0.2M trehalose

L-Arg & L-Glu Concentration (mM)

[AA] (mM)   [B.sub.22]   SD
               value

    25         -1.4      1.1
    50         0.27      1.2
   100          5.6      1.8

Figure 7. [B.sub.22] value versus trehalose concentration,
osteoprotegerin in 50mM HEPES pH7, 10mM sodium chloride,
0.1M L-arginine and L-glutamic acid

Trehalose Concentration (mM)

[tre] (mM)   [B.sub.22]   SD
                value

    0          -13.6      1.1
   100          5.8       1.3
   200          5.6       1.8

Figure 8. [B.sub.22] value versus sodium chloride concentration,
osteoprotegerin in 50mM HEPES pH7, 50mM L-arginine and L-glutamic
acid, 0.1M trehalose

NaCl Concentration (mM)

[NaCl] (mM)   [B.sub.22]   SD
                 value

   10            0.6       0.5
   150           2.6       0.6
   300           6.6       0.3

Figure 9. [B.sub.22] value versus ammonium sulfate concentration,
osteoprotegerin in 50mM HEPES pH7, 10mM sodium chloride, 50mM
L-arginine and L-glutamic acid, 0.1M trehalose

[Ammonium Sulfate] (M)

[AS] (M)   [B.sub.22]   SD
              value

   0           1.7      1.3
  0.5          6.9      0.2
  1.0          5.1      1.0
COPYRIGHT 2015 Alabama Academy of Science
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:McDonald, Heather M.; Macon, Kevin; Johnson, David; McCombs, Debbie; Teale, Mike; Wall, Stephanie B.
Publication:Journal of the Alabama Academy of Science
Article Type:Report
Date:Jan 1, 2015
Words:5020
Previous Article:$1000 Fellowship in science teaching.
Next Article:Reproductive development in the Black Darter (Etheostoma duryi).
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters