Printer Friendly

Screening for mutations and polymorphisms in the genes KCNH2 and KCNE2 encoding the cardiac HERG/MiRP1 ion channel: implications for acquired and congenital long Q-T syndrome.

The action potential of the heart is the result of the concerted and well-orchestrated action of many ion channels conducting currents with different biophysical characteristics (1). The slow ([I.sub.Ks]) and rapid ([I.sub.Kr]) components of the voltage-gated delayed rectifier [K.sup.+]-current are important for repolarization of the heart in the third phase of the action potential (2).

The [I.sub.Kr] current is conducted through an ion channel most likely composed of four HERG subunits (3) in combination with an unknown number of MiRP1 subunits (4). The [I.sub.Ks] current is likewise conducted through an ion channel composed of four KvLQT1 [alpha] subunits and an unknown number of minx [beta] subunits (5). If the ion channels responsible for [I.sub.Kr] or [I.sub.Ks] are dysfunctional because of mutations or pharmacological interferences, the result may be long Q-T syndrome (LQTS) [8] a condition characterized by prolonged cardiac repolarization, and, in consequence, a prolonged Q-T interval on the electrocardiogram, a propensity for ventricular arrhythmias of the torsades de pointes type, causing syncopes or ventricular fibrillation and death (6).

Approximately 50% of cases with clinically diagnosed LQTS can be genotyped at present (6). Among these patients, 20-40% may have mutations in KCNH2 encoding the HERG [alpha]-subunit of the HERG/MiRP1 channel conducting the [I.sub.Kr], current, and 30-50% may have mutations in KCNQ1 encoding the KvLQT1 [alpha]-subunit of the KvLQT1/minx channel conducting the [I.sub.Ks] current (7). The remainder may have mutations in KCNE1 or KCNE2 encoding minx (8) and MiRP1 (4), respectively, or in the SCN5A gene encoding the SCN5A [Na.sup.+]-ion channel conducting the [I.sub.Na] current responsible for the initial depolarization of the action potential (9,10).

The HERG/MiRP1 ion channel is of pharmacological importance because many common drugs, e.g., haloperidol, amiodarone, ketoconazol, terfenadine, class III anti-arrhythmics, and others (11-15), interact with the [I.sub.Kr], current, and in some cases cause acquired LQTS, or may precipitate prolongation of the Q-T interval and torsades de pointes in patients with LQTS. Furthermore, patients with low--or nonpenetrant genetic LQTS (16,17) may become symptomatic only when taking drugs prolonging the Q-T interval (18).

The recent discovery of KCNE2 mutations among patients suffering from drug-induced, inherited, or sporadic arrhythmia (4) further corroborates the involvement of the HERG/MiRP1 ion channel in the susceptibility to arrhythmia.

Here we describe a rapid single-strand conformation polymorphism-heteroduplex (SSCP-HD) analysis method for screening for mutations in all coding regions of the KCNH2 and KCNE2 genes, and identify 11 KCNH2 mutations, 6 of which were novel, and several polymorphisms in 40 families with LQTS.

Materials and Methods

DNA SAMPLES

Blood samples were collected from 40 unrelated patients referred to Statens Serum Institut for routine analysis for the presence of mutations causing LQTS. Detailed clinical descriptions of the patients will be presented elsewhere (M. Christiansen et al., manuscript in preparation). Genomic DNA was extracted from whole blood or filterpaper blood spots using a QIAamp reagent set (Qiagen GmbH).

PCR AMPLIFICATION

PCR was performed in 200-[micro]L, thin-walled PCR tubes in a total reaction volume of 50 [micro]L, containing 0.4-5 [micro]L of DNA template, 5 [micro]L of 10x reaction buffer [100 mM Tris-HCl (pH 8.85), 250 mM KCI, 50 mM [([NH.sub.4]).sub.2][SO.sub.4]]; 0.5-2.0 mM Mg[SO.sub.4] (optimized for each primer pair; see Table 1), 200 [micro]M dNTPs, and 1 U of Pwo DNA polymerase (Roche Molecular Biochemicals). The PCR primers are listed in Table 1. Thermal cycling was performed in a PTC200 DNA engine (MJ Research) with the following temperature profile: 94 [degrees]C for 4 min followed by 33 cycles of 94 [degrees]C for 20 s, 58 [degrees]C for 20 s, 72 [degrees]C for 40 s, and ending with a 7-min extension at 72 [degrees]C. Unincorporated primers were removed from the PCR reaction by spin columns according to the manufacturer's instructions (Qiagen) or by digestion of 15 [micro]L of PCR product with 5 U of exonuclease I for 1 h at 37 [degrees]C (Amersham Life Sciences).

MUTATION ANALYSIS

SSCP-HD analysis was performed on purified PCR products as follows: 1-5 [micro]L of PCR product was mixed with 15-19 [micro]L of formamide stop solution (U570725; Amersham) in a total volume of 20 [micro]L. The mixture was heated at 98 [degrees]C for 5 min and transferred directly to an ice-water bath. Sample/stop solution (8 [micro]L) was loaded on a precast 12.5% polyacrylamide gel (122 x 110 x 0.5 mm; Amersham Pharmacia Biotech). Electrophoresis was performed at 5 [degrees]C and 20 [degrees]C for 90 min (600 V; 25 mA) using a GenePhor apparatus (Amersham Pharmacia Biotech). Bands were visualized by silver staining using a Hoefer automated silver stainer and a PlusOne DNA silver staining reagent set according to the manufacturer's instructions (Pharmacia Biotech). Automated "Dye terminator" cycle sequencing (Perkin-Elmer) was performed directly on purified PCR products according to the manufacturer's instructions using an ABI373 DNA sequencer.

Results

Intronic PCR primer sequences were designed for robust amplification of the KCNH2 and KCNE1 exons, without nesting or additives (19, 20), under identical thermocycling conditions. The sequences, optimal Mg[SO.sub.4] concentrations, and optimal amounts of template are listed in Table 1. The PCR amplifications were performed using Pwo DNA polymerase, an enzyme with 3'-5' exonuclease activity, to reduce the risk of polymerase-induced errors and false-positive results caused by PCR fragments with +A overhangs (21). Excessive primers were removed from the PCR products before the SSCP-HD analysis by either spin columns or exonuclease I digestion. No differences in the resulting SSCP-HD band patterns were observed between the two clean-up procedures. Both led to clear, sharp bands (Fig. 1) and allowed for subsequent direct sequencing of the PCR fragments (data not shown). The use of precast gels made the analysis highly reproducible (data not shown).

Forty probands were screened for KCNH2 and KCNE2 mutations using SSCP-HD analysis. Fragments displaying abnormal conformers or heteroduplexes were sequenced using automated DNA sequencing. Examples of SSCP-HD band patterns are shown in Fig. 1. Nine missense mutations, one nonsense mutation, and a 9-bp in-frame duplication were found in KCNH2 (Table 2). Five of these mutations have been described previously (10,17, 19, 20, 23, 25, 26, 35), whereas six of the mutations are novel (82InsIAQ, I96T, K101E, R366X, I400N, and S621N).

None of the five known mutations was found among 50 wild-type controls, and none of the six novel mutations was found among 100 wild-type controls. A rare allelic variant of KCNH2 encoding an Arg1047Leu amino acid variant was found in 3 of 80 wild-type alleles (Table 3).

The rare amino acid polymorphism, Thr8Ala, described previously (4) was not found in any of the LQTS patients. It was, however, found in 1 of 168 wild-type alleles (Table 3).

We also identified eight different single-nucleotide polymorphisms (SNPs) in KCNH2 and one SNP in KCNE2 among the patients and the wild-type controls (Table 3). Five of these SNPs have not been described previously.

The 29 probands without mutations in KCNH2 were also screened for mutations in KCNQ1, KCNE1, and SCN5A, and several additional mutations were found (M. Christiansen et al., manuscript in preparation).

[FIGURE 1 OMITTED]

Discussion

We have developed a rapid screening method for detection of mutations in the KCNH2 and KCNE2 genes involved in congenital and acquired LQTS. The most important advantage of the method is that it is suitable for large-scale screening because the amplifications of KCNH2 and KCNE2 exons are performed under identical thermocycling conditions. This is an improvement over previously published methods, in which several annealing temperatures, additives, and/or nested PCR conditions were necessary to ensure amplification of all exons (19, 20). Furthermore, the use of exonuclease digestion eliminates the need for spin columns, making the method even more amenable for screening a large number of patients.

The combination of SSCP and HD has been shown previously (22) to increase the mutation detection rate compared with SSCP analysis alone. In this study, all mutations found were detectable by SSCP analysis alone. However, for some mutations, the difference between abnormal and normal55CP conformers were minor compared with a clear difference in the migration of the heteroduplexes (Fig. 1, B and C). Such weak differences in the SSCP patterns are very sensitive small variations in the electrophoresis conditions and may be missed if the detection is based on SSCP alone. Thus, although it has not been examined in a controlled study, we find it likely that the combined use of SSCP and HD, as described here, is more efficient than SSCP alone for mutation screening in the KCNH2 and KCNE2 genes. Furthermore, multiplexing and detection using automated capillary electrophoresis may increase performance even more (23).

A general testing strategy for the molecular diagnosis of LQTS, based on initial mutation screening, would be the following: (a) electrocardiographic measuring of the proband; (b) SSCP-HD screening of KCNH2 and KCNQ1; and (c) sequencing of abnormal conformers. If no mutations are found, the following would be performed: (a) SSCP-HD screening of SCN5A, KCNE1, and KCNE2 and (b) sequencing of abnormal conformers. When a suspected disease-causing mutation is found, the following would be performed: (a) SSCP-HD screening of 100 wild-type controls and (b) DNA sequencing of the mutated exon in all accessible family members.

We found 11 mutations in KCNH2 in 40 families with LQTS, and this number is to be expected from the distribution of LQTS-associated mutations in the published literature as compiled in the LQTSdbase (www.ssi.dk/en/forskning/lgtsdb.htm). Each mutation was found in only 1 proband and not in any of the 39 additional probands or in 50 wild-type controls. Furthermore, an additional 50 wild-type controls were screened for the presence of the six novel mutations. Thus, we find it unlikely that any of the 11 mutations listed in Table 2 are nonpathologic variants. However, the possibility of rare allelic variants cannot be fully excluded until functional analysis in a cell-based model system has been performed.

Interestingly, six of the mutations (five novel) were located N-terminally to the 51 transmembrane segment, in the PAS or PAS-51 domains (24), making it clear that it is necessary to screen the entire gene when looking for LQT2-associated mutations. In the early days of LQTS-genotyping, most KCNH2 mutations were found in the S4-S5-pore-S6 region, and the clinical phenotype was often (10, 25-27), but not always (17, 28), characterized by a dominant mode of inheritance and high penetrance caused by a pore-associated mutation affecting the whole tetrameric HERG ion channel in a dominant-negative way and thus making it possible for the mutation to be identified by linkage studies (10, 27). Recent functional studies have disclosed that many mechanisms may cause mutations in KCNH2 to produce LQTS (29).

However, despite the screening of the entire coding sequence and the surrounding intronic regions, an unknown number of LQTS-associated mutations may still be missed by the method presented here, e.g., mutations in upstream regulatory sequences, deletions of whole exons, or rare splice-site mutations outside of the amplified intronic segments. Such mutations may be found by genetic linkage analysis in large families or from inclusion of mutation analysis based on illegitimate mRNA expressed in leukocytes. The novel SNPs and amino acid polymorphisms defined here may be used for linkage studies.

The screening for mutations in the KCNE2 gene revealed only a previously published (4) rare amino acid variant, Thr8Ala. Thus, in agreement with the previous study, our data suggest that the direct involvement of MiRP1 in LQTS is rare. However, the existence of the Thr8Ala variant in MiRP1 and our discovery of a novel Arg1047Leu amino acid variant in the C-terminal region of HERG shows that rare amino acid variants exist in the population, as has been shown previously for KvLQT1 (30). Although no investigation has been performed to determine whether these allelic variants have a phenotypic effect, it is tempting to speculate that rare amino acid variants, such as Arg1047Leu, may be associated with a particular susceptibility toward certain drugs or hypokalemia, as suggested by another study showing that C-terminal mutations in HERG may become symptomatic in hypokalemic patients (28) or in patients with other known torsades de pointes-inducing factors.

Combinations of different polymorphisms in [alpha]--and [beta]-subunits of ion channels may explain the varying penetrance of LQTS, as well as the genetic linkage in the general population between LQT-linked loci and quantitative characteristics of the electrocardiogram (31), and possibly the relationship between prolongation of neonatal Q-T time and sudden infant death syndrome (32-34). The method presented here will make it possible to conduct large studies to clarify these issues.

We would like to thank Jette Rasmussen and Mads Dahm Johansen for excellent technical assistance. We gratefully acknowledge support from The Danish Heart Foundation, The Novo Nordisk Foundation, Laegeforeningens Forskningsfond, and Kong Christian den Tiendes Fond.

Revision received and accepted March 29, 2001.

References

(1.) Mitcheson JS, Sanguinetti MC. Biophysical properties and molecular basis of cardiac rapid and slow delayed rectifier potassium channels. Cell Physiol Biochem 1999;9:201-16.

(2.) Sanguinetti MC. Dysfunction of delayed rectifier potassium channels in an inherited cardiac arrhythmia. Ann N Y Acad Sci 1999; 868:406-13.

(3.) Ackerman MJ. The long QT syndrome: ion channel diseases of the heart. Mayo Clin Proc 1998;73:250-69.

(4.) Abbott GW, Sesti F, Splawski I, Buck ME, Lehmann MH, Timothy KW, et al. MiRP1 forms IKr potassium channels with HERG and is associated with cardiac arrhythmia. Cell 1999;97:175-87.

(5.) Suessbrich H, Busch AE. The IKs channel: coassembly of IsK (minx) and KvLQT1 proteins. Rev Physiol Biochem Pharmacol 1999;137:191-226.

(6.) Viskin S. Long QT syndromes and torsade de pointes. Lancet 1999;354:1625-33.

(7.) Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, Van Raay TJ, et al. Positional cloning of a novel potassium channel gene: KVLQTI mutations cause cardiac arrhythmias. Nat Genet 1996; 12:17-23.

(8.) Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, Keating MT. Mutations in the hminKgene cause long QT syndrome and suppress IKs function. Nat Genet 1997;17:338-40.

(9.) Schwartz PJ, Priori SG, Locati EH, Napolitano C, Cantu F, Towbin JA, et al. Long QT syndrome patients with mutations of the SCN5A and HERG genes have differential responses to [Na.sup.+] channel blockade and to increases in heart rate. Implications for gene-specific therapy. Circulation 1995;92:3381-6.

(10.) Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell 1995;80:795-803.

(11.) Taglialatela M, Castaldo P, Pannaccione A, Giorgio G, Genovese A, Marone GM, et al. Cardiac ion channels and antihistamines: possible mechanisms of cardiotoxicity. Clin Exp Allergy 1999; 29(Suppl 3):182-9.

(12.) Rampe D, Murawsky MK, Grau J, Lewis EW. The antipsychotic agent sertindole is a high affinity antagonist of the human cardiac potassium channel HERG. J Pharmacol Exp Ther 1998;286:78893.

(13.) Dumaine R, Roy ML, Brown AM. Blockade of HERG and Kv1.5 by ketoconazole. J Pharmacol Exp Ther 1998;286:727-35.

(14.) Suessbrich H, Schonherr R, Heinemann SH, Attali B, Lang F, Busch AE. The inhibitory effect of the antipsychotic drug haloperidol on HERG potassium channels expressed in Xenopus oocytes. Br J Pharmacol 1997;120:968-74.

(15.) Kiehn J, Thomas D, Karle CA, Schols W, Kubler W. Inhibitory effects of the class III antiarrhythmic drug amiodarone on cloned HERG potassium channels. Naunyn Schmiedebergs Arch Pharmacol 1999;359:212-9.

(16.) Larsen LA, Fosdal I, Andersen PS, Kanters JK, Vuust J, Wettrell G, et al. Recessive Romano-Ward syndrome associated with compound heterozygosity for two mutations in the KVLQTI gene. Eur J Hum Genet 1999;7:724-8.

(17.) Priori SG, Napolitano C, Schwartz PJ. Low penetrance in the long-QT syndrome: clinical impact. Circulation 1999;99:529-33.

(18.) Donger C, Denjoy I, Berthet M, Neyroud N, Cruaud C, Bennaceur M, Chivoret G, et al. KVLQTI C-terminal missense mutation causes a forme fruste long-QT syndrome. Circulation 1997;96: 2778-81.

(19.) Itoh T, Tanaka T, Nagai R, Kamiya T, Sawayama T, Nakayama TT, et al. Genomic organization and mutational analysis of HERG, a gene responsible for familial long QT syndrome. Hum Genet 1998;102:435-9.

(20.) Splawski I, Shen J, Timothy KW, Vincent GM, Lehmann MH, Keating MT. Genomic structure of three long QT syndrome genes: KVLQTI, HERG, and KCNE1. Genomics 1998;51:86-97.

(21.) Hayashi K. Recent enhancements in SSCP. Genet Anal 1999;14: 193-6.

(22.) Axton RA, Hanson IM, Love J, Seawright A, Prosser J, van Heyningen V. Combined SSCP/heteroduplex analysis in the screening for PAX6 mutations. Mol Cell Probes 1997;11:287-92.

(23.) Larsen LA, Christiansen M, Vuust J, Andersen PS. High-throughput single-strand conformation polymorphism analysis by automated capillary electrophoresis: robust multiplex analysis and pattern-based identification of allelic variants. Hum Mutat 1999;13:318-27.

(24.) Chen J, Zou A, Splawski I, Keating MT, Sanguinetti MC. Long QT syndrome-associated mutations in the Per-Arnt-Sim (PAS) domain of HERG potassium channels accelerate channel deactivation. J Biol Chem 1999;274:10113-8.

(25.) Satler CA, Vesely MR, Duggal P, Ginsburg GS, Beggs AH. Multiple different missense mutations in the pore region of HERG in patients with long QT syndrome. Hum Genet 1998;102:265-72.

(26.) Larsen LA, Svendsen IH, Jensen AM, Kanters JK, Andersen PS, Moller M, et al. Long QT syndrome with a high mortality rate caused by a novel G572R missense mutation in KCNH2. Clin Genet 2000;57:125-30.

(27.) Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell 1995;81:299307.

(28.) Berthet M, Denjoy I, Donger C, Demay L, Hammoude H, Klug DM, et al. C-terminal HERG mutations: the role of hypokalemia and a KCNQ1-associated mutation in cardiac event occurrence. Circulation 1999;99:1464-70.

(29.) Roden DM, Balser JR. A plethora of mechanisms in the HERG-related long QT syndrome. Genetics meets electrophysiology [Editorial; Comment]. Cardiovasc Res 1999;44:242-6.

(30.) Itoh T, Tanaka T, Nagai R, Kikuchi K, Ogawa S, Okada S, et al. Genomic organization and mutational analysis of KVLQTI, a gene responsible for familial long QT syndrome. Hum Genet 1998;103: 290-4.

(31.) Busjahn A, Knoblauch H, Faulhaber HD, Boeckel T, Rosenthal M, Uhlmann RA, et al. QT interval is linked to 2 long-QT syndrome loci in normal subjects. Circulation 1999;99:3161-4.

(32.) Schwartz PJ. Stramba Badiale M, Segantini A, Austoni P, Bosi G, Giorgetti R, et al. Prolongation of the QT interval and the sudden infant death syndrome. N Engl J Med 1998;338:1709-14.

(33.) Schwartz PJ, Priori SG, Dumaine R, Napolitano C, Antzelvitch C, Stramba-Badaile M, et al. A molecular link between the sudden infant death syndrome and the long QT syndrome. N Engl J Med 2000;343:262-7.

(34.) Christiansen M, Larsen LA, Fosdal I, Svendsen IH, Andersen PS, Kanters JK, et al. Long QT syndrome. Genotype-phenotype relationship and relation to sudden infant death syndrome. Am J Hum Genet 1999;65(Suppl):A289.

(35.) Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta K, et al. Four novel KVLQTI and four novel HERG mutations in familial long-QT syndrome. Circulation 1997;95:565-7.

(36.) Akimoto K, Furutani M, Imamura S, Furutani Y, Kasanuki H, Takao AK, et al. Novel missense mutation (G601S) of HERG in a Japanese long QT syndrome family. Hum Mutat 1998;1:S184-6.

[8] Nonstandard abbreviations: LQTS, long Q-T syndrome; SSCP-HD, single-strand conformation polymorphism-heteroduplex; and SNP, single-nucleotide polymorphism.

LARS ALLAN LARSEN, [1] PAAL SKYTT ANDERSEN, [1] JORGEN KANTERS, [2] IDA HASTRUP SVENDSEN, [3] JOES RAMSOE JACOBSEN, [4] DENS VUUST, [1] GORAN WETTRELL, [5] LISBETH TRANEBJAERG, [6] JORN BATHEN, [7] and MICHAEL CHRISTIANSEN [1] *

[1] Department of Clinical Biochemistry, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen, Denmark.

[2] Department of Medical Physiology, University of Copenhagen, DK-2200N Denmark.

[3] Departments of Medicine B and [4] Pediatrics, Rigshospitalet, DK-2200O Copenhagen, Denmark.

[5] Department of Pediatric Cardiology, Lund University Hospital, S-221 00 Lund, Sweden.

[6] Department of Medical Genetics, Tromso University Hospital, 9037 Tromso, Norway.

[7] Department of Cardiology, Regional Hospital of Trondheim, 7004 Trondheim, Norway.

* Address correspondence to this author at: Department of Clinical Biochemistry, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark. Fax 45-32-68-38-78; e-mail mic@ssi.dk.
Table 1. Intronic PCR primers for amplication
of the coding regions of KCNH2and KCNE2.

Oligonucleotide Amplified Optimal Template
sequence, from 5' to 3' region, MgS[O.sub.4] volume,
 exon no. concentration, mL
 mM

KCNH2
GCCACCCGAAGCCTAGTGCT 1 0.5 0.4
CACGCCCCCCCATCCACAC
GGTCCCGTCACGCGCACTCT 2 0.75 4
TTGACCCCGCCCCTGGTCGT
GGGCTATGTCCTCCCACTCT 3 0.75 2
AGCCTGCCCTAAAGCAAGTACA
CGACCACGTGCCTCTCCTCTCC 4 0.75 2
GAGCCCTGCCACGTGGTTGTCC
GCTGGCCCTGGACGAAGTGACA 4 0.75 2
CCCAGAATGCAGCAAGCCTG
GCCCTGACCACGCTGCCTCT 5 1 2
CCCTCTCCAAGCTCCTCCAA

CAGAGATGTCATCGCTCCTG 6 2 2
CAGGCGTAGCCACACTCGGTAG
CGACGTGCTGCCTGAGTACAA 6 0.75 2
CACCTCCTCGTTGGCATTGAC
TTCCTGCTGAAGGAGACGGAAG 6 0.75 2
TACACCACCTGCCTCCTTGCTGA
TGCCCCATCAACGGATGTGC 7 0.75 2
CAGCCAGCCGATGCGTGAGTCCA
TAGCCTGCATCTGGTACGC 7 0.75 2
GCCCGCCCCTGGGCACACTCA
TGGGGTCCCTGCAGAGGCTGAC 8 0.75 2
CTTCCCAGCCTGCCACCCACTG
GGCCTGGAGGTTGAGATTTC 9 0.75 2
GCGGTGCATGTGTGGTCTTG
GCACTGCAAACCCTTCCGAG 9 0.75 2
GGCATTTCCAGTCCAGTGC
TGAGCTCCCTGTCCTCTCCATG 10 0.75 2
CTCAGGGCAGCCAACTCACATC
GGTGGGGCAGGAGAGCACTG 11 0.75 2
TCCCCCGCCTCACCCTTGTC
TCTCTGTTCTCCTCCCCTCTC 12 1 5
GCCCGGAATACCTGACAGG
TCACCCAGCTCTGCTCTCTG 13 0.75 2
AGGCCCTCTCCCTCTACCAG
ATCCCGGTGGAGGCTGTCA 14 0.75 2
GAACAAGCGGGTCACGGTAC
TCCTGTCCTCCCCTCCATC 15 0.75 2
ACGTGTCCACACTGGGCAG
KCNE2
TCCGTTTTCCTAACCTTGTTC 1.5 1
GCCACGATGATGAAAGAGAAC 1.5 1
GATGCTGAGAACTTCTACTATG 1.5 1
GTCTGGACGTCAGATGTTAG 1.5 1

Oligonucleotide Size of Reference
sequence, from 5' to 3' amplicon,
 bp

KCNH2
GCCACCCGAAGCCTAGTGCT 231 This study
CACGCCCCCCCATCCACAC This study
GGTCCCGTCACGCGCACTCT 312 20
TTGACCCCGCCCCTGGTCGT 20
GGGCTATGTCCTCCCACTCT 213 20
AGCCTGCCCTAAAGCAAGTACA 20
CGACCACGTGCCTCTCCTCTCC 230 This study
GAGCCCTGCCACGTGGTTGTCC This study
GCTGGCCCTGGACGAAGTGACA 361 This study
CCCAGAATGCAGCAAGCCTG 20
GCCCTGACCACGCTGCCTCT 293 20
CCCTCTCCAAGCTCCTCCAA 20
CAGAGATGTCATCGCTCCTG 295 20
CAGGCGTAGCCACACTCGGTAG 20
CGACGTGCTGCCTGAGTACAA 301 19
CACCTCCTCGTTGGCATTGAC 19
TTCCTGCTGAAGGAGACGGAAG 296 19
TACACCACCTGCCTCCTTGCTGA 19
TGCCCCATCAACGGATGTGC 240 19
CAGCCAGCCGATGCGTGAGTCCA 19
TAGCCTGCATCTGGTACGC 277 19
GCCCGCCCCTGGGCACACTCA 19
TGGGGTCCCTGCAGAGGCTGAC 289 This study
CTTCCCAGCCTGCCACCCACTG This study
GGCCTGGAGGTTGAGATTTC 258 This study
GCGGTGCATGTGTGGTCTTG This study
GCACTGCAAACCCTTCCGAG 222 19
GGCATTTCCAGTCCAGTGC 19
TGAGCTCCCTGTCCTCTCCATG 243 This study
CTCAGGGCAGCCAACTCACATC This study
GGTGGGGCAGGAGAGCACTG 163 This study
TCCCCCGCCTCACCCTTGTC This study
TCTCTGTTCTCCTCCCCTCTC 331 This study
GCCCGGAATACCTGACAGG This study
TCACCCAGCTCTGCTCTCTG 300 This study
AGGCCCTCTCCCTCTACCAG This study
ATCCCGGTGGAGGCTGTCA 287 19
GAACAAGCGGGTCACGGTAC 19
TCCTGTCCTCCCCTCCATC 281 19
ACGTGTCCACACTGGGCAG 19
KCNE2
TCCGTTTTCCTAACCTTGTTC 255 This study
GCCACGATGATGAAAGAGAAC This study
GATGCTGAGAACTTCTACTATG 289 This study
GTCTGGACGTCAGATGTTAG This study

Table 2. KCNH2 mutations associated with LQTS.

Mutation Nucleotide Amino acid Coding
no. change (a) change effect

1 87 C3A F29L Missense
2 244-252ins9 82-84insIAQ Duplication
3 287 T3C I96T Missense
4 391 A3G K101E Missense
5 1096 C3T R366X Nonsense
6 1199 T3A I400N Missense
7 1600 C3T R534C Missense
8 1682 C3T A561V Missense
9 1714 G3C G572R Missense
10 1862 G3A S621N Missense
11 1886 A3G N629S Missense

Mutation Region Exon Reference
no.

1 PAS 2 20
2 PAS 2 This study
3 PAS 2 This study
4 PAS 2 This study
5 Pre S1 5 This study
6 S1 6 This study
7 S4 7 19
8 S5 7 10, 17, 35
9 S5-Pore 7 26
10 Pore 7 This study
11 Pore 7 23, 25

(a) Numbering according to GenBank Accession No. U04270.
ATG start codon was assigned to position 1.

Table 3. Polymorphisms in KCNH2 and KCNE2 found
in the Danish population.

Mutation Allelic Type of
no. variant (a) polymorphism
KCNH2
1 1056 C/T SNP
2 1467 C/Tb SNP
3 1539 C/Tb SNP
4 1692 A/G SNP
5 1956 T/C SNP
6 IVS8 261 A/G SNP
7 IVS13 112 C/A SNP
8 IVS13 122 A/G SNP
9 Arg1047Leu Amino acid
KCNE2
1 228 A/G SNP
2 Thr8Ala Amino acid

 Frequency of alleles
Mutation
no. Allele Frequency Allele Frequency
KCNH2
1 C 0.995 T 0.005
2 C 0.82 T 0.18
3 C 0.82 T 0.18
4 A 0.58 G 0.42
5 C 0.62 T 0.38
6 A 0.50 G 0.50
7 A 0.01 C 0.99
8 A 0.10 G 0.90
9 Arg 0.96 Leu 0.04
KCNE2
1 A 0.982 G 0.018
2 Thr 0.994 Ala 0.006

Mutation ??. of Reference
no. alleles
KCNH2
1 200 This study
2 92 36
3 92 36
4 78 36
5 94 23
6 66 This study
7 80 This study
8 80 This study
9 80 This study
KCNE2
1 168 This study
2 168 4

(a) Numbering according to GenBank Accession No. U04270
(KCNH2) and NM_005136 (KCNE2). ATG start codon was
assigned to position 1.

(b) Total linkage disequillibrium was observed for
1467 C/T and 1539 C/T (e.g., all individuals with the
genotype 1467 CC were also 1539 CC).
COPYRIGHT 2001 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Larsen, Lars Allan; Andersen, Paal Skytt; Kanters, Jorgen; Svendsen, Ida Hastrup; Jacobsen, Joes Ram
Publication:Clinical Chemistry
Date:Aug 1, 2001
Words:4109
Previous Article:Solid-phase amplification for detection of C282Y and H63D hemochromatosis (HFE) gene mutations.
Next Article:Vitamin [B.sub.12] treatment normalizes metabolic markers but has limited clinical effect: a randomized placebo-controlled study.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters