Printer Friendly

Screening for candidate genes related with histological microstructure, meat quality and carcass characteristic in pig based on RNA-seq data.

INTRODUCTION

Analyzing transcriptomes using next generation sequencing methods (RNA-seq) has been useful in various applications: estimation of gene expression; identification of novel genes or transcripts; and detection of genomic variants, gene fusion and RNA editing [1,2]. According to numerous studies, calling variants from RNA-seq data has many advantages. First, RNA sequencing is less cost-intensive compared to genome sequencing, and often, genomic variants can be identified from the existing RNA-seq data [3]. Furthermore, the comparison of single nucleotide polymorphism (SNP) panels obtained from animals differing in the levels of given traits can be useful in searching for the genetic background of analyzed traits. To date, the most efficient and reliable methods of SNP calling from RNA-seq data have been validated [4,5].

In pigs, an RNA-seq approach enabled Jung et al [6] to detect nonsynonymous single nucleotide variations potentially related to enzyme activity in porcine liver. Moreover, the authors showed that selected SNPs were associated with pork quality and could be used in marker-assisted selection in future pig breeding programs. Transcriptome sequencing of liver tissue collected from four different pig breeds enabled the identification of non-synonymous SNPs within genes coding for enzymes that are critical during post-mortem metabolic process in muscle [7]. Using RNA-seq data, Piorkowska et al [8] compared distributions of genetic variants detected in two breeds with extreme fatness parameters and identified genes involved in fatty acid metabolism and lipid storage, which can be potential genetic markers associated with meat quality in pigs. Conversely, Fisher et al [9] detected non-synonymous mutations with a possible influence on porcine reproduction traits using transcriptome data obtained after RNA sequence from oviduct and testis tissue.

It has been well-established that percentage number of fiber types in muscle determines metabolic properties and water holding capacity of muscle tissue, as well as marbling, intramuscular fat (IMF) level, meat color and texture [10-12]. In our previous study performed on Large White pigs, we identified genes differentially expressed in muscle contingent on histological microstructure [13]. According to the differential expression and biological function, several genes were selected with possible effect on variation of fiber-type distribution. Thus, the aim of the present study was to identify genetic variants based on RNA-seq data, obtained via transcriptome sequencing of muscle tissue of pigs differing in muscle histological structure. The second aim was to select the most interesting variants, based on transcriptome-wide association study, and to verify the theirs effect on production traits and histological microstructure in a larger pig population.

MATERIALS AND METHODS

RNA-seq data

The SNPs in coding and untranslated regions (UTR) were identified based on RNA-seq data obtained previously by Ropka-Molik et al [13]. Whole transcriptome sequencing was performed on longissimus lumborum samples collected from 11 Large White pigs that differed in the histological structure of this muscle. Pigs (unrelated sows) were maintained under the same housing and feeding conditions and slaughtered at final body weight of 100 kg ([+ or -]2.5 kg). Immediately after slaughter, muscle samples were collected and stored at -20[degrees]C in RNAlater solution (Ambion Inc., Austin, TX, USA) for RNA-seq application and at -80[degrees]C for histological analysis. The details of the animals used, the RNA-seq experiment and histological analysis were described in a previous study focused on differential expression analysis [13].

SNPs identification and association study based on RNA-seq data

Quality control of the raw RNA-seq data was performed using FastQC (v0.11.4; Illumina, San Diego, CA, USA). Adapters, poly-A sequences, and reads with a quality score lower than 20 and a fragment size reads lower than 36 bp were removed using the Flexbar tool (v.2.5GNU General Public License version 3.0 [GPLv3]). The cleaned reads were mapped to a Sus scrofa reference genome (Sscrofa10.2) using STAR aligner [14]. Next, reads containing Ns (N cigar elements) were split (CIGAR string), and base quality score recalibration, INDEL realignment, duplicate removal, and identification of SNPs and INDELs (small insertions and deletions) were performed using Picard and GATK software packages [15]. The filtering parameters were as follows: FisherStrand value>50, QualByDepth<2.0, RMS mapping quality<40, quality<40 and a SnpCluster filter. The genome annotation of identified polymorphisms was established using SnpEff 4.1b and Variant Effect Predictor (EMBL-European Bioinformatics Institute, Hinxton, Cambridge, UK) [16], and for downstream association analysis, only SNPs located within coding regions were selected (5'prime UTR variants; missense variants; synonymous variants; 3'prime UTR variants; noncoding transcript exon variants).

The association analysis for additive (fixed) effect of SNP was carried out for percentage and diameter of the I, IIA, and IIB types of fibers. The whole procedure was implemented in R-project. SNPs were considered significant if they met the following criteria: frequency (chisq p<0.05), a minimum of 9 observations, and a significant association analysis (p<0.05).

QTLs identification

The differential expressed genes (DEGs) identified by RNAseq, and genes with SNPs (based on whole coding sequence analysis) significantly associated with percentage and/or diameter of I, IIA, and IIB types of fibers were mapped to quantitative trait loci (QTL) regions. The QTLs positions were taken from Animal Quantitative Trait Loci Database (Animal QTLdb) [17], which corresponds to the genome release used in this study (Sscrofta10.2, Ensemble database). We used R script [18] prepared by us to conduit the whole procedure. Based on RNA-seq results, 355 DEGs were mapped to QTLs regions. In contrast, based on the transcriptome-wide association study, 222 polymorphisms correlated with at least two histological traits and located within 149 genes were selected to the subsequent analysis.

Candidate genes--association study on a larger population

For an association study, four genes were selected based on high gene expression differences during RNA-seq analysis and their location within QTLs related to percentage of fibers I, IIA, and IIB (troponin T2 [TNNT2]; forkhead box O1 [FOXO1]). Two additional polymorphisms within two genes related to analyzed histological properties (transforming acidic coiled-coil-containing protein 2 [TACC2]; delta 4-desaturase, sphingolipid 1 [DEGS1]) were selected as significant based on the transcriptome-wide association study. For all genes, genotypes were assessed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method (TNNT2; TACC2; DEGS1) and polymerase chain reaction-artificially created restriction site (PCR-ACRS) method (FOXO1). The details of the analyses were presented in Table 1.

For the downstream association study, a larger pig population comprising 944 animals representing five breeds (Landrace n = 306, Large White n = 345, Pietrain n = 80, Duroc n = 61, native Pulawska breed n = 152) was used. All pigs (sows) were unrelated at least three generations back and were maintained under the same housing and feeding conditions according to Pig Test Station procedures. In the Test Station pigs are slaughtered, dissected and after carcass evaluation, meat is standard intended for consumption, thus research does not require the approval of Animal Experimentation committee. Pigs were fattened from 30 kg up to 100 ([+ or -]2.5) kg according to test procedures described previously by Ropka-Molik et al [19] and were slaughtered and dissected. For all animals, the following carcass characteristic traits were measured: weight of loin (kg), loin "eye" area (cm) and lean meat percentage (%). Furthermore, several meat quality traits were measured for selected animals: IMF content (the Soxhlet method) [20] and meat color (redness, a*; yellowness, b*; and lightness, L* parameters; Minolta Chroma Meter CR-310; Osaka, Japan) (699 pigs). The determination of meat color was performed using Chroma Meter CR-310 with a pulse xenon arc lamp D65 and 50 mm orifice. The a*, b*, and L* parameters were assessed 24 h post mortem on muscle tissue samples (longissimus lumborum; 150 to 200 g). The analysis was performed in two measurement points for each sample.

For selected animals, in total 293 (Landrace n = 110, Large White n = 70, Duroc n = 20, Pulawska pigs n = 93), longissimus muscle samples were collected immediately after slaughter and histological profile--percentage and diameter of the I, IIA, and IIB types of fibers--were estimated according to the procedure described previously by Ropka-Molik et al [13]. The animals used to histological analysis were randomly selected from population included in association study. Tissue samples (frozen at -80[degrees]C) were cut on 10 [micro]m thick slides using a cryostat (Slee MEV, Mainz, Germany) and then fibers were detected using NADPH dehydrogenase (diaphorase) method. Myosin heavy chains (MHCs) were detected immunohistochemically with NCL-MHC antibodies (Leica, Novocasta, Leider Lane, Buffalo Grove, IL, USA) and NovoLink Polymer Detection Systems (Zalesie Gorne, Poland) (Leica, Novocasta, USA) [21]. The obtained preparations were analyzed in terms of the percentage content of types of muscle fibers (I, IIA, IIB) and their diameter using the Nikon Eclipse 50i light microscope and MultiScan image analysis software (ver. 18.03; Sony, Tokyo, Japan). In each histological sample, the analysis covered a minimum of 300 fibers of each types. The percentage of fiber types was calculated based on 10 bundles measurements.

The statistical analysis for all selected genes was performed using the general linear model (GLM) procedure in SAS software (SASv. 8.02; Wadowice, Poland) and the model used was:

[Y.sub.ijk] = [mu]+[f.sub.i]+[h.sub.j]+[alpha]([x.sub.ij])+[e.sub.ijk]

Where, [Y.sub.ijk], the trait measured; [mu], the overall mean for the trait; [f.sub.i], the fixed effect of j genotype group of analyzed gene; [h.sub.j], the fixed effect of k breed; [alpha]([x.sub.ij]), covariate with weight of right half-carcass for selected slaughter traits; [e.sub.ijk], random error.

The correlation coefficients between histological features and carcass characteristics and meat quality traits were calculated using Pearson correlation method (SAS software, SASv. 8.02, Poland).

RESULTS

SNP identification and transcriptome-wide association analysis

Based on RNA-seq data, 65,535 SNPs were identified. After filtering according to the criteria outlined above, 51,590 SNPs were selected for use in the association study. The significant association of SNPs and percentage of I, IIA, and IIB fiber types were identified (p<0.05; 560, 251, and 837; respectively) (Table 2). We identified the panel of SNPs significantly related to the diameter of each fiber type. Few polymorphisms affected fiber I and IIB diameters compared to those that were associated with percentage of the same fiber types (Table 3). Our results show that the most numerous polymorphisms were 3'UTR variants, while the least numerous variants in each histological trait (both parentage and diameter of all fiber types) were 5'UTR variants and missense mutations (Tables 2, 3). The list of all SNPs significantly associated with histological traits is presented in Supplementary Table S1 available online (goo.gl/VAHcUs).

Several polymorphisms/genes influenced more than one analyzed histological trait, simultaneously affecting the percentage and the diameter of the fibers. The identified panel of genes was the basis for selecting significant SNPs for subsequent GLM analysis performed on a larger population. From such genes, we selected the TACC2, DEGS1, and FOXO1 genes, which were related to multiple histological properties.

Genes mapping to QTLs

Based on the pig QTL database (pigQTLdb), DEGs (n = 355) identified by the RNA-seq, were located within QTLs related with fiber percentage and diameter (78 and 65, respectively). The most interesting locus seems to be on chromosome 14, at which 23 genes located in regions affecting percentage of I and IIA fibers were identified. DEGs localized in QTLs associated with percentage of fiber type IIB were identified mainly on chromosome 2 (SSC2) and SSC10 (Supplementary Table S2). The most represented QTLs related with muscle fiber diameter were identified on SSC12 and SSC15; SSC2, SSC14 and SSC15; SSC2 and SSC14 (diameter of fibers I, IIA, and IIB; respectively) (Supplementary Table S3). On chromosome 14, 13 DEGs associated with diameter of both fibers IIB and IIA were mapped to four QTL regions (Supplementary Table S3).

After the transcriptome-wide association study, 149 genes were selected (222 SNPs) and mapped to QTL regions. Results showed that chromosome 14, on which four QTLs were identified (related with percentage of fiber type I: QTLs #2822 and #2824; and IIB fiber type: #2823 and #7044), was the most overrepresented (Table 4). Also, on SSC10, four QTLs were identified, but these were represented by low numbers of genes (#7012 and #7026, percentage of fiber type I; #7031 and #7034, percentage of fiber type IIA) (Table 4). In the case of diameter of fiber, the higher numbers of genes were detected on SSC14 and SSC3 within QTL regions associated with diameter of fiber types IIA and IIB (Table 5).

Association of selected SNPs with carcass characteristic and pork quality traits

Based on findings of other authors indicating relations of histological structure and meta quality and carcass traits [10-12], we also performed an association study on a large number of pigs. For this analysis four genes were selected: TNNT2; FOXO1; TACC2; DEGS1. These genes were previously identified as differentially expressed between muscle characterized by different histological properties; were localized within QTL regions associated with percentage of fiber types (FOXO1, IIB and IIA; TNNT2 and DEGS1, I and IIA), and contained SNPs potentially related with muscle microstructure. Moreover, subsequent GLM analysis showed significant relationships of FOXO1, DEGS1, and TNNT2 genes with loin 'eye' area, FOXO1 with loin weight, as well as FOXO1 and TACC2 with lean meat percentage. Furthermore, the significant (p<0.01) effect of polymorphisms within DEGS1, TACC2, and TNNT2 genes on IMF content was detected (Table 6). Only a small extent of SNPs was associated with pork color. TACC2 polymorphism showed an effect on value of a* color parameter and TNNT2 polymorphism influenced the b* color parameter (Table 6).

Association of selected SNPs with histological microstructure of muscle tissue

The association study performed on a large number of animals (293 samples of longissimus muscle) confirmed significant effect of FOXO1 and TACC2 genes on histological characteristics in pigs. FOXO1 was associated with diameter of fiber types IIA and IIB (p<0.01) (Table 7). The lowest diameter of both fiber types was detected in pigs with GG genotype, while the highest diameter was observed in heterozygote pigs. Conversely, a missense variant analyzed in the TACC2 locus showed a significant effect on diameter of fibers I and IIA and percentage of fiber type IIB. Our results showed that pigs with the AA genotype were characterized by the lowest diameter of fibers I and IIA, as well as the lowest percentage of fiber type IIB (Table 7).

Furthermore, our result confirmed also significant correlation between selected histological traits and carcass characteristic. The diameters of all fiber types were positively, significant correlated with weight of loin. Diameters of fibers I and IIA was also correlated with lean meat percentage, while diameter of fibers I and IIB with meat color parameter, yellowness (b*) (Table 8). Percentage of fiber types was only corelated with loin 'eye' area (percentage of fiber I and IIB) (Table 8). For the other analyzed traits, the significant correlations were not obtained.

DISCUSSION

Currently, much focus is placed on improving meat quality traits in pig breeding programs while maintaining satisfactory levels of meat and fatness characteristics [22]. Research has been performed on refining pork quality through different methods including environmental conditions (maintenance, nutrition), animal transport, slaughter procedures, and genetics. One of the factors determining pork quality is fiber types distribution in muscle tissue [23,24], which can be affected by genetic background [25,26]. However, the genetic basis of muscle fiber structure has not been well understood.

The present study is a continuation of previous research concerning identification of genes determining muscle fiber structure in pigs [13]. The differential expression analysis was performed on pigs representing one breed (Large White) to avoid an influence of breed factor on gene expression profile. The comparison of global gene expression profiles enabled us to detect the panel of genes that can play a role in formation of muscle fiber such as TNNT2, FOXO1, myosin XVIIIB, FERM domain containing 4B, and scavenger receptor class a member 5 [13]. The SNP calling analysis is a next step facilitating the search for candidate genes and establishing the exact genetic basis of phenotypic traits. In our research, the wide-transcriptome association study, performed as a preliminary analysis, allowed us to select the most important genetic variants potentially related with histological profile in muscle, the effects of which were validated on a large pig population.

Mapping both DEGs and SNPs significantly correlated with muscle microstructure to the known QTLs showed that a high number of genes were localized on SSC14. The most over-represented were QTL regions associated with percentage of fiber type I (ID#2822 and #2824), IIB (ID#2823 and #7024), and diameter of fibers IIA (ID#7038) and IIB (ID#7018). These results were consistent with previous findings of Wimmers et al [26] (QTLs #2822; #2823; #2824) and Estelle et al [27] (QTLs #7018; #7024; #7038), who mapped QTLs associated with size and percentage of fibers on SSC14 and SSC15. These genome regions also span QTLs related with meat quality traits: pork color--redness and lightness [28], as well as fatness traits--abdominal fat weight and IMF content [29]. This may indicate that identified genes can affect some production traits in pigs.

Genome location was one of the selection criteria of genes for the subsequent GLM analysis. The association study carried out on a larger group of animals confirmed the significant effect of scrutinized polymorphisms in FOXO1 and TACC2 genes on some histological characteristics. A prior study [13] indicated differential expression of the FOXO1 gene between pigs characterized by various percentages of fiber types I and IIB. The results obtained by transcriptome-wide association analysis, supplemented with information on genes localization in QTLs regions, were confirmed for both FOXO1 and TACC2. The most interesting gene seems to be TACC2 coding for transforming acidic coiled-coil protein 2. The RNAseq approach enabled us to detect several polymorphisms within the TACC2 gene. For the association study, the missense variant within TACC2 locus was selected (p.Arg2613Cys) due to the highly potential results on protein structure, as well as biological function.

Our results show that investigated SNP in TACC2 gene affected diameter of both fiber types I and IIA and percentage amount of fiber IIB. The same polymorphism was also significantly related with lean meat percentage as well as IMF content. In the cell cycle, TACC2 protein is involved in G2/M progression [30] by playing a key role in microtubule dynamics. It has been established that the TACC2 gene is a critical factor controlling mitotic spindle dynamics during the normal course of the mitosis process [30]. To date, scarce research has investigated the involvement of the TACC2 gene in fiber type specification or muscle growth, even though this gene is highly expressed in skeletal and cardiac muscle. Our study suggested that transforming acidic coiled-coil protein 2 could play an important role during muscle fiber differentiation, resulting in modification of the number and size of muscle fibers. In turn, the differences in histological features are related to muscle mass and/or meat quality traits. The fiber composition in muscle is related with fatty acid and glycogen content due to the type of energy sources. The fiber type I is characterized by high fatty acid storage and low glycogen content, whereas the opposite trend is observed for the fiber type IIB. The observed missense variant changing arginine to cysteine in two different TACC2 isoforms (ENSSSCP00000029 474.1 :p.Arg795Cys; ENSSSCP00000025150.1:p.Arg2613Cys) may affect function of synthesized proteins. Our results confirmed previous findings that percentage amount of type fiber IIB is inversely related with IMF [11]. According to the TACC2 missense variant, pigs with the AA genotype had significantly lower numbers of fiber type IIB and higher IMF content.

Conversely, our results indicated significant association between a FOXO1 mutation and diameter of fibers IIA and IIB and carcass characteristics such as weight of loin, loin 'eye' area and lean meat percentage. Furthermore, the significant correlation was observed between diameter of all fiber types and weight of loin. A previous study [13] showed differential expression of the FOXO1 gene depends on histological microstructure of muscle tissue. Moreover, our current research, which confirmed a significant relationship of a 3'UTR variant in the FOXO1 gene with fiber diameter, suggests that the analyzed SNP can affect FOXO1 transcript levels and histological profile as a result. Schiaffino and Mammucari [31] showed that FOXO proteins can regulate skeletal muscle growth via interaction with the IGF1-Akt/PKB pathway. Moreover, the research performed on transgenic mice confirmed that over-expression of the FOXO1 gene leads to muscle atrophy and increases transcript level of cathepsin L [32]. Researchers demonstrated that skeletal muscle of mice overexpressing FOXO1 was characterized by decrease size of both fiber types I and II, likewise reducing the number of fiber type I. Subsequently, the up-regulation of the cathepsin L gene can indicate increasing protein degradation processes in muscle tissues. The FOXO1 gene has been considered as a main genetic factor closely associated with muscle fiber type specification and skeletal muscle differentiation [33]. Our results confirmed that in pigs, the FOXO1 gene is related to muscle mass, as well as size of fiber types IIA and IIB, and should be investigated in the future for relation with important production traits.

Our results did not show the significant association of DEGS1 and TNNT2 genes with histological traits. However, polymorphisms identified in both genes affected loin 'eye' area and lean meat content in carcasses. This suggests that detected SNPs can be related with muscle growth processes but do not affect histological structure of muscle tissue at the same time. Furthermore, there is also the possibility of occurrence of another polymorphism within the DEGS1 and TNNT2 loci (in promoter or intron regions), which are associated with gene expression, and as a result, with cell size and fiber type distribution.

CONCLUSION

The use of RNA-seq data enabled us to identify a panel of SNPs within coding and UTRs regions with potential effects on histological microstructure. The genes detected by differential expression and the transcriptome-wide association analyses enabled us to select candidate genes potentially related to distribution of fiber types in porcine muscle tissue. These results can inform future studies evaluating the use of selected SNPs as genetic markers related to muscle histological profile and production traits in pig breeding.

https://doi.org/10.5713/ajas.17.0714

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

ACKNOWLEDGMENTS

The study was supported by statutory activity of the National Research Institute of Animal Production (project no 01-014.1).

REFERENCES

[1.] Wang Z, Gerstein M, Snyder M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 2009;10:57-63.

[2.] Ramaswami G, Zhang R, Piskol R, et al. Identifying RNA editing sites using RNA sequencing data alone. Nat Methods 2013;10:128-32.

[3.] Piskol R, Ramaswami G, Li JB. Reliable identification of genomic variants from RNA-seq data. Am J Hum Genet 2013;93: 641-51.

[4.] Canovas A, Rincon G, Islas-Trejo A, Wickramasinghe S, Medrano JF. SNP discovery in the bovine milk transcriptome using RNA-Seq technology. Mamm Genome 2010;21:592-8.

[5.] Lopez-Maestre H, Brinza L, Marchet C, et al. SNP calling from RNA-seq data without a reference genome: identification quantification differential analysis and impact on the protein sequence. Nucleic Acids Res 2016;44:e148.

[6.] Jung WY, Kwon SG, Son M, et al. RNA-Seq approach for genetic improvement of meat quality in pig and evolutionary insight into the substrate specificity of animal carbonyl reductases. PLoS One 2012;7:e42198.

[7.] Lee YH, Cho ES, Kwon EJ, et al. Non-synonymous SNP in the ApoR gene associated with pork meat quality. Biosci Biotechnol Biochem 2011;75:2018-20.

[8.] Piorkowska K, Zukowski K, Tyra M, Ropka-Molik K. Detection of genetic variants different between Polish Landrace and Pulawska pigs by means of RNA-seq analysis. Anim Genet 2018;49:215-25.

[9.] Fischer D, Laiho A, Gyenesei A, Sironen A. Identification of reproduction-related gene polymorphisms using whole transcriptome sequencing in the Large White pig population. G3 (Bethesda) 2015;5:1351-60.

[10.] Joo ST, Kim GD, Hwang YH, Ryu YC. Control of fresh meat quality through manipulation of muscle fiber characteristics. Meat Sci 2013;95:828-36.

[11.] Bereta A, Tyra M, Ropka-Molik K, et al. Histological profile of the longissimus dorsi muscle in Polish Large White and Polish Landrace pigs and its effect on loin parameters and intramuscular fat content (IMF). Ann Anim Sci 2014;14:955-66.

[12.] Shen LY, Luo J, Lei HG, et al. Effects of muscle fiber type on glycolytic potential and meat quality traits in different Tibetan pig muscles and their association with glycolysis-related gene expression. Genet Mol Res 2015;14:14366-78.

[13.] Ropka-Molik K, Bereta A, Zukowski K, et al. Transcriptomic gene profiling of porcine muscle tissue depending on histological properties. Anim Sci J 2017;88:1178-88.

[14.] Dobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013;29:15-21.

[15.] McKenna A, Hanna M, Banks E, et al. The genome analysis toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 2010;20:1297-303.

[16.] Cingolani P, Platts A, Wang LL, et al. A program for annotating and predicting the effects of single nucleotide polymorphisms SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012;6:80-92.

[17.] R Core Team. R: A language and environment for statistical computing [internet]. Vienna, Austria: R Foundation for Statistical Computing; 2017. Available from: https://www.R-project. org/

[18.] Hu ZL, Park CA, Reecy JM. Developmental progress and current status of the Animal QTLdb. Nucleic Acids Res 2016; 44:D827-33.

[19.] Ropka-Molik K, Dusik A, Piorkowska K, et al. Polymorphisms of the membrane-associated ring finger 4 ubiquitin protein ligase gene (MARCH4) and its relationship with porcine production traits. Livest Sci 2015;178:18-26.

[20.] Oczkowicz M, Tyra M, Ropka-Molik K, Mucha A, Zukowski K. Effect of IGF2 intron3-g. 3072G>A on intramuscular fat (IMF) content in pigs raised in Poland. Livest Sci 2012;149: 301-4.

[21.] Wojtysiak D, Kaczor U. Effect of g.2728G>A and g.3996 T>C polymorphisms at the leptin gene locus on microstructure and physicochemical properties of longissimus lumborum muscle of Polish Landrace pigs. Folia Biol 2011;59:77-82.

[22.] Zak G, Pieszka M. Improving pork quality through genetics and nutrition. Ann Anim Sci 2009;9:327-39.

[23.] Karlsson AH, Klont RE, Fernandez X. Skeletal muscle fibres as factors for pork quality. In: Quality of meat and fat in pigs as affected by genetics and nUTRition. Wageningen, The Netherlands: Wageningen Academic Publishers; 2000. pp. 47-67.

[24.] Wu F, Zuo JJ, Yu QP, et al. Effect of skeletal muscle fibers on porcine meat quality at different stages of growth. Genet Mol Res 2015;14:7873-82.

[25.] Nii M, Hayashi T, Mikawa S, et al. Quantitative trait loci mapping for meat quality and muscle fiber traits in a Japanese wild boarxLarge White intercross. J Anim Sci 2005;83:308-15.

[26.] Wimmers K, Fiedler I, Hardge T, et al. QTL for microstructural and biophysical muscle properties and body composition in pigs. BMC Genet 2006;7:15.

[27.] Estelle J, Gil F, Vazquez JM, et al. A quantitative trait locus genome scan for porcine muscle fiber traits reveals overdominance and epistasis. J Anim Sci 2008;86:3290-9.

[28.] de Koning DJ, Harlizius B, Rattink AP, et al. Detection and characterization of quantitative trait loci for meat quality traits in pigs. J Anim Sci 2001;79:2812-9.

[29.] Jiao S, Maltecca C, Gray KA, Cassady JP. Feed intake average daily gain feed efficiency and real-time ultrasound traits in Duroc pigs: II. Genomewide association. J Anim Sci 2014;92: 2846-60.

[30.] Takayama K, Horie-Inoue K, Suzuki T, et al. TACC2 is an androgen-responsive cell cycle regulator promoting androgen-mediated and castration-resistant growth of prostate cancer. Mol Endocrinol 2012;26:748-61.

[31.] Schiaffino S, Mammucari C. Regulation of skeletal muscle growth by the IGF1-Akt/PKB pathway: insights from genetic models. Skelet Muscle 2011;1:4.

[32.] Kamei Y, Miura S, Suzuki et al. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass down-regulated Type I (slow twitch/red muscle) fiber genes and impaired glycemic control. J Biol Chem 2004;279:41114-23.

[33.] Xu M, Chen X, Chen D, Yu B, Huang Z. FoxO1: a novel insight into its molecular mechanisms in the regulation of skeletal muscle differentiation and fiber type specification. Oncotarget 2017;8:10662-74.

Katarzyna Ropka-Molik (1), *, Anna Bereta (2), Kacper Zukowski (2), Mirostaw Tyra (2), Katarzyna Piorkowska (1), Grzegorz Zak (2), and Maria Oczkowicz (1)

* Corresponding Author: Katarzyna Ropka-Molik

Tel: +48-666-081-208; Fax: +48-12-422-80-65, E-mail: katarzyna.ropka@izoo.krakow.pl

(1) Department of Genomics and Animal Molecular Biology, National Research Institute of Animal Production, Krakowska 1, Balice 32-083, Poland

(2) Department of Animal Genetics and Breeding, National Research Institute of Animal Production, Krakowska 1, Balice 32-083, Poland

ORCID

Katarzyna Ropka-Molik

https://orcid.org/0000-0002-8555-0495

Anna Bereta

https://orcid.org/0000-0002-0792-2732

Kacper Zukowski

https://orcid.org/0000-0002-5690-3634

Mirostaw Tyra

https://orcid.org/0000-0001-8221-3461

Katarzyna Piorkowska

https://orcid.org/0000-0002-4368-9624

Grzegorz Zak

https://orcid.org/0000-0001-6857-1588

Maria Oczkowicz

https://orcid.org/0000-0001-8975-0200

Submitted Sept 21, 2017; Revised Dec 13, 2017; Accepted Mar 5, 2018
Table 1. Detailed information about the analyzed genes
and SNPs along with the methods used

Gene    Accession number     SNP             SNP variant

TNNT2   ENSSSCG00000023031   c.294T>C        splice region variant/
                             (rs330309370)   synonymous variant
FOXO1   ENSSSCG00000009370   c. *1395A>G     3' prime UTR variant
                             (rs337841578)
TACC2   ENSSSCG00000028063   c.7837C >T      missense variant
                             p.Arg2613Cys
                             (rs80840610)
DEGS1   ENSSSCG00000024484   c. *250T > C    3' prime UTR variant
                             (rs344988843)

Gene    Accession number     Primers                     Endonuclease

TNNT2   ENSSSCG00000023031   F CACGCCTCCTTCTGTTCATC      HpyCH4IV
                             R CAGCTCCTCCTCCTCCTTCT
FOXO1   ENSSSCG00000009370   F TCAGCAAGTTTTCCCTCTGTaCT   HpyCH4III
                             R CCCCAGCTTAACTTTCCAGA
TACC2   ENSSSCG00000028063   F GCTGAGGTGTTCGTTGTGAA      AluI
                             R TGCACGATTGACGCTTTTAG

DEGS1   ENSSSCG00000024484   F AGACGAGCCCCTCGTACAAT      HpyCH4IV
                             R GAACTCCCAGGCCTTTTCA

Gene    Accession number     Obtained alleles (bp)

TNNT2   ENSSSCG00000023031   T: 334
                             C: 255, 79
FOXO1   ENSSSCG00000009370   A: 154
                             G: 131, 23
TACC2   ENSSSCG00000028063   C: 200, 121, 56, 16
                             T: 200, 89, 56, 32, 16
DEGS1   ENSSSCG00000024484   T: 361
                             C: 211, 150

SNP, single nucleotide polymorphism; TNNT2, troponin T2;
FOXO1, forkhead box O1; TACC2, transforming acidic
coiled-coil-containing protein 2; DEGS1, delta 4-desaturase,
sphingolipid 1.

Table 2. Number of identified polymorphisms and selected genes
significantly associated with percentage of all fiber types

Fiber   SNPs   Gene (N)   Genetic variants
type

I       560    630        5 prime UTR variant
                          Synonymous variant

                          Missense variant
                          3 prime UTR variant

                          Non coding transcript
                          exon variant, non coding
                          transcript variant
IIA     251    299        5 prime UTR variant
                          Synonymous variant
                          Missense variant
                          3 prime UTR variant

                          Non coding transcript
                          exon variant, non coding
                          transcript variant
IIB     837    921        5 prime UTR variant

                          Synonymous variant

                          Missense variant
                          3 prime UTR variant

                          Non coding transcript
                          exon variant, non coding
                          transcript variant

Fiber   SNPs   Genes
type    (N)

I       19     MAFF; SCO2; MRTO4; SDHB; CD151; MRTO4
        150    MYH7; COL5A1; SETX; TNNI1;ACE; MYH3;
               SLC15A4; SLC25A37;ATIC; CAST; CNOT11;CHD7
        66     SLC16A5; MYO18B; FBXO7; DECR1; PINK1; SLC16A5; HEBP2
        300    SLC17A5; MYO1E; TGFB2; DEGS1; SLC16A6; RPTOR; TACO1;
               BMP1; BMP6; MTR; TMX2; ILF2; GLO1
        25     TXLNA; SSH2; MYH7; GPX3; RPIA;ACE; SGCA

IIA     10     TMED7; UQCC3; GTF2F1
        80     MYBPC1; PER1; ITGB7; BIN1; TRRAP; ITGB7; LIN7B; SUN2
        31     TACC2; PROB1; MLH1; HCR; PISD; SERPINB1
        127    CASP2; BMPER; MAFB; VIPR1; SLC9A3R1; COL4A2; PPP1R9B;
               CRP
        3      TACC2; ZCCHC6

IIB     33     SLC2A12; MARC2;AQP3;ACO1; MYH13; GOT1; TACC2;
               MYLK2;
        261    TACC2;APP; PLCD1; MYH13; TSN; GOT1; MYLK2; BRAF;
               SLC43A2; COL4A1; MARC2
        91     TACC2; MARCHS; LTF; MTO1; CAST; FYCO1; LIFR
        439    DEGS1; FOXO1; AKT3; FYN; RPTOR; SCARA5; BMPR2; SRFBP1;
               TAGLN2; TGFB1; GLO1
        13     TACC2; SSH2; LAT; ARNT; KLRB1; TNFRSF21

N, number of identified genes; SNP, single nucleotide polymorphisms.

Table 3. Number of identified polymorphisms and selected genes
significantly associated with diameter of all fiber types

Fiber   SNPs   Gene   Genetic variants
type           (N)

I       91     112    5 prime UTR variant
                      Synonymous variant
                      Missense variant
                      3 prime UTR variant

                      Non coding transcript
                      exon variant, non coding
                      transcript variant
IIA     139    162    5 prime UTR variant
                      Synonymous variant

                      Missense variant
                      3 prime UTR variant

                      Non coding transcript
                      exon variant, non coding
                      transcript variant
IIB     33     39     5 prime UTR variant
                      Synonymous variant
                      Missense variant
                      3 prime UTR variant

Fiber   SNPs   Fiber type
type    (N)

I       6      MYL9; TMEM258; MAP2K2
        29     TACC2; GPX3; CA3; HP; NOB1; MYH7; PIK3C3;ATAT1
        14     TACC2; FBXO7; BCAR1; HSF4; ELL2; TMEM5
        38     ESR1; ERG; ITGB1; TACC2; MARCH6; TTL; CHD1L; HP;
               HYI; ATAT1
        4      TACC2; SGCA

IIA     5      CAPN3; PFDN4; MAFF; NOL1U; FGFR1OP2; INTS3
        42     ACE; TACC2; ERBB2; NRBF2; HPS6; E2F6; SUN2; ILF2;
               RYR1; ENO1; AARS;
        15     TACC2; SIRT3;ACAT2; FLAD1; RFX5; C4A; GSTM3
        72     FOXO1; ITGB1; STX7; OAS2; CD82; HOXC6; PRR3;
               SLC29A1; STK38; RPTOR;
        5      TACC2;ACE; SGCA; CD8A

IIB     1      TMEM258
        15     TRRAP; HP; HK1; SLC35B1; NXN;ADAM17; LUM
        3      TACC2; BCAR1; HEATR5A
        14     GOT1; OTULIN; GPAM; YBX3; SMUG1; IDH3A; ZSCAN31

N, number of identified genes; SNPs,
single nucleotide polymorphisms.

Table 4. Genes obtained after transcriptome-wide association
study mapped to QTL regions related to percentage of fiber
types I, IIA, and IIB

I fiber type     SSC          QTL ID

RGP1             1     2794
IKBKAP                 2794
MARC2            10    7012   7026
C1orf115               7012   7026
DEGS1                  7012   7026
RABIF                  7012   7026
C9orf64                7012   7026
ANAPC7           14    2822   2824
PPTC7                  2822   2824
AP1B1                  2822   2824
MTR                    2822   2824
ARV1                   2822   2824
RAB4A                  2822   2824
SUPV3L1                2822   2824     4022
EXOSC1                 2822   2824
GOT1                   2822   2824

IIA fiber type   SSC          QTL ID

CCDC28A          1     7015
KCNQ5                  7015
APIP             2     4025
RPS13                  4025   7016
DHPS                   4025   7016
MARC2            10    7034
C1orf115               7034
DEGS1                  7034
RABIF                  7034
C9orf64                7031
NRP1                   7031
VPS36            11    7030
MAP3K14          12    7033
TUBG2                  7033
NKIRAS2                7033
ZNF385C                7033
CNP                    7033
TTC25                  7033

IIB fiber type   SSC          QTL ID

VPS36            11    7020   7023     7042
WRAP53           12    7021   7036
DHRS7C                 7021   7036
ANAPC7           14    2823   7024
PPTC7                  2823   7024
AP1B1                  2823   7024
MTR                    2823   7024
ARV1                   2823   7024
RAB4A                  2823   7024
SUPV3L1                2823   7024     4045
EXOSC1                 2823
GOT1                   2823
FAM45A                 7044
TACC2                  7044

QTL, quantitative trait loci. SSC, chromosome 2.

Table 5. Genes obtained after transcriptome-wide association
study mapped to QTL regions related to percentage of fiber
types I, IIA, and IIB

I fiber type     SSC   QTL ID

SCRN2            12    2819        2821
UTP18                  2819        2821
TOM1L1                 2819        2821
WRAP53                 2819        2821
FASTKD1          15    2832
HNRNPA3                2832

IIA fiber type   SSC   QTL ID

SLF1             2     2797
CAST                   2797
ANAPC7           14    7018
PPTC7                  7018
AP1B1                  7018
MTR                    7018
ARV1                   7018
RAB4A                  7018
SUPV3L1                7018
FAM45A                 2827
TACC2                  2827
PAF1                   2827

IIB fiber type   SSC   QTL ID

RGP1             1     2795
IKBKAP                 2795
TTL              3     7037
UXS1                   7037
IL1R1                  7037
MAP4K4                 7037
NAGK                   7037
PCYOX1                 7037
EFEMP1                 7037
MTIF2                  7037
FEZ2                   7037
CRIM1                  7037
HDGF             4     2807        2810
PAQR6                  2807        2810
RFX5                   2807        2810
ANAPC7           14    7038
PPTC7                  7038
AP1B1                  7038
MTR                    7038
ARV1                   7038
RAB4A                  7038
SUPV3L1                7038
FAM45A                 2828
TACC2                  2828
PAF1                   2828

QTL, quantitative trait loci; SSC, chromosome 2.

Table 6. Association of analyzed polymorphisms with
carcass and meat quality traits

                                         FOXO1

Items                  Genotype     LSM [+ or -] SE

Weight of loin (kg)       AA      6.07 [+ or -] 0.03 (a)
                          AG      6.11 [+ or -] 0.04 (a)
                          GG      5.93 [+ or -] 0.10 (b)
Loin 'eye' area (cm)      AA      52.6 [+ or -] 0.26 (b)
                          AG      54.7 [+ or -] 0.54 (a)
                          GG      53.5 [+ or -] 0.12 (ab)
Lena meat percentage      AA      61.4 [+ or -] 0.14 (b)
                          AG      61.5 [+ or -] 0.23 (b)
                          GG      62.7 [+ or -] 0.04 (a)
IMF                       AA      1.40 [+ or -] 0.02
                          AG      1.36 [+ or -] 0.03
                          GG      1.38 [+ or -] 0.11
L*                        AA      54.15 [+ or -] 0.12
                          AG      54.03 [+ or -] 0.21
                          GG      54.01 [+ or -] 0.45
a*                        AA      16.89 [+ or -] 0.08
                          AG      17.02 [+ or -] 0.14
                          GG      17.04 [+ or -] 0.38
b*                        AA      3.24 [+ or -] 0.10
                          AG      3.41 [+ or -] 0.18
                          GG      3.58 [+ or -] 0.54

                                       DEGS1

Items                  Genotype   LSM [+ or -] SE

Weight of loin (kg)       TT      6.11 [+ or -] 0.04
                          CT      6.03 [+ or -] 0.03
                          CC      6.05 [+ or -] 0.03
Loin 'eye' area (cm)      TT      53.3 [+ or -] 0.52 (a)
                          CT      53.7 [+ or -] 0.46 (a)
                          CC      52.1 [+ or -] 0.33 (b)
Lena meat percentage      TT      61.5 [+ or -] 0.27
                          CT      61.8 [+ or -] 0.18
                          CC      61.4 [+ or -] 0.20
IMF                       TT      1.36 [+ or -] 0.06 (b)
                          CT      1.37 [+ or -] 0.03 (b)
                          CC      1.46 [+ or -] 0.03 (a)
L*                        TT      54.10 [+ or -] 0.22
                          CT      54.06 [+ or -] 0.14
                          CC      54.30 [+ or -] 0.20
a*                        TT      16.84 [+ or -] 0.14
                          CT      17.00 [+ or -] 0.10
                          CC      16.84 [+ or -] 0.14
b*                        TT      3.38 [+ or -] 0.17
                          CT      3.25 [+ or -] 0.12
                          CC      3.26 [+ or -] 0.19

                                        TACC2

Items                  Genotype   LSM [+ or -] SE

Weight of loin (kg)       CC      6.06 [+ or -] 0.08
                          CT      6.11 [+ or -] 0.03
                          TT      6.02 [+ or -] 0.03
Loin 'eye' area (cm)      CC      52.8 [+ or -] 0.84
                          CT      54.0 [+ or -] 0.42
                          TT      52.8 [+ or -] 0.32
Lena meat percentage      CC      60.6 [+ or -] 0.38 (b)
                          CT      61.5 [+ or -] 0.19 (ab)
                          TT      61.9 [+ or -] 0.17 (a)
IMF                       CC      1.44 [+ or -] 0.09 (a)
                          CT      1.39 [+ or -] 0.03 (AB)
                          TT      1.35 [+ or -] 0.03 (B)
L*                        CC      53.64 [+ or -] 0.51
                          CT      54.06 [+ or -] 0.16
                          TT      54.25 [+ or -] 0.13
a*                        CC      17.21 [+ or -] 0.06 (a)
                          CT      17.07 [+ or -] 0.12 (ab)
                          TT      16.80 [+ or -] 0.09 (b)
b*                        CC      3.82 [+ or -] 0.40
                          CT      3.42 [+ or -] 0.14
                          TT      3.14 [+ or -] 0.12

                                        TNNT2

Items                  Genotype   LSM [+ or -] SE

Weight of loin (kg)       TT      6.07 [+ or -] 0.02
                          TC      6.11 [+ or -] 0.07
                          CC      5.96 [+ or -] 0.27
Loin 'eye' area (cm)      TT      53.3 [+ or -] 0.25 (ab)
                          TC      54.9 [+ or -] 0.87 (a)
                          CC      51.7 [+ or -] 3.10 (b)
Lena meat percentage      TT      61.4 [+ or -] 0.13
                          TC      62.8 [+ or -] 0.35
                          CC      61.5 [+ or -] 0.78
IMF                       TT      1.35 [+ or -] 0.02 (C)
                          TC      1.56 [+ or -] 0.08 (b)
                          CC      2.00 [+ or -] 0.31 (a)
L*                        TT      54.2 [+ or -] 0.11
                          TC      53.4 [+ or -] 0.30
                          CC      52.7 [+ or -] 0.96
a*                        TT      17.03 [+ or -] 0.08
                          TC      16.91 [+ or -] 0.20
                          CC      17.04 [+ or -] 0.73
b*                        TT      3.46 [+ or -] 0.10 (b)
                          TC      3.23 [+ or -] 0.19 (b)
                          CC      5.23 [+ or -] 1.37 (a)

FOXO1, forkhead box O1; DEGS1, delta 4-desaturase, sphingolipid 1;
TACC2, transforming acidic coiled-coil-containing protein 2; TNNT2,
troponin T2; LSM, least squares mean; SE, standard error;
IMF, intramuscular fat content; a*, b*, L*, meat colour parameters.

(a,b) p <0.05; (A,B,C) p<0.01.

Table 7. Association of selected polymorphisms with muscle
microstructure traits

                                       FOXO1

Items                      Genotype   LSM [+ or -] SE

Percentage of fiber type
  I                        AA         12.3 [+ or -] 0.33
                           AG         12.3 [+ or -] 0.42
                           GG         12.2 [+ or -] 1.11
  IIA                      AA         16.8 [+ or -] 0.45
                           AG         16.4 [+ or -] 0.47
                           GG         15.8 [+ or -] 0.84
  IIB                      AA         71.3 [+ or -] 0.48
                           AG         71.3 [+ or -] 0.65
                           GG         71.9 [+ or -] 1.44
Diameter of fiber type
  I                        AA         54.4 [+ or -] 0.69
                           AG         56.2 [+ or -] 0.84
                           GG         53.3 [+ or -] 2.50
  IIA                      AA         55.8 [+ or -] 0.63 (A)
                           AG         56.9 [+ or -] 0.83 (A)
                           GG         50.6 [+ or -] 1.78 (b)
  IIB                      AA         71.6 [+ or -] 0.82 (ab)
                           AG         73.6 [+ or -] 1.07 (a)
                           GG         67.0 [+ or -] 2.44 (b)

                                     DEGS1

Items                      Genotype   LSM [+ or -] SE

Percentage of fiber type
  I                        TT         12.6 [+ or -] 0.44
                           CT         12.5 [+ or -] 0.37
                           CC         12.0 [+ or -] 0.50
  IIA                      TT         17.1 [+ or -] 0.53
                           CT         16.7 [+ or -] 0.54
                           CC         15.8 [+ or -] 0.45
  IIB                      TT         70.3 [+ or -] 0.71
                           CT         71.2 [+ or -] 0.54
                           CC         72.1 [+ or -] 0.69
Diameter of fiber type
  I                        TT         55.2 [+ or -] 1.10
                           CT         55.4 [+ or -] 0.81
                           CC         55.1 [+ or -] 0.89
  IIA                      TT         55.8 [+ or -] 1.00
                           CT         55.5 [+ or -] 0.73
                           CC         56.3 [+ or -] 0.78
  IIB                      TT         71.3 [+ or -] 1.24
                           CT         72.2 [+ or -] 0.97
                           CC         71.3 [+ or -] 1.03

                                     TACC2

Items                      Genotype   LSM [+ or -] SE

Percentage of fiber type
  I                        CC         12.4 [+ or -] 0.90
                           CT         12.1 [+ or -] 0.34
                           TT         12.7 [+ or -] 0.39
  IIA                      CC         15.9 [+ or -] 0.97
                           CT         15.7 [+ or -] 0.41
                           TT         17.4 [+ or -] 0.50
  IIB                      CC         67.5 [+ or -] 1.60 (b)
                           CT         73.2 [+ or -] 0.55 (a)
                           TT         71.6 [+ or -] 0.51 (a)
Diameter of fiber type
  I                        CC         52.0 [+ or -] 1.35 (b)
                           CT         55.4 [+ or -] 0.88 (a)
                           TT         55.8 [+ or -] 0.76 (a)
  IIA                      CC         54.0 [+ or -] 1.73 (b)
                           CT         56.2 [+ or -] 0.79 (a)
                           TT         55.7 [+ or -] 0.64 (ab)
  IIB                      CC         67.5 [+ or -] 1.80
                           CT         73.2 [+ or -] 1.01
                           TT         71.6 [+ or -] 0.88

                                     TNNT2

Items                      Genotype   LSM [+ or -] SE

Percentage of fiber type
  I                        TT         12.4 [+ or -] 0.26
                           TC         12.6 [+ or -] 0.98
                           CC         11.1 [+ or -] 2.62
  IIA                      TT         16.3 [+ or -] 0.33
                           TC         16.6 [+ or -] 0.86
                           CC         12.4 [+ or -] 4.04
  IIB                      TT         71.2 [+ or -] 0.38
                           TC         70.7 [+ or -] 1.34
                           CC         76.4 [+ or -] 6.60
Diameter of fiber type
  I                        TT         55.3 [+ or -] 0.55
                           TC         55.2 [+ or -] 1.64
                           CC         56.9 [+ or -] 8.01
  IIA                      TT         56.0 [+ or -] 0.50
                           TC         54.3 [+ or -] 1.54
                           CC         55.9 [+ or -] 5.06
  IIB                      TT         71.9 [+ or -] 0.66
                           TC         71.6 [+ or -] 1.97
                           CC         75.4 [+ or -] 5.60

FOXO1, forkhead box O1; DEGS1, delta 4-desaturase, sphingolipid 1;
TACC2, transforming acidic coiled-coil-containing protein 2;
TNNT2, troponin T2; LSM, least squares mean; SE, standard error.

(a,b) p <0.05; (A,B) p<0.01.

Table 8. The obtained significant correlation coefficients between
percentage or diameter of fiber types and carcass characteristics

Items     Weight of   Loin eye    Lean meat      b *
          loin(kg)    area (cm)   percentage

Percentage of fiber type
I            ns       -0.20 **        ns         ns
IIA          ns          ns           ns         ns
IIB          ns        0.12 *         ns         ns

Diameter of fiber type
I          0.12 *        ns         0.15 *     0.20 **
IIA        0.21 **       ns        -0.17 *       ns
IIB        0.15 **     0.11 *         ns       0.16 *

(b)*, yellowness; ns, not significant.
* p<0.05; ** p<0.01.
COPYRIGHT 2018 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Ropka-Molik, Katarzyna; Bereta, Anna; Zukowski, Kacper; Tyra, Mirostaw; Piorkowska, Katarzyna; Zak,
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Date:Oct 1, 2018
Words:7107
Previous Article:Monitoring conservation effects on a Chinese indigenous chicken breed using major histocompatibility complex B-G gene and DNA Barcodes.
Next Article:Selection response and estimation of the genetic parameters for multidimensional measured breast meat yield related traits in a long-term breeding...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters