Printer Friendly

SNP DETECTION OF GnRHR GENE AND ITS ASSOCIATION WITH LITTER SIZE TRAITS IN GIANT PANDA.

Byline: B. Tang, X. Huang, C. Han, L. Li, K. Xie, X. Li, C. Bao, Y. Huang, B. Luo, Z. Huang, M. Wei, H. Zhang and J. Wang

Keywords: Giant panda, GnRHR, SNPs, PCR-SSCP, Litter traits

INTRODUCTION

The giant panda (Ailuropoda melanoleuca), which is a flagship species and a typical representative for biodiversity conservation, is a rare and unique animal in China (Liu et al. 1999). Zhan et al., using fecal samples and nine microsatellite loci from our molecular census estimate, found that there may be as many as 2, 500-3, 000 giant pandas residing in a few small mountains of western China (Zhan et al., 2006). The giant panda has its own unique biological characteristics, one of which is very low fertility. As a key measurement parameter of reproduction, litter size was used to evaluate animal fertility. Analysis of giant panda calving records demonstrated that the litter size of every birth in giant panda is limited to one or two litters, with three litters occurring occasionally (Liu 1987). This finding suggests that giant panda share varied litter sizes. In other words, they share varied fertility, which is controlled by many reproductive genes.

However, it is still unknown which major genes influence the fertility of the giant panda. It is well known that animal fertility is primarily affected by the hypothalamus-pituitary axis, which regulates the secretion of many hormones. The hypothalamic release of gonadotropin-releasing hormone (Gonadotropin releasing hormone, GnRH) plays an important role in the control of mammalian reproductive physiology and sexual gland development (Kumar et al. 2001; Kah et al. 2007; Ikemoto et al. 2004). GnRHR binds with high affinity to GnRH on the pituitary gonadotrope's cell surface to stimulate the biosynthesis and secretion of the gonadotropins (luteinizing hormone, LH and follicle-stimulating hormone, FSH) from the anterior pituitary and then regulates gonadal function, including both synthesizing hormones and generating gametes(Millar et al. 2004; Finch et al. 2008; Naor et al. 2009).

The increase in GnRH secretion and the high concentration of pituitary GnRHR promotes the occurrence of ovulation in mammals, but the absence of GnRHR can obstruct ovulation, leading to infertility (Wise et al. 1984). MacColl et al. found that the inhibition or mutation of the protein expression of GnRH or GnRHR in some organisms can lead to individual infertility (MacColl et al. 2002). In addition, Kim et al. found that the inhibition of the GnRH gene and GnRHR gene expression limits the reproductive activity of mammals (Kim et al. 2003). These findings suggest that the GnRHR gene may be an important gene for regulating a mammal's reproductive performance. Thus, it is worth exploring GnRHR gene influence on the fertility of the giant panda. Given the importance of the GnRHR gene in mammalian reproduction, the influence of polymorphism on the reproduction of mammals has attracted a great deal of attention.

Liu et al. reported that a G230C mutation was detected in the GnRHR genes of Small Tail Han sheep and Dorset sheep populations and that G230C substitution led to one amino acid mutation (GlyaCys). This mutation may have a certain positive correlation with the reproductive capacity of Small Tail Han sheep and Dorset Sheep (Liu ZH et al. 2006). Chu et al. found a SNP locus in the GnRHR gene exon 1 of the Jining Grey goat, which has AA, AB and BB three genotypes, and found that the average litter size of the Jining Grey goats with the BB genotype was larger than that of goats with the AA and AB genotypes (Chu MX et al. 2009). In addition, Zhang et al. detected a SNP locus G121A in the GnRHR gene exon 1 of the Guizhou black goat and found that the litter size of AA genotype was significantly higher than that of the AG and GG genotypes (Pa$?0.05) (Zhang et al., 2015). Previous studies have shown that the polymorphism of the GnRHR gene is closely related to the fertility of many animals.

Thus, it is still necessary to confirm whether the polymorphism exists in the GnRHR gene and how it influences the fertility of giant panda. Thus, this study uses 38 giant pandas as experimental material to research the polymorphism of the GnRHR gene and the connection between the GnRHR genotypes and giant panda litter size traits to explore how GnRHR influences the fertility of the giant panda and provide a theoretical basis for the protection of high-yield litter size pandas.

MATERIALS AND METHODS

DNA samples and data collection: Blood samples were collected from 38 giant pandas (27 females) reared in the Wolong region in Sichuan Province (PR China). Records of the litter size of giant pandas were collected for statistical analysis. Using jugular vein blood, 10-ml blood samples were collected from each giant panda. With citric acid and glucose anticoagulation, they were frozen at -20AdegC. The samples used for the preparation of genomic DNA were subjected to kit extraction, and the remaining samples were stored at 4AdegC.

Primer synthesis and polymerase chain reaction (PCR): Three pairs of primers (Table 1) were designed to amplify the GnRHR gene coding region of the giant panda, based on the giant panda GnRHR gene sequence (GenBank accession no. XM_002926719.1). The primers were custom synthesized by Shenzhen Hua Da gene science and Technology Co., Ltd., China. The 25uL volume contained 50 ng of genomic DNA, 1.0uM of each primer, 0.2 uM of dNTP, 0.5 U of Taq-DNA polymerase and 1xreaction buffer, which contained 1.5 mM MgCl2.The cycling protocol was 95AdegC for 5 min, 40 cycles of 95AdegC for 30s, annealing temperature for 30s, 72AdegC for 40s, and a final extension at 72AdegC for 10 min. The products were detected by 1.5% agarose gel electrophoresis. In addition, PCR products were sent to Shanghai Yingjun Biotechnology Co. Ltd. For positive sequencing. In this study, 38 samples were analyzed by direct sequencing.

Statistical analysis: Genotypes and allelic frequencies were calculated using the POPGENE software (ver. 1.31), and Hardy-Weinberg equilibrium for each population was analyzed using a I2-test. The analysis of associations between the GnRHR genotypes and litter traits was carried out using the GLM procedure by using SAS software (Statistical Analysis System 8.2, SAS Institute Inc.) according to the mathematical model: Yij=u + Gi + Eij. The level of significance was defined as Pa$?0.05, where Yij was the record of individual j with genotype i; u was defined as population mean; Gi was defined as the genotype effect; and Eij was defined as the residual effect.

Table 1. Primer sequences and information of the GnRHR.

Primer###Primer sequence###Amplified region###Products size/bp

P1###F:ATCACCCAATACAGTAGTCAAG###exon1###618

###R:GAAACTCCATCCGTCAGG

P2###F:GCTGCGTTGAATACTGC###exon2###455

###R:TTCGATGAAGAGCCAAA

P3###F:CTTCCTTTTTGTCCACTTTG###exon3###317

###R:TTACAAAGAGAAATATCCATAGATA

Table 2. Allelic and genotypic frequencies of GnRHR.

Mutation###site###Genotype frequency###Allele frequency###X2 value

T516121C###exon1###AA###AB###BB###A###B

###2(0.05)###22(0.58)###14(0.37)###0.34###0.66###0.04

C504498T###exon2###CC###CD###DD###C###D

###14(0.37) 15(0.39)###9(0.24)###0.57###0.43###0.23

Table 3. Least squares mean and standard error for litter size of different GnRHR genotypes.

Mutation###Genotype###No. of samples###The average litter size of###The average litter size of

site###first birth###second birth

###AA###1###2*###1*

T516121C###AB###19###0.95+-0.17a###0.63+-0.19a

###BB###7###0.86+-0.37a###0.57+-0.31a

###CC###11###1.27+-0.22a###1+-0.22a

C504498T###CD###13###0.77+-0.21a###0.46+-0.21ab

###DD###3###0.67+-0.43a###0b

RESULT

Amplification of the coding region (CDS) of the GnRHR gene in giant panda: The 618, 455, and 317bp fragments of the GnRHR gene of giant pandas were amplified by PCR within three pairs of primers named GnRHR primer1, GnRHR primer2, and GnRHR primer3, respectively. The length of the amplified fragments agreed well with the expected results, and the target bands were clear and specific, which allowed them to be used for direct DNA sequencing. P1, P2 and P3, respectively, indicate 618bp and 455bp and 317bp fragments amplified; M. DNA Marker DL 2000

Polymorphisms of the GnRHR gene in giant panda: Comparative analysis of the giant panda GnRHR gene sequencing indicated two single mutation sites that were found in exons 1 and 2, respectively. According to customary nomenclature, the single mutation site in exon 1 was named T516121C, and the T516121C substitution led to one amino acids mutation (Cys>Arg). Similarly, the single mutation site in exon 2 was named C504498T, and the C504498T substitution led to one amino acids mutation (Ala>Val). A mutation site in the exon3 was not detected.

Genotypic and allelic frequencies: In the analysis of giant panda populations, three different genotypes of the T516121C locus were named AA, AB and BB, and the different genotypes of C504498T locus were named CC, CD and DD (Table 2). At the T516121C locus, the AB genotype was the predominant genotype, and allele B was the dominant allele. In the C504498T locus, the CD genotype was the predominant genotype, and allele C was the dominant allele. Furthermore, the results of the fitness of Hardy-Weinberg equilibrium were in equilibrium (P>0.05).

The relationship between litter traits and the polymorphism of the GnRHR gene: The average and standard deviation for the litter sizes of different genotypes of the GnRHR gene in giant panda are given in Table 3. We can see from Table 3 that the first birth of the giant panda with an AA genotype had the maximum average litter size and that the first birth with the BB genotype had the minimum average litter size. The average litter size of the first birth with an AB genotype was grearter than the size of the BB genotype. The giant panda with the CC genotype had a greater first birth average litter size than did the CD and DD genotypes. In addition, compared with the CD and DD genotypes, the giant panda with the CC genotype had the largest average litter size for second births (Pa$?0.05).

DISCUSSION

At present, the giant panda breeding research concentrates primarily on the panda rutting characteristics, reproductive behavior, hormones related to reproduction, and artificial insemination technology. Comparatively, there are only a few studies on the molecular regulation mechanism on the fertility of the giant panda. Moreover, even fewer reports on which major genes could influence the fertility of the giant panda. GnRHR, which can regulate the synthesis and secretion of LH and FSH, plays a key role in mammalian reproduction. However, it is still unknown that whether GnRHR could also influence the reproduction of giant panda. Therefore, this study first detected giant panda GnRHR gene polymorphisms. Then, the association of the GnRHR gene polymorphism with the litter size of the giant panda was analyzed, seeking a new theoretical basis for improving the reproductive capacity of the giant panda.

Analysis of polymorphism of GnRHR gene in giant panda: In recent years, the GnRHR gene, as a candidate gene for litter size traits, was found to be closely related to the reproductive capacity of mammals. Furthermore, a large number of researchers have detected different SNP loci in the GnRHR genes of various mammals, and these SNP loci were closely related to the reproductive capacity of those mammals. In this study, the SNP loci T516121C and C504498T were found in exons 1 and 2 of the giant panda GnRHR gene, and no SNP locus in exon 3 was detected. TheT516121C and C504498T loci belong to non-synonymous mutations, and the T516121C substitution led to one amino acid mutation (Cys>Arg). Similarly, the C504498T substitution led to another amino acid mutation (Ala>Val). Correlation analysis suggests that the C504498T mutation can affect the panda litter size trait. Because these two loci are located in the exon region that encodes protein sequences, the mutations are very important.

De Roux et al. (1997) found that G317A and A785G, two mutations that occur in human GnRHR cDNA, cause the amino acid changes (Gln106Arg and Arg206Gln). Additionally, it caused the amino acid sequence to change, which weakened the binding force between GnRHR and ligand. This is closely related to the low function of the familial primary brain pituitary gonadal hormone, thereby affecting reproductive ability (De Roux et al. 1997). Jiang et al. (2001) reported a C1721G substitution in the 3'UTR (untranslated region) that was detected in an F2 population of MeishanxEuropean Large White pigs, and a 1721 G allele with a greater first litter size in Meishan pigs (Jiang et al. 2001). Han et al. detected GnRHR gene exon 1 in Saanen Dairy Goat and GnRHR gene exon 2 in the Boer goat in the presence of mutation sites, and they were associated with litter size (Han D et al. 2009). Liu et al. detected the single nucleotide polymorphism of the GnRHR gene in the Laoshan dairy goat.

These results showed that the m utation of the gene A261G for multiparous ewe GA genotype litter size was significantly higher than that of the AA genotype (Liu Net al. 2014). Further, Zhang et al. found an A/C mutation in the GnRHR exon 1 of Huanghuai goat and Boer goat and determined that the litter size of Huanghuai goats with the BB genotype is grearter than that of the AA genotype (Pa$?0.05) (Zhang YJ et al. 2010). Sun et al. reported the amplification of the GnRHR gene exon 2 fragment and found that the Small Tail Han ewes with mutant homozygous genotype DD had 0.81 (Pa$?0.01) more lambs than did those with the wild type CC (Sun J et al. 2008). In addition, Dunn et al. used PCR-RFLP in hen groups to detect GnRHR gene polymorphism, showing an additive effect of the GnRHR gene on the number of double-yolked eggs in one generation of a commercial broiler breeder hen population (Dunn et al.2004).

These studies show that the GnRHR gene is closely related to the reproductive performance. Combining the results of this study, we predicted the C504498T base mutation would impact the giant panda GnRHR gene function and influence the giant panda reproductive function, but the specific impact mechanism requires further research.

The relationship between litter size and the polymorphism of GnRHR gene in giant panda: The results of this study showed that the T516121C and C504498T loci were both in the Hardy-Weinberg equilibrium state (P>0.05). The giant panda populations from Wolong nature reserve in Sichuan Province (PR China) and the group without any artificial selection tried to make the population in their natural state. The results of this study objectively reflect the characteristics of the giant panda population. At present, the number of giant pandas in captivity shows great improvement, but the low reproduction rate problem for the giant panda has not been completely resolved. Therefore, it is very necessary to strengthen the research on the biology of giant panda reproduction and explore the related genes and mechanisms underlying giant panda reproduction.

The result in this study showed that different genotypes of different SNP loci have different effects on the average litter size of the first and second births of the pandas. The different genotypes of the C504498T locus in the giant panda GnRHR gene had significant effects on the average litter size of the second birth (Pa$?0.05). We speculated that the C504498T locus may influence panda litter size related traits. Therefore, it is inferred that the GnRHR gene may be a major gene that controls litter size traits in giant panda. If so, the GnRHR gene can be considered the main candidate gene to improve giant panda litter sizes.

Conclusion: In summary, this study showed two SNP loci that were found in the GnRHR gene exons 1 and exon 2 of the giant panda. The C504498T locus was found in exon 2 and led to an amino acid mutation (Ala>Val). This mutation had a significant influence on the litter size of giant pandas. Therefore, these results suggest that the C504498T base mutation in the exon 2 of GnRHR could influence the litter size of giant pandas. In other words, GnRHR could influence the fertility of giant pandas. The giant panda GnRHR gene polymorphism was first detected in this study, and this finding provides a theoretical basis for improving the reproductive capacity of the giant pandas.

Acknowledgments: The work was supported by China Wolong Panda Club.

REFERENCES

Chu, M.X., J.W. Xiao, and R. Di (2009). Polymorphism of Gonadotropin Releasing Hormone Receptor (GnRHR) Gene and Its Relationship with Prolificacy of Jining Grey Goat. J. Agr. Biotechnol. 2: 218-223.

De Roux, N., J. Young, M. Misrahi, R. Genet, P. Chanson, G. Schaison, and E. Milgrom (1997). A family with hypogonadotropic hypogonadism and mutations in the gonadotropin-releasing hormone receptor. New. Engl. J. Med. 337: 1597-1603.

Dunn, I.C., Y.W. Miao, and A. Morris (2004). A study of association between genetic markers in candidate genes and reproductive traits in one generation of a commercial broiler breeder hen population. Heredity. 92: 128-134.

Finch, A.R., K.R. Sedgley, and C.J. Caunt (2008). Plasma membrane expression of GnRH receptors: regulation by antagonists in breast, prostate, and gonadotrope cell lines. J. Endocrinol.196: 353-367.

Han, D., G. Li, and B.Y. Cao (2009). Polymorphism of GnRHR gene and its relationship with litter size trait of Saanen Dairy Goat. J. Chin. Agr. Univ. 5: 93-97

Ikemoto, T., M. Enomoto, and M.K. Park (2004). Identification and characterization of a reptilian GnRH receptor from the leopard gecko. Mol. Cell. Endocrinol. 214: 137-147.

Jiang, Z., J.P. Gibson, and A.L. Archibald (2001). The porcine gonadotropin-releasing hormone receptor gene (GnRHR): genomic organization, polymorphisms, and association with the number of corpora lutea. Genome. 44: 7-12.

Kumar, R.S., and J.M.Trant (2001). Piscine glycoprotein hormone (gonadotropin and thyrotropin) receptors: a review of recent developments. Comp. Biochem. Phys. B. 129: 347-355.

Kah, O., C. Lethimonier, and G. Somoza (2007). GnRH and GnRH receptors in metazoa: a historical, comparative, and evolutive perspective. Gen. Comp. Endocr.153:346-364.

Kim, J.H., H.J. Kim, and H.S. Noh (2003). Suppression by ethanol of male reproductive activity. Brain. Res. 989: 91-98.

Liu, J., Z. Ouyang, and W.W. Taylor (1999). A framework for evaluating the effects of human factors on wildlife habitat: the case of giant pandas. Conserv. Biol. 13: 1360-1370.

Liu, W.X. (1987). Litter size on each tire giant panda. Chinese. J. Wildlife. 04: 37-38.

Liu, Z.H., M.X. Chu, and G.H. Chen (2006). PCR-SSCP analysis on partial sequence of gonadotropin releasing hormone receptor gene in sheep. J. Anhui Agr. Univ. 33: 318-321.

Liu, N., X.L. Ma, and M. Cheng (2014). Correlation Analysis Polymorphism of GnRHR Gene and Litter Size of Laoshan Dairy Goats. Acta. Agr. Boreali-Sinica. 06: 78-83.

Millar, R.P., Z.L. Lu, and A.J. Pawson (2004). Gonadotropin-releasing hormone receptors. Endocr. Rev. 25:235-275.

MacColl, G., R. Quinton, and P.M.G. Bouloux (2002). GnRH neuronal development: insights into hypogonadotrophic hypogonadism. Trends. Endocrin. Met. 13: 112-118.

Naor, Z. (2009). Signaling by G-protein-coupled receptor (GPCR): studies on the GnRH receptor. Front. Neuroendocrinology. 30: 10-29.

Sun, J., M.X. Chu, and H.Q. Chen (2008). Polymorphism of GnRHR Gene and Its Relationship with Prolificacy of Small Tail Han Sheep. J. Agr. Biotechnol. 16: 230-236.

Wise, M.E., D. Nieman, and J. Stewart (1984). Effect of number of receptors for gonadotropin-releasing hormone on the release of luteinizing hormone. Biol Reprod. 31: 1007-1013.

Zhan, X., M. Li, and Z. Zhang (2006). Molecular censusing doubles giant panda population estimate in a key nature reserve. Curr. biol.16: R451-R452.

Zhang, J.S., W.H. Long, and H.Q. Xu (2015). Study on correlation between GnRHR gene and reproductive traits in Guizhou black goat. Chinese. Livest. Poul. 08: 44-45.

Zhang, Y.J., M.L. Hu, and Z.J. Zhang (2010). Polymorphism of Exon 1, 2 of GnRHR Gene and its Correlation with the Litter Size in Goat. Chin. Herbivore. Sci. 4: 13-16.
COPYRIGHT 2019 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Geographic Code:9CHIN
Date:Apr 23, 2019
Words:3526
Previous Article:SILVER NANOPARTICLES: ECOFRIENDLY SURFACE STERILIZATION OF PLANT SEEDS IN DIFFERENT SHAPES AND SIZES.
Next Article:GENETIC VARIABILITY AND INTER-TRAIT ASSOCIATION FOR COOKING AND MICRONUTRIENT (Feand Zn) TRAITS IN ADVANCE LINES OF KALANAMAK AROMATIC RICE.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |