Printer Friendly

STAPHYLO COCCUS PSEUDINTERMEDIUS ISOLATION FROM CANINE, BACTERIAL COLONIZATION AND CLINICAL PICTURE IN BALB/C MOUSE MODEL.

Byline: D. H. Kalhoro, S. Gao, M. S. Kalhoro, F. Parveen, M. Tariq, S. A. Pirzado and Y. J. Liu

ABSTRACT

Staphylococcus pseudintermedius is an emerging pathogen causing respiratory infection in dogs. In this experiment pathogenicity characteristic of S. pseudintermedius were determined. The research was mainly focused on three aspects including bacterial load, histopathological changes and virulence factors. BALB/c mice were intranasaly inoculated with S. pseudintermedius. The results showed that the bacteria can cause serious neurologic symptoms including walking in circles, bending of neck and produces obvious histopathological changes in lung and brain of the mice. In lungs and brain higher levels of bacterial load was observed during present study. Of all 11 oxacillin-resistant isolates of S. pseudintermedius, 2 carried SCCmec types II-III, 2 carried SCCmec I and 3 carried SCCmec types III according to PCR-based SCCmec typing. Exfoliative toxin (siet), lukS and luk F genes were also identified from the isolates.

Keywords: Staphylococcus pseudintermedius, Mouse model, Bacterial load, Histopathology, Virulence factors.

INTRODUCTION

Respiratory problems are common in dogs. A varying flora of bacterial pathogens is normally present in the respiratory tract of the canines without causing any clinical signs. Methicillin-resistant Staphylococcus pseudintermedius (MRSP) is coagulase positive staphylococci identified by Devriese et al., (2005) has emerged globally in companion animals in the last decade (Damborget al., 2016) and is the most important opportunistic pathogen which belongs to the normal microbiota of companion animals andhumans (Bardiu et al., 2013;Van Duijkeren et al., 2011). Organism is isolated from groin and forehead, nares, mouth, anus of healthy dogs and cats (Abraham et al., 2007; Griffeth et al., 2008),mostly associated with skin, wound infection, otitis, pyoderma and urinary tract infections (Bannoehr and Guardabassi, 2012; Weese et al., 2009).

MRSP infections are generally linked with outbreaks (Weese and Van Duijkeren, 2010), colonization of healthy animals and contact of the persons working with the animals so they become carriers (Boost et al., 2011; Hanselman et al., 2008). It was reported from PFGE analysis, that pet owners suffering from deep pyoderma can carry the organism (Guardabassi et al., 2004), and recent reports confirmed transmission of MRSP from pets to their owners (Frank et al., 2009; Soedarmanto et al., 2011) and to veterinary staff working in the Veterinary clinics and staff owned healthy dogs carried MRSP of same resistance pattern and PFGE profile as the patients (Van Duijkeren et al., 2008). Methicillin resistance of S. pseudintermedius is mediated by mecA gene located on the chromosome of the bacterium on a mobile element called the 'staphylococcal chromosomal cassette' (SCCmec) (Weese and Van Duijkeren, 2010).

These elements can be transferred between different staphylococcal species (Wielders et al., 2002). S. pseudintermedius (previously S. intermedius) carry several virulence factors i.e coagulase, clumping factors, haemolysin and leukotoxin, pyogenic toxins comprising staphylococcal enterotoxins, toxic shock syndrome toxin 1, and S. intermediusexfoliative toxin (Futagawa-Saito et al., 2004). Another S. pseudintermediusexfoliative toxin (SIET) showed a rounding effect on cultured epithelial cells. SIET Animal models were used to observe the effect of exfoliative in day old chickens, hamsters and dogs, but not in rats and mice. Dogs injected with SIET showed symptoms of erythema, exfoliation and crusting, which were similar to human staphylococcal scalded skin syndrome and porcine exudative epidermitis, canine pyoderma(Terauchi et al., 2003).

Like Panton Valentine leucocidinleukotoxin of S. aureus, S. (pseud) intermedius also produces a bicomponentleukotoxin, Luk-I encoded by two cotranscribed genes, lukS and lukF(Futagawa-Saito et al., 2004; Prevost et al., 1995) a leukotoxin known as Luk-I having leucotoxicity towards polymorphonuclear cells (Futagawa-Saito et al., 2004) but only a little haemolytic activity on rabbit erythrocytes (Prevost et al., 1995). S. pseudintermedius produces an immunoglobulin-binding staphylococcal protein A (spa) that binds to the IgG from the fc portion, thereby affecting its ability of opsoninsation(Moodley et al., 2009) and form biofilms like S. aureus(Futagawa-Saito et al., 2006). Complete genome sequence of S. pseudintermedius was published recently for better understanding of the pathogenesis of S.pseudintermedius(Zakour et al., 2011).

The aim of this study was toinvestigate the occurrence and characteristics of S. pseudintermediusisolates and develop a mouse model to examine the factors associated with infection.

MATERIALS AND METHODS

Ethics statement: Before conducting the study, approval for conducting the experiments was obtained from Ethical Committee for Animal Experiments of Nanjing Agricultural University, China.

Isolation and Identification:Forty nasal swabs were taken from dogs having respiratory symptoms, such as coughing, sneezing and copious nasal discharge. Samples were collected from Animal Clinics of Nanjing Agricultural University in Jiangsu Province of China to isolate S. pseudintermedius.PCR amplification of 16S rRNA gene was performed for the confirmation of the bacteria using a pair of oligonucleotide primer (5'AGAGTTTGATCMTGGCTCA/TACGGYTACCTT GTTACGACTT-3').

Detection of virulence factors: PCR assay was used and tested for the presence of mecA gene. Antibiotic oxacillin was used to detect resistant isolates of S. pseudintermedius for SCC mectypingas described by some reports (Baron et al., 2004, Zhang et al., 2005). Leukocid in genes viz lukS, lukF and siet were also identified (Becker et al., 1998; Futagawa-Saito et al., 2004; Lautz et al., 2006). The information of primers is shown in Table 1.

Table1. Primers used for PCR analysis.

Primer###Oligonucleotide sequence (5'3')###Amplicon size (bp)###References

SEC###GGCGGCAATATTGGCGCTCG###271###(Becker et al., 1998)

###TTACTGTCAATGCTCTGACC

Sea###GCGAAACACACAATGCTTGC###127###(Becker et al., 1998)

###GGAGGAATATAACCACGCGC

Seb###GTGGCTGGCGGTGAGTCACG###477###(Becker et al., 1998)

###GAGTGAAGGTAGCCGTGGC

SIET###CCTAAATGAATAATAACTGTAATTACGG###359###(Lautz et al., 2006)

###TGGCAATATCATGAGCAGCGTTGCTG

LUK F###CCTGTCTATGCCGCTAATCAA###572###(Futagawa-Saito et al.,

###AGGTCATGGAAGCTATCTCGA###2004)

LUK S###TGTAAGCAGCAGAAAATGGGG###503###(Futagawa-Saito et al.,

###GCCCGATAGGACTTCTTACAA###2004)

CIF2 F2###TTCGAGTTGCTGATGAAGAAGG###495###(Oliveira and de

CIF2 R2###ATTTACCACAAGGACTACCAGC###Lencastre, 2002)

RIF4 F3###GTGATTGTTCGAGATATGTGG###243###(Oliveira and de

RIF4 R9###CGCTTTATCTGTATCTATCGC###Lencastre, 2002)

DCS F2###CATCCTATGATAGCTTGGTC###342###(Oliveira and de

DCS R1###CTAAATCATAGCCATGACCG###Lencastre, 2002)

MECA P4###TCCAGATTACAACTTCACCAGG###162###(Oliveira and de

MECA P7###CCACTTCATATCTTGTAACG###Lencastre, 2002)

MECI P2###ATCAAGACTTGCATTCAGGC###209###(Oliveira and de

MECI P3###GCGGTTTCAATTCACTTGTC###Lencastre, 2002)

Type I-F###GCTTTAAAGAGTGTCGTTACAGG###613###(Zhang et al., 2005)

Type I-R###GTTCTCTCATAGTATGACGTCC

Type III-F###CCATATTGTGTACGATGCG###280###(Zhang et al., 2005)

Type III-R###CCTTAGTTGTCGTAACAGATCG

Type V-F###GAACATTGTTACTTAAATGAGCG###325###(Zhang et al., 2005)

Type V-R###TGAAAGTTGTACCCTTGACACC

mec A gene, SCC mectyping: an initial denaturation step at 94degC for 4min, followed by 30 cycles with denaturation at 94degC for 30s, annealing at 53degC for 30s and extension at 72degC for 1 min. A final extension step was done at 72degC for 4 min.

sietgene: an initial denaturation step at 94degC for 2min, followed by 30 cycles with denaturation at 95degC for 1min, annealing at 55degC for 1min and extension at 72degC for 2min. A final extension step was done at 72degC for 4 min.

lukF and lukS genes: an initial denaturation step at 94degC for 5min, followed by 35 cycles with denaturation at 94degC for 1min, annealing at 57degC for 1min and extension at 72degC for 1min. A final extension step was done at 72degC for 5 min.

Aliquots from amplification reactions were analyzed by 1.5% agarose gel electrophoresis and viewed under UV light.

Experimental infection of mice: The S. pseudintermedius (Sp) NJ-1 strain isolated from a dog with respiratory syndrome was used. The bacterial strain was cultured on LB and incubated at 37degC. The bacterium was identified on the basis of its biochemical characteristics and through sequencing of the 16S rRNA gene. BALB/c female mice (6 weeks of age, 18-20 g) were purchased from the Animal Experiment Centre, Yangzhou University, China. Mice were divided into Sp and PBS groups with 25 mice in each group. Mice in Sp group were intranasally inoculated with Sp (1x109 CFU/ml, 50 u l/mouse) and PBS group was inoculated with PBS intranasally as control. Five mice from each group were sacrificed humanely according to a pre-designated schedule at indicated time points of 1, 2, 3, 4 and 5 days post-infection (d.p.i.).

Bacterial loads: The lung and brain from each mouse were weighed and homogenized individually in PBS to obtain a 10% weight-to-volume suspension. The number of CFUs of Sp was determined by plating serial 10-fold dilutions of homogenates on LB agar in duplicate. The plates were incubated overnight at 370C. Results were counted and expressed as CFU/g for brain and lung.

Histopathological examination: At 2 d.p.i. mice were euthanized; brain and lung tissues were harvested and fixed in 10% neutral buffered formalin. After fixation, the tissues were embedded in paraffin wax. Tissue sections with a thickness of 4um were stained with haematoxylin and eosin and examined under microscope.

RESULTS

During present study S. pseudintermediuswere isolated and confirmed by morphology, culture and biochemical characteristics. In addition PCR was performed for the confirmation of the bacteria.

Clinical symptoms: After 24 h of S. pseudintermediusinoculation, clinical signs were appeared in the mice. Clinical signs included coarse hair, not shiny, apathetic appearance of distinct neurological symptoms. Abnormal reactions were observed having sensitive to touching and paralyzed on one side has lost the ability to walk (Fig 1), when the tail was lift, quick circling movement was observed, this phenomena was more pronounced on 2d.p.i.

Bacterial loads: The bacterial load in the brain and lungs of mice infected with bacteria is presented in (Fig. 2). Twenty-five mice were intranasaly inoculated with 1x109 CFU/ml, 50 u l/mouse. Bacterial load was carried out from lung and brain. At 1 d.p.i bacterial load in lung and brain was more than 103 and 102 CFU/g respectively. At 2d.p.i bacterial load was more than 105 CFU/g in lung and more than 104 CFU/g in brain. Bacterial number continued to be slightly increased in brain and decreased in lung with the course of the infection. At day 2 bacterial load in lungs reached its maximum, whereas in brain bacterial load slightly decreased, while At 5 d.p.ibacterial load becomes 105 CFU/g in brain and lung.

Histopathological changes: In brain microglial cell numbers were increased and aggregated to form microglial nodules andneurophagia phenomena was observed (Fig 3A). Nerve fibres become dissolved as well as appearance of vascular cuff was noticeable (Fig 3B). In lung widening of alveolar septa and increased infiltration of the inflammatory cells including macrophages were observed. (Fig.3D, E). Brain and lungs from control group mice did not showed histopathological lesions (Fig. 3C, F).

Presence of mecA and SCCmec typing of S. pseudintermedius: All oxacillin resistant isolates of S.pseudintermediusfrom dogs had mecA gene while oxacillin susceptible isolates did not possess themecAgene. Among the mecA-positive isolates, 2(18.18 %) belonged to SCCmec type II-III, 2(18.18 %) belonged to SCCmec type I and 3(27.27 %) belonged to SCCmec type III. Results of mecA and SCCmec type are summarized in Table 2. The results for PCR amplification are shown in Fig.4-9.

Table 2.SCCmec typing of mecA resistant S.pseudintermediusstrains isolated from dogs.

Total###Number of###SCCmec###Number of

number###positive###type###positive strains

of###strains###(%)

samples###formecA(%)

24###11 (45.83%)###II-III###2 (18.18%)

###III###3 (27.27%)

###I###2 (18.18%)

DISCUSSION

Dogs are the main reservoir of S. pseudintermedius having variable carriage rates subject to the different sites of the body (Bannoehr and Guardabassi, 2012). Studies have been done in past for the bacterial isolation from the upper and lower respiratory tract of both diseased and healthy dogs. In the present study twenty four Staphylococcus pseudintermedius spp were isolated from forty dogs having respiratory infection. Our results are in agreement with others authors who isolated S. pseudintermedius from indoor patient dogs (46.2%) and outdoor patient dogs (19.4%) in a Japanese veterinary teaching hospital (Sasaki et al., 2007). Onumaet al., (2012) reported high prevalence of S. pseudintermedius in dogs having pyoderma infection (76.1%during 1999-2000 and 76.4% in 2009). However, in Canada, low MRSP (2.1%) and MRSS (0.5%) isolates were detected (Hanselman et al., 2008).

S. pseudintermedius is not present in the nasopharyngeal flora of the humans but can be carriers when they come in contact with infected animals (Sasaki et al., 2007). A mouse model was designed to study pathogenicity of S.pseudintermedius. BALB/c mice were inoculated with S.pseudintermedius. The mice were killed at different intervals, and brains and lungs were taken and plated for bacterial count. In the present study, severe neurological signs including bending of the neck and walking in circles were observed. In previous studies, mice exhibited clinical signs of anorexia, ruffled hair, abdominal breathing, septicemic infection (Souza et al., 2012) and meningitis (Gerber et al., 2001). Higher level of bacterial loads in brains and lungs of the mice weredetected, leading to the severe histopathological lesions.

In brain,theincreased microglial cells resulted into the formation of microglial nodules, while in lungs alveolar septa was widened with increased infiltration of the inflammatory cells including macrophages. Our findings are in agreement with other authors who observed neuronal damage, focal necrosis with shrunken eosinophilic neurons (Gerber et al., 2001;Guoet al., 2014), specific necrotizing encephalitis and abscesses (Vecht et al., 1997). Necrosis, alveolar inflammation, interstitial edema and infiltration of the inflammatory cells have been observed after pneumococcal infection in the mice (Kalhoro et al., 2015;Wang et al., 2005).

Methicillin resistance of S. pseudintermedius is mediated bymecA gene. The mecA gene is located on a mobile element called the 'staphylococcal chromosomal cassette' (SCCmec) on the chromosome of the bacterium (Weese and Van Duijkeren, 2010). Present study showed that all oxacillin resistant strains possessed mecA and SCCmec type II-III in 2 isolates (18.18%), SCCmec type I in 2 isolates (18.18%) and SCCmec type III in 3 isolates (27.27%). A study by Bemis et al. (2006) reported 30 out of 31 staphylococci were resistant to oxacillin possessed mecA gene. Some studies have also shown that SCCmec II-III and SCCmec V are most prevalent in MRSP in China (Feng et al., 2012; Wang et al., 2012), Korea (Moon et al., 2012)and Japan (Onuma et al., 2012), whileSCCmec type V has been reported in USA (Moodley et al., 2009). Our results are in agreement with other authors who identified SCCmec type III (Moodley et al., 2009; Ruscher et al., 2009; Ruscher et al., 2010) as most prevalent.

Conclusion: It is concluded from present study thatmethicillin resistant S.pseudintermediusis potentially pathogenic in dogs. The study on pathogenicity and characterization of S.pseudintermedius in mouse model can be particularly important due to its ability of inducing brain damage by crossing the blood-brain barrier (BBB) and subsequent long term colonization.

Acknowledgements: This work was supported by the International SandT Cooperation Program of China (2014DFG32770) and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

REFERENCES

Abraham, J. L., D. O. Morris, G. C. Griffeth, F. S. Shofer and S. C. Rankin (2007). Surveillance of healthy cats and cats with inflammatory skin disease for colonization of the skin by methicillin-resistant coagulase-positive staphylococci and Staphylococcus schleiferi ssp. Schleiferi.Vet.Dermatol. 18: 252-259.

Bannoehr, J. and L. Guardabassi (2012). Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity.Vet. Dermatol. 23:253-e252.

Baron, F., M.F. Cochet, J.L. Pellerin, N. B. Zakour, A. Lebon, A. Navarro, I. Proudy, Y. Le Loir and M. Gautier (2004). Development of a PCR test to differentiate between Staphylococcus aureus and Staphylococcus intermedius. J. Food Prot. 67:2302-2305.

Becker, K., R. Roth and G. Peters (1998). Rapid and specific detection of toxigenic Staphylococcus aureus: use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene.J. Clin. Microbiol. 36:2548-2553.

Bemis, D. A., R. D. Jones, L. E. Hiatt, E. D. Ofori, B. W. Rohrbach, L. A. Frank and S. A. Kania (2006). Comparison of tests to detect oxacillin resistance in Staphylococcus intermedius, Staphylococcus schleiferi, and Staphylococcus aureus isolates from canine hosts.J. Clin. Microbiol.44:3374-3376.

Boost, M., S. So and V. Perreten (2011). Low Rate of Methicillin-resistant Coagulase-positive Staphylococcal Colonization of Veterinary Personnel in Hong Kong.Zoonoses Public Health.58:36-40.

Bardiau, M.,K.Yamazaki, I. Ote, N. Misawa andJ.G. Mainil (2013). Characterization of methicillin-resistant Staphylococcus pseudintermedius isolated from dogs and cats. Microbiol.Immunol. 57:496-501.

Damborg, P., A. Moodley, B. Aalbaek, G. Ventrella, T.P. dos Santos and L. Guardabassi(2016). High genotypic diversity among methicillin-resistant Staphylococcus pseudintermedius isolated from canine infections in Denmark.BMC Vet. Res. 12(1), 1.

Devriese, L. A., M. Vancanneyt, M. Baele, M. Vaneechoutte, E. De Graef, C. Snauwaert, I. Cleenwerck, P. Dawyndt, J. Swings and A. Decostere (2005). Staphylococcus pseudintermedius sp. nov., a coagulase-positive species from animals. Int. J. Syst. Evol. Microbiol. 55:1569-1573.

Feng, Y., W. Tian, D. Lin, Q. Luo, Y. Zhou, T. Yang, Y. Deng, Y.H. Liu and J.H. Liu (2012). Prevalence and characterization of methicillin-resistant Staphylococcus pseudintermedius in pets from South China.Vet. Microbiol. 160:517-524.

Frank, L. A., S. A. Kania, E. M. Kirzeder, L. C. Eberlein and D. A. Bemis (2009). Risk of colonization or gene transfer to owners of dogs with meticillin-resistant Staphylococcus pseudintermedius. Vet. Dermatol. 20:496-501.

Futagawa-Saito, K., W. B.Thein, N. Sakurai and T. Fukuyasu (2006). Prevalence of virulence factors in Staphylococcus intermedius isolates from dogs and pigeons.BMC Vet. Res. 2:4.

Futagawa-Saito, K., T. Sugiyama, S. Karube, N. Sakurai, W. Ba-Thein and T. Fukuyasu (2004). Prevalence and characterization of leukotoxin-producing Staphylococcus intermedius in isolates from dogs and pigeons.J. Clin. Microbiol.42:5324-5326.

Gerber, J., G. Raivich, A. Wellmer, C. Noeske, T. Kunst, A. Werner, W. Bruck and R. Nau (2001). A mouse model of Streptococcus pneumoniae meningitis mimicking several features of human disease.Acta Neuropathol. 101:499-508.

Griffeth, G. C., D. O. Morris, J. L. Abraham, F. S. Shofer and S. C. Rankin (2008). Screening for skincarriage of methicillin-resistant coagulase-positive staphylococci and Staphylococcus schleiferi in dogs with healthy and inflamed skin.Vet. Dermatol. 19:142-149.

Guardabassi, L., M. Loeber and A. Jacobson (2004). Transmission of multiple antimicrobial-resistant Staphylococcus intermedius between dogs affected by deep pyoderma and their owners.Vet. Microbiol. 98:23-27.

Guo, C. M., R. R. Chen, D.H. Kalhoro, Z.F. Wang, G.J. Liu, C.P. Lu and Y.J. Liu (2014). Identification of genes preferentially expressed by highly virulent piscine Streptococcus agalactiae upon interaction with macrophages. PloS one 9: e87980.

Hanselman, B. A., S. Kruth and J. S. Weese (2008). Methicillin-resistant staphylococcal colonization in dogs entering a veterinary teaching hospital.Vet. Microbiol. 126: 277-281.

Kalhoro, D. H, S. Luo, X. Xie, Y.B. Zhao, C.P. Lu and Y.J. Liu (2015). Streptococcus pluranimalium isolated from a canine respiratory case: identification and experimental infection in mice. Pak. Vet. J. 35: 388-390.

Lautz, S., T. Kanbar, J. Alber, C. Lammler, R. Weiss, E. P. Berninghoff and M. Zschock (2006). Dissemination of the gene encoding exfoliative toxin of Staphylococcus intermedius among strains isolated from dogs during routine microbiological diagnostics.J. Vet. Med, Series B. 53:434-438.

Moodley, A., M. Stegger, N. L. B. Zakour, J. R. Fitzgerald and L. Guardabassi (2009). Tandem repeat sequence analysis of staphylococcal protein A (spa) gene in methicillin-resistant Staphylococcus pseudintermedius.Vet. Microbiol. 135:320-326.

Moon, B. Y., J.H. Youn, S. Shin, S. Y. Hwang and Y. H. Park (2012). Genetic and phenotypic characterization of methicillin-resistant staphylococci isolated from veterinary hospitals in South Korea.J. Vet. Diagn. Invest. 24:489-498.

Oliveira, D. C. and H. de Lencastre (2002). Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.Antimicrob.Agents Chemother. 46:2155-2161.

Onuma, K., T. Tanabe and H. Sato (2012). Antimicrobial resistance of Staphylococcus pseudintermedius isolates from healthy dogs and dogs affected with pyoderma in Japan. Vet.Dermatol. 23:17-e15.

Prevost, G., T. Bouakham, Y. Piemont and H. Monteil (1995).Characterisation of a synergohymenotropic toxin produced by Staphylococcus intermedius.FEBS letters 376:135-140.

Ruscher, C., A. Lubke-Becker, C.G. Wleklinski, A. Soba, L. H. Wieler and B. Walther (2009). Prevalence of methicillin-resistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes.Vet. Microbiol. 136:197-201.

Ruscher, C., A. Lubke-Becker, T. Semmler, C.G. Wleklinski, A. Paasch, A. Soba, I. Stamm, P. Kopp, L. H. Wieler and B. Walther (2010). Widespread rapid emergence of a distinct methicillin-and multidrug-resistant Staphylococcus pseudintermedius (MRSP) genetic lineage in Europe. Vet. Microbiol. 144:340-346.

Sasaki, T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata and K. Hiramatsu (2007). Reclassification of phenotypically identified Staphylococcus intermedius strains.J. Clin. Microbiol. 45:2770-2778.

Soedarmanto, I., T. Kanbar, H. Ulbegi-Mohyla, M. Hijazin, J. Alber, C. Lammler, O. Akineden, R. Weiss, A. Moritz and M. Zschock (2011). Genetic relatedness of methicillin-resistant Staphylococcus pseudintermedius (MRSP) isolated from a dog and the dog owner.Res. Vet. Sci. 91:e25-27.

Souza, C., J. Warth, J. Agottani, J. Moura, R. Maluta, M. Cardozo and F. Avila (2012).Efficacy of seroneutralization of a systemic toxico-infection caused by Staphylococcus pseudintermedius on mice/utilizacao de modelo biologico experimental na acao soroneutralizante de toxinfeccao sistemica por cepa de Staphylococcus pseudintermedius. Ars Veterinaria28:022-027.

Terauchi, R., H. Sato, Y. Endo, C. Aizawa and N. Maehara (2003). Cloning of the gene coding for Staphylococcus intermedius exfoliative toxin and its expression in Escherichia coli. Vet. Microbiol. 94:31-38.

Van Duijkeren, E., D. Houwers, A. Schoormans, M. Broekhuizen-Stins, R. Ikawaty, A. Fluit and J. Wagenaar (2008). Transmission of methicillin-resistant Staphylococcus intermedius between humans and animals.Vet. Microbiol 128:213-215.

Van Duijkeren, E., B. Catry, C. Greko, M. A. Moreno, M. C. Pomba, S. Pyorala, M. Ruzauskas, P. Sanders, E. J. Threlfall and J. Torren-Edo (2011). Review on methicillin-resistant Staphylococcus pseudintermedius.J. Antimicrob.Chemother. 66:2705-2714.

Vecht, U., N. Stockhofe-Zurwieden, B. J. Tetenburg, H. J. Wisselink and H. E. Smith (1997). Virulence of Streptococcus suis type 2 for mice and pigs appeared host-specific.Vet. Microbiol. 58:53-60.

Wang, J., R. A. Barke, R. Charboneau and S. Roy (2005). Morphine impairs host innate immune response and increases susceptibility to Streptococcus pneumoniae lung infection.J. Immunol. 174:426-434.

Wang, Y., J. Yang, C. Logue, K. Liu, X. Cao, W. Zhang, J. Shen and C. Wu (2012). Methicillin-resistant Staphylococcus pseudintermedius isolated from canine pyoderma in North China.J.Appl. Microbiol. 112:623-630.

Weese, J. S. and E. van Duijkeren (2010). Methicillin-resistant Staphylococcus aureus and Staphylococcus pseudintermedius in veterinary medicine.Vet. Microbiol. 140:418-429.

Weese, J. S., R. Poma, F. James, G. Buenviaje, R. Foster and D. Slavic (2009). Staphylococcus pseudintermedius necrotizing fasciitis in a dog. Can. Vet. J. 50:655.

Wielders, C., A. Fluit, S. Brisse, J. Verhoef and F. Schmitz (2002). mecA gene is widely disseminated in Staphylococcus aureus population.J.Clin. Microbiol. 40: 3970-3975.

Zakour, N. L. B., J. Bannoehr, A. H. van den Broek, K. L. Thoday and J. R. Fitzgerald (2011). Complete genome sequence of the canine pathogen Staphylococcus pseudintermedius. J. Bacteriol. 193:2363-2364.

Zhang, K., J. A. McClure, S. Elsayed, T. Louie and J. M. Conly (2005). Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.J. Clin. Microbiol. 43:5026-5033.
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Geographic Code:9CHIN
Date:Apr 30, 2017
Words:4078
Previous Article:IMMUNOMODULATORY EFFECTS OF CAMELLIA SINENSIS AGAINST COCCIDIOSIS IN CHICKENS.
Next Article:EFFECTS OF FEVERFEW (TANACETUM PARTHENIUM) AND ANTIBIOTIC CO-ADMINISTRATION ON BLOOD NEUTROPHIL FUNCTION AND SERUM PROCALCITONIN IN DOGS WITH...
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters