Printer Friendly

SINGLE NUCLEOTIDE SOMATIC VARIANTS OF Tp53 GENE IN WIDESPREAD NEOPLASMS OF CANIS FAMILIARIS.

Byline: R. Saif, A. R. Awan, L. Lyons, B. Gandolfi and M. Wasim

ABSTRACT

Sequence diversity of Tp53 gene was analyzed in dog tumors to have an insight of accumulated somatic mutations in 18 samples belongs to 7 different types of cancers. Nine different polymorphic sites were observed in exon 3, 4 and 5, while 32 polymorphic sites are observed in intron 3, 4 and 9. Most of these alterations are heterozygous, locus c.76 in exon 3 is transversion with homozygous (G) variant in one of the mammary and CTVT samples, which is missense in nature and alter the leucine amino acid to valine. Similarly, c.356 locus in exon 5 is homozygous (C), that is also a transversion, which changed the lysine residue to threonine. Most of the observed cancer samples are heterozygous in intronic regions of this gene.

Current study of sequence variations of cancerous somatic cells in the aforementioned gene confirm the involvement of this gene in cancer pathways and might serve as potential molecular diagnostic and prognostic marker for these cancer types in Canis familiaris and may be helpful for other animal species as well.

Keywords:Tp53variants,Dog tumor, Canis familiaris cancer.

INTRODUCTION

Tumor may arise due to chemical, radiation, genetic and genomic reasons. Here we explored somatic Tp53 variations which might defect the whole genome and ultimately can cause cancer. Moreover, intermittent and random causes may also develop cancer.

Total seven types of cancers were analyzed in this study including mammary tumors, which is one of the wide spread neoplasm of the aged female dogs (Withrow and Vail, 2007), Canine Transmissible Venereal Tumor (CTVT) or sticker's sarcoma which is sexually transmitting cancer of the genital organs in Canis familiaris (Eze et al., 2008; Ganguly et al., 2013; Vermooten, 1987), Perianal adenocarcinoma, which is tumor of hairless skin around anus (North and Banks, 2009), Fourth one is canine lymphoma, which involves the lymphocytes and lymphocytes storage organs (lymphoid tissues) which may include spleen, bone marrow and lymph nodes of head and neck region (Withrow and Vail, 2007), Oral squamous cell carcinomas are also being address and analyzed in this study, which are mostly malignant melanoma, squamous cell carcinoma or fibrosarcoma. Its other types may include osteosarcoma, chondrosarcoma, anaplastic sarcoma, hemangiosarcoma and mast cell sarcomas.

Somatic mutations in cancerous tissue can not pass through the offspring because they only accumulate in the neoplastic tissues, that's why these somatic mutations being considered potential markers for cancer diagnosis. Different molecular biomarkers are studied now a days, which have great implication in diagnosis and prognosis of different cancers. Among those Tp53 gene is one of the highly significant and attention seeking biomarker in human and animal species (Paoloni and Khanna, 2007; Zoubeidi and Gleave, 2012), which is almost 60% mutated in all human cancers and have significant role in different neoplasm of Canis familiaris (Hollstein et al., 1991; Wakui et al., 2001). Function of this gene is to apply brakes to the cell cycle and halt the growth of the uncontrolled and spontaneously aberrant dividing cells. Wild-type Tp53 protein increases in response to DNA damage, resulting in the cell arrest at G1 interphase.

It allows DNA repair before replication or apoptosis if the damage is irreparable. So, the pro-apoptotic function of this gene is fully established which are explored in this manuscript to have an idea of all accumulated mutations due to different seven types of cancers in this valued pet animal species.

MATERIALS AND METHODS

Sample Collection: Total 26 samples (cancerous = 21, normal = 5) and peripheral blood were collected from the Pet Center-University of Veterinary and Animal Sciences (UVAS), Lahore, Pakistan and few samples from other private pet clinics through the standard technique of sample collection. Out of total 21, eighteen samples were successfully amplified and screened. Which includes 5 CTVT, 4 mammary carcinoma, 3 from each perianal adenocarcinoma and SCC, 2 from each lymphocytic lymphoma and granuloma, 1 from each melanoma and pelvic-warts. All samples were obtained through excisional biopsies resected tissues and immediately stored at -86AdegC (Table 1).

Table 1. Samples collection procedure, mode of obtaining case-control tissues and representation of disease prevalence data in relation to their age, sex and breeds.

Sample ID###Breed###Tumor type/type of tissue###AgeYears###Sex###Tissue Collection Method

DP1###Non-descriptive###Canine Lymphoma###7###Male###Necropsy lymph node

DP3###English Springer###CTVT###6###Female###Chunk of tissues

DP5###German Shepherd###Mammary adenocarcinoma###8###Female###Surgical excisional

DP8###Labrador###Perianal adenocarcinoma###7###Female###Surgical excisional

DP9###Non-descriptive###Oral tumor/SCC###2###Male###Surgical excisional

DP10###Non-descriptive###CTVT###7###Female###Surgical excisional

DP11###German shepherd###Mammary adenocarcinoma###10###Female###Surgical excisional

DP12###German shepherd###Mammary adenocarcinoma###11###Female###Surgical excisional

DP14###Non-descriptive###Perianal adenocarcinoma###10.5###Male###Surgical excisional

DP15###German shepherd###Perianal adenocarcinoma###3.5###Female###Surgical excisional

DP17###Non-descriptive###Oral tumor/SCC###5###Male###Surgical excisional

DP18###Non-descriptive###Canine lymphoma###12###Male###Necropsy lymph node

DP19###Non-descriptive###Melanoma###10###Male###Chunk of tissues

DP20###Non-descriptive###Mammary adenocarcinoma###11###Female###Surgical excisional

DP21###Labrador###CTVT###2.5###Female###Chunk of tissues

DP22###Rottweiler###Granuloma###2###Female###Chunk of tissues

DP23###Non-descriptive###Granuloma###3###Male###Chunk of tissues

DP24###Sheep dog###CTVT###2.5###Male###Chunk of tissues

DP25###German shepherd###CTVT###2.5###Female###Chunk of tissues

DP26###German shepherd###Head andNeck SCC###2.5###Male###Surgical excisional

DP27###Labrador###Pelvic Warts###4 Month###Male###Chunk of tissues

Normal 1###Random bred###Lungs###5###Male###Necropsy samples

Normal 2###Random bred###Liver###6###Male###Necropsy samples

Normal 3###Random bred###Testes###8###Male###Necropsy samples

Normal 4###Random bred###Kidney###9###Male###Necropsy samples

Normal 5###Random bred###Endometrial###5###Male###Necropsy samples

Nucleic acid extraction: TaiGen genomic DNA tissue extraction kit (TaiGen Biotechnology Co., Ltd, Neihu, Taipe, Taiwan) was used to extract the DNA from all tissues according to manufacturer's guideline (Vogelstein, 1979). DNA concentrations and integrity were measured by NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and gel electrophoresis methods respectively. High quality DNA of 50ng/uL concentration were used for downstream PCR amplifications.

Primers: Long-range primer set was designed from the DNA sequence ID ENSCAFT00000026465 for Tp53 gene taken from ensemble genome browser using primer3 and Net-Primer software (PREMIER Biosoft International, Palo Alto, CA) (Rozen and Skaletsky, 1999). This primer set amplified total 4738bp of Tp53 gene. Then further internal primers were designed for sanger sequencing of the complete gene (Table 2). Tp53 gene has 11 exons with a single splice variant of 2110 bp which encodes 283 amino acids.

PCR protocol: Long-range polymerase chain reaction was conducted using Applied Biosystem thermo cycler with 94AdegC temperature for 2 minutes as initial denaturation, then 10 cycles of (94AdegC as cyclic denaturation for 10 sec, annealing at 61AdegC for 30 sec and extension at 68AdegC was adopted for 1 minute/kb). Then remaining 30 cycles were conducted at (94AdegC as cyclic denaturation for 10 sec, annealing at 59AdegC for 30 sec and extension at 68AdegC for 1 minute/kb with an increment of 20 sec per cycle), at the end, final extension was given at 72AdegC for 5 min and finally hold at 4AdegC. Optimized long-range PCR kit with dNTPs was used containing high-fidelity long range polymerase, 5 U/uL with final concentration of 1.8 U, PCR 10X enhancer A with final concentration of 1x and PCR additive dimethyl sulfoxide (DMSO) for the amplification of GC-rich region, 10X reaction buffer with final concentration of 1x was used to amplify the required gene of interest (Innis et al., 1990).

Gel electrophoresis and sequence analysis: PCR product was visualized through 1.5% agarose gel electrophoresis for 50 minutes (Figure 1), specific amplicon was obtained and cleaned with ExoSAP (ExoSAP-IT PCR Product Cleanup"Santa Clara, CA, USA) for downstream sequencing. Then sequencing was done with ABI BigDye terminator sequencing Kit (Applied Biosystems, Foster City, CA, USA). Sequence analysis was performed by "Sequencher software" ver. 5.2.3 to determine the sequence variants and its other statistical attributes (Gene Codes Corporation, Ann Arbor, MI, USA).

Table 2. Long-range and internal sequencing primer sequences of Tp53 gene in Canis familiaris.

Primer###5' to 3' sequence###Total###Type###Tm(AdegC)###GC%###Overall rating###Product

Label###(bp)###/Purpose###(%)(hairpin,self###size(bp)

###and cross diming)

P53-Cf-###CCCTGGTATAATGTTGCTGGAAG###23###Long-range###60.72###47.83###93###4738

LRF###(Forward)

P53-Cf-###AACGTCACCTCCTTCCTCATCC###22###Long-range###61.89###54.55###88

LRR###(Reverse)

P53-Cf-###GCTAACTGCTTGCCCTTACTTGTC###24###Exon1###61.93###50###100###286

E1F###(Forward)

P53-Cf-###GTGACTCAGACAGGACTCATCTGG###24###Exon1###60.18###54.17###86

E1R###(Reverse)

P53-Cf-###CTGACCCTTGACTCTGGTCTCG###22###Internal###61.12###59.09###83

1SF###(Forward)

P53-Cf-###GTTGAGCGTCTGCCTTTGGTT###21###Internal###61.78###52.38###100

2SF###(Forward)

P53-Cf-###TGGTTTGGCATCTGAGGGGT###20###Internal###62.3###55###100

3SF###(Forward)

P53-Cf-###TGTGGCTTCTCAATAGTCTGTAGGC###25###Internal###62.1###48###100

4SF###(Forward)

P53-Cf-###GAGGAGGATGTGGGGCAGATAC###22###Internal###62.23###59.09###100

E9F###(Forward)

P53-Cf-###GAGTAGAATGGAATCCTGTGGCTTT###25###Internal###62.38###44###100

E10R###(Reverse)

P53-Cf-###AAAGCCACAGGATTCCATTCTACTC###25###Internal###62.38###44###100

6SF###(Forward)

P53-Cf-###TTACTCCAGCCTTGGACCCTTC###22###Internal###62.29###54.55###85

7SF###(Forward)

P53-Cf-###CCCTAAGACACTGAGTCATGAGCC###24###Internal###62.02###54.17###82

8SF###(Forward)

RESULTS AND DISCUSSION

Sequence diversity analysis of Tp53 gene: Tp53 is one of the most renowned tumor suppressor genes, which protect the whole genome but if this gene is transformed due to any reason, whole genome may be at risk and prone to develop malignancies. So, the whole gene was characterized including exonic and interonic regions for complete analysis of coding, non-coding and splicing regions.

Exon 3 mutational landscape: Exon 3 of Tp53 found altered almost in all cancer cases analyzed in this. Coding position c.76 was found homozygous (G) in one CTVT sample (DP10) and heterozygous (C/G) in sample (DP3) and (C/T) heterozygous in another CTVT sample (DP6), which appeared as non synonymous mutation and alter the leucine residue to valine in one case and phenylalanine in other case. Similarly, at coding position c.79 and c.80 in CTVT sample (DP3) is observed heterozygous (C/T), which change the proline amino acid into serine residue. Two mammary tumor samples (DP12, DP20) found homozygous (G), which cause the change of leucine residue to valine, while in other two cases ID (DP4, DP5) were found heterozygous (C/T) on the same position. Two mammary tumor samples (DP12, DP20), two CTVT samples (DP6, DP10) and one perianal adenocarcinoma cases (DP15) are heterozygous (C/A) at position c.87, which appeared as missense mutation and change the asparagine amino acid to lysine.

Most of the mammary tumors among all studied cancer types are widely mutated at different loci, e.g. c.90 position is found heterozygous (T/G) in one mammary lacerationin sample (DP20) and two CTVT samples (DP3, DP6), which are also non-synonymous mutation and changed the asparagine to lysine residue. CDS position c.92 is found (T/G) heterozygous in two of mammary adenocarcinoma samples (DP12, DP20) and one CTVT sample (DP10), which is also appeared as a non-synonymous mutation and change the valine to glycine. Another locus c.93 in exon 3 of Tp53 gene in CTVT case of dog (DP3) revealed heterozygous (T/G), which is synonymous mutation.

Mutational landscape of Exon 4: As far as exon 4 of Tp53 is concerned, CDS position c.103 is (G/A) heterozygous in one of the lymphoma sample (DP18) and one perianal adenocarcinoma sample (DP15), which is appeared as non-synonymous point mutation and changed the glutamic acid residue to lysine.

Mutational landscape of exon 5: Exon 5 coding position c.356 is mutated with homozygous (C) in one of the mammary tumor sample (DP11) instead of homozygous (A) in control and reference sequence (Figure 2a). This point mutation changed the lysine residue to threonine in its polypeptide chain of amino acid (Table 3).

Intronic mutational landscape: Tp53 intronic mutations are also detected in different canine tumors under study as compared to normal tissues and reference sequence. Intron 2, 3, 9 and 10 are found altered at different seven loci. Intron 2 showed deletion of (A) in all screened cases, including normal control, but reference control from database has (A) at 9114 position. Intron 3 showed heterozygosity on its three mutated loci. Altered gene position 9246 in exon 3 found heterozygous (T/G) in all screened samples, including normal instead of homozygous (T) in reference sample. The locus 9248 is highly polymorphic as it is homozygous (G) in one of the CTVT (DP6) and two mammary tumor sample (DP12, DP20), while heterozygous (T/G) in eight cases, three of them are mammary, two were perianal adenocarcinoma, one from each CTVT, lymphoma and head and neck tumor. Another locus 9263 was found heterozygous (C/G) in all screened cases.

As far as intron 9 is concerned, insertion of (T) and (C) were observed in all cases and control instead of reference sequence of two positions 11696, 11698, while one sample (DP26) was heterozygous (G/C) at position 12399 in intron 10 instead of homozygous (G) in all other cases including normal and reference controls (Table 4, Figure 2b)

Table 3. Signature exonic mutations of Tp53 gene in different tumor cases in Canis familiaris.

Animal###Phenotype/ Tissue type###Exon 3###Exon 4###Exon 5

ID###C.76###C.79###C.80###C.87###C.90###C.92###C.93###C.103###C.356

###C>G>T###C>T###C>T###C>A###T>G###T>G###T>G###G>A###A>C

Reference###Normal###C###C###C###C###T###T###T###G###A

Control###Normal/Blood###C###C###C###C###T###T###T###G###A

DP1###Case/Lymphoma###C###C###C###C###T###T###T###G###A

DP2###Case/MT###C###C###C###C###T###T###T###G###A

DP3###Case/CTVT###C>G###C>T###C>T###C###T>G###T###T>G###G###A

DP4###Case/MT###C>T###C###C###C###T###T###T###G###A

DP5###Case/MT###C>T###C###C###C###T###T###T###G###A

DP6###Case/CTVT###C>T###C###C###C>A###T>G###T###T###G###A

DP10###Case/CTVT###G###C###C###C>A###T###T>G###T###G###A

DP11###Case/MT###C###C###C###C###T###T###T###G###C

DP12###Case/MT###G###C###C###C>A###T###T>G###T###G###A

DP14###Case/Perianal Adenocarcinoma###C###C###C###C###T###T###T###G###A

DP15###Case/Perianal Adenocarcinoma###C###C###C###C>A###T###T###T###G>A###A

DP17###Case/Oral (SCC)###C###C###C###C###T###T###T###G###A

DP18###Case/Lymphoma###C###C###C###C###T###T###T###G>A###A

DP20###Case/MT###G###C###C###C>A###T>G###T>G###T###G###A

DP21###Case/CTVT###C###C###C###C###T###T###T###G###A

DP22###Case/Granuloma###C###C###C###C###T###T###T###G###A

DP23###Case/Granuloma###C>T###C###C###C###T###T###T###G###A

DP26###Case/Head and Neck T.###C###C###C###C###T###T###T###G###A

a.a###Leucine to Valine###Proline to###Proline to###Asparagine###Asparagine###Valine to###Synonymous###Glutamic###Lysine to

change###/ phenylalanine###serine###Leucine###to Lysine###to Lysine###Glycine###acid to lysine###threonine

Table 4. Signature intronic mutations of Tp53 in different tumors in Canis familiaris.

Sample ID###Phenotype / Tissue Type###Intron 1###Intron3###Intron 9###Intron 10

###9114###9246###9248###9263###11696###11698###12399

###Del(A)###T>G###T>G###C>G###Ins(T)###Ins(C)###G>C

Reference###Normal###A###T###T###C###-###-###G

Control###Normal/Blood###-###T/G###T/G###C/G###T###C###G

DP2###Case/MT###-###T/G###T###C/G###T###C###G

DP3###Case/CTVT###-###T/G###T###C/G###T###C###-

DP4###Case/MT###-###T/G###T/G###C/G###T###C###G

DP5###Case/MT###-###T/G###T/G###C/G###T###C###G

###Case/Blood###-###-###-###-###T###C###-

DP6###Case/CTVT###-###T/G###G###C/G###T###C###G

DP10###Case/CTVT###-###T/G###T###--###T###C###G

DP11###Case/MT###-###T/G###T/G###C/G###T###C###G

DP12###Case/MT###-###T/G###G###C/G###T###C###G

DP14###Case/Perianal Adenocarcinoma###-###T/G###T/G###C/G###T###C###G

DP15###Case/Perianal Adenocarcinoma###-###T/G###T/G###C/G###T###C###G

DP18###Case/Lymphoma###-###T/G###T/G###C/G###T###C###G

DP20###Case/MT###-###T/G###G###C/G###T###C###G

DP21###Case/CTVT###-###T/G###T/G###C/G###T###C###G

DP23###Case/Granuloma###-###T/G###T/G###C/G###T###C###G

DP26###Case/Head and Neck T.###-###T/G###T###C/G###T###C###G/C

A study by Robinson found that cancer development is micro-evolutionary process, in which merely a single point mutation is not responsible for cancer outbreak, but single mutation can start the process of chaos in the genome. The tumor suppressor Tp53 gene was selected here, which has pro-apoptotic activities. Normally, mutations damage the proto-oncogene and trigger them to become oncogene, these mutations might keep the cell cycle acceleration on, which should remain stop all the time in a fully functional proto-oncogenes. On the other hand, mutations alter the tumor suppressing function of these genes and lose of function may accure due to cell growth brakes, which usually tells the cell to stop growing as their life span has ended (Souza et al., 2012). It is also observed in the current results that Tp53 tumor suppressor gene is highly mutant especially in intronic regions.

A similar study was conducted successfully, which depicts that exon 4 and 8 in Tp53 gene have different mutations in dog mammary tumors cases, in which CDS Positions 147, 248, 266 and 287 proved missense and changes the valine residue to serine, arginine to proline, glycine to proline and glutamic acid to valine respectively. It is also demonstrated that codon 176TGC>TTC, 236TAC>AAC and 245GGC>GCC found mutated in dog mammary tumor cell lines which is also in conformity to human codons(Van Leeuwen et al., 1996).Another study was conducted on sixty three benign and malignant mammary carcinoma on dog's Tp53 gene, in which four missense mutations were observed in 38 benign cases, five missense mutation in 25 mammary carcinomas and one nonsense mutation was found in 25 mammary carcinomas(Muto et al., 2000). According to another Mexican study in which TVT cases in dogs were screened with Tp53 gene and four new polymorphism were found(Sanchez-Servin et al., 2009).

In another study which demonstrated that TVT is one of the oldest and most mutated transmissible cancer genome in animals which has almost 10,000 non-synonymous mutation among its 1.9 million alteration in total, while 646 genes were lost in its genome(Murchison et al., 2014).found that CTVT samples included in this study showed (G) change in two samples (DP3, DP10) while another sample (DP6) was found changed with (T) at c.76 position which was (C) in control and reference sample. Similarly, in another study of Canis familiaris mammary carcinoma, in which exon 4 and 8 of Tp53 gene found hotspot regions(Souza et al., 2012). (Wakui et al., 2001) showed that prognostic and diagnostic implications of Tp53 gene was also addressed, in which 17% canine mammary adenocarcinoma cases were found to be altered in 5-8 exons. Similarly, (Setoguchi et al., 2001; Veldhoen et al., 1998) demonstrated that canine lymphoma samples were sequenced directly for studying the Tp53 somatic variants.

In one of the similar type of study, seven lymphoma cases were found aberrant on one or both alleles. In the current studied samples, exon 4 and 5 at CDS position 103, 356 were found altered, which fall into 34 and 118 number codon respectively. These are non-synonymous alterations and change the glutamic acid amino acid to lysine and lysine to threonine respectively (Table 5). As for as the human cancer in the context of comparative genomics are concerned, (Murakami et al., 1996) highlighted few of human lungs cancer cases, (Heide et al., 1997) found colorectal cancer, (Ooyama et al., 2006) demonstrated the breast cancer and (Nakamori et al., 1995) revealed 1bp deletion in pancreatic adenocarcinoma.at the same CDS 76 position in 26 codon of exon 3. The same position was also found altered (C>G/T) in our eight samples (DP3, DP4, DP5, DP6, DP10, DP12, DP20, DP23) of mammary, CTVT and granuloma tumors cases (Table 5). This position is at the end of exon 3 and may involve splicing site.

In above mentioned human studies, this position appeared non-synonymous similar to our samples, but in human studies it appeared as frame shift point mutation, while in our dogs' samples, it changed the valine residue to phenylalanine amino acid. Another human study where (Nakamori et al., 1995) reportedc.79 position in the same exon 3 at 27th codon was found altered. (Fransen et al., 2004), (Jones et al., 2008) and (Lee et al., 2010) revealed the following four studies in human pancreatic cancer, colorectal adenocarcinoma, pancreatic tumor and in non-small cell lungs cancer. In the earlier three studies, this codon showed non-synonymous frame shift mutations, while in the fourth one this c.79 locus in codon 27 changed from CCT to ACT codon, which replaced the proline amino acid to threonine. In our studied tumor cases of dog Tp53, this c.79 locus in 27th codon changed from (C>T) in one of the CTVT sample ID (DP3) and this non-synonymous mutation replaced the proline to serine amino acid (Table 3).

According to (Curtis et al., 2012) exon 3 c.80 locus in human breast tumor showed a change of CCT to CTT, which replaced the proline amino acid into leucine, the same c.80 locus in one of our studied CTVT sample ID (DP3) revealed the same change of (C>T) as observed in the human and replaced the proline amino acid to leucine residue (Table 3). (Grenier, 2002) revealed that CDS position 87 was also found altered in another human breast cancer study, in which AAC29AAG codon change was observed, which replaced the asparagine amino acid to lysine, exactly the same position was noticed in our two mammary tumors (DP12, Dp20), two CTVT samples (DP6, DP10) and one perianal adenocarcinoma sample (DP15) in dog, in which c.80 locus was found altered (C>A) which changed the asparagine to lysine, same as in the human cases (Table 3).

c.103 locus in exon 4 is also found altered in three human studies, two studies were conducted by (Mitsudomi et al., 1992)on NSCLC, in which insertion were observed and appeared as frame shift mutations, another study by (Lee et al., 2010) showed the same results, while one study conducted by (Temam et al., 2003) on human head and neck SCC which showed deletion at the same locus. Our study on these veterinary species also found this locus as a hotspot and observed (G>A) change at this locus, which changed the glutamic acid amino acid to lysine (Table 3).

(Backvall et al., 2004) demonstrated that according to Codon 119 of Tp53 gene at c.356 position in our dog mammary tumor (DP11) was found altered in accordance to two of the human skin basal cell carcinoma in which GCC>GAC transversion mutation was observed(Lind et al., 2007), which changed the alanine amino acid into asparagine (p.A119D) and other one was human NSCLC, which changed c.356C>G, this mutation transformed the polypeptide chain from alanine to glycine (p.A119G). Current study can be extended by gene expression profiling in this tumor suppressor gene which can be coupled with sequence diversity data for the purpose of establishing fidelity in the field of diagnostic, two of similar studies were conducted on Tp53 markers in CTVT cases, which augment the diagnostic confidence on the basis of these polymorphism and expression based techniques(Chu et al., 2001; Stockmann et al., 2011).

Cancer treatment by inhibiting Hspb27gene product is also getting acceptance in the scientific community to combat this cancer type in different species(Gleave et al., 2009).

Cross-tissue comparison: As a subsidiary finding, comparison of neoplastic tissues and blood of the same diseased animal were compared, in which Tp53 gene was amplified in one of the mammary tumor sample (DP5) to ascertain the comparison of mutational variations in blood and tumorous tissues of the animal to have an idea of germ line and somatic transmitted mutations. As somatic cell mutations in neoplastic tissues are those which are due to cancer outbreak, while the germ line mutations have familial history and transfer generations to generations. It has been observed that, Tp53 c.76 position in dog mammary tumor (DP5) tissues has somatic mutation of (T), while same position has a germ line mutation (C) at the same locus (Table 3). Similarly, Tp53 intron 3 positions 9246, 9248 and 9263found polymorphic/heterozygous (T/G), (T/G) and (C/G) in cancerous tissues and found homozygous (T), (T) and (C) in germ line tissues in sampleID (DP5) (Table 4).

Conclusion: In nutshell, seven different loci in intron 2, 3, 9 and 10 were found altered. It is also predominantly deduced that most of heterozygous variants are observed in intronic regions rather than exonic part of the gene.

Acknowledgements: Authors would like to thank the whole staff of Lyons Feline Genetics lab at University of Missouri-Columbia USA. Pet Center-UVAS team is also appreciated for helping in sample collection. We also pay our gratitude to HEC for funding this project.

REFERENCES

SequencherA(r) version 5.2 sequence analysis software, Gene Codes Corporation, Ann Arbor, MI USA In, City.

Backvall, H., Stromberg, S., Gustafsson, A., Asplund, A., Sivertsson, A., Lundeberg, J., Ponten, F., 2004. Mutation spectra of epidermal p53 clones adjacent to basal cell carcinoma and squamous cell carcinoma. Experimental dermatology 13, 643-650.

Chu, R., Sun, T., Yang, H., Wang, D., Liao, K., Chuang, T., Lin, C., Lee, W., 2001. Heat shock proteins in canine transmissible venereal tumor. Veterinary Immunology and Immunopathology 82, 9-21.

Curtis, C., Shah, S.P., Chin, S.-F., Turashvili, G., Rueda, O.M., Dunning, M.J., Speed, D., Lynch, A.G., Samarajiwa, S., Yuan, Y., 2012. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346-352.

Ensemble genome browser. In, City.

ExoSAP-IT PCR Product Cleanup. In, City.

Eze, C., Anyanwu, H., Kene, R., 2008. Review of canine transmissible venereal tumour (TVT) in dogs. Nigerian Veterinary J. 28, 54-70.

Fransen, K., Klintenas, M., Osterstrom, A., Dimberg, J., Monstein, H.-J., Soderkvist, P., 2004. Mutation analysis of the BRAF, ARAF and RAF-1 genes in human colorectal adenocarcinomas. Carcinogenesis 25, 527-533.

Ganguly, B., Das, U., Das, A., 2013. Canine transmissible venereal tumour: a review. Veterinary and Comparative Oncology.

Gleave, M., Ong, C., Hayashi, N., 2009. Treatment of Cancer by Inhibition of HSP27. In. Google Patents, City.

Grenier, 2002. Interest of investigating p53 status in breast cancer by four different methods. Oncology reports 9, 1167-1172.

Heide, I., Thiede, C., Sonntag, T., De Kant, E., Neubauer, A., Jonas, S., Peter, F., Neuhaus, P., Herrmann, R., Huhn, D., 1997. The status of p53 in the metastatic progression of colorectal cancer. European J. Cancer 33, 1314-1322.

Hollstein, M., Sidransky, D., Vogelstein, B., Harris, C.C., 1991. p53 mutations in human cancers. Science 253, 49-53.

Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., 1990. PCR protocols: a guide to methods and applications. Access Online via Elsevier.

Jones, S., Zhang, X., Parsons, D.W., Lin, J.C.-H., Leary, R.J., Angenendt, P., Mankoo, P., Carter, H., Kamiyama, H., Jimeno, A., 2008. Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science 321, 1801-1806.

Lee, E.B., Jin, G., Lee, S.Y., Park, J.Y., Kim, M.J., Choi, J.E., Jeon, H.S., Cha, S.I., Cho, S., Kim, C.H., 2010. TP53 mutations in Korean patients with non-small cell lung cancer. J. Korean medical science 25, 698-705.

Lind, H., Ekstrom, P.O., Ryberg, D., Skaug, V., Andreassen, T., Stangeland, L., Haugen, A., Zienolddiny, S., 2007. Frequency of TP53 Mutations in Relation to Arg72Pro Genotypes in Non-Small Cell Lung Cancer. Cancer Epidemiology Biomarkers and Prevention 16, 2077-2081.

Mitsudomi, T., Steinberg, S., Nau, M., Carbone, D., D'amico, D., Bodner, S., Oie, H., Linnoila, R., Mulshine, J., Minna, J., 1992. p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7, 171-180.

Murakami, I., Fujiwara, Y., Yamaoka, N., Hiyama, K., Ishioka, S., Yamakido, M., 1996. Detection of p53 gene mutations in cytopathology and biopsy specimens from patients with lung cancer. American J. of Respiratory and Critical Care Medicine 154, 1117-1123.

Murchison, E.P., Wedge, D.C., Alexandrov, L.B., Fu, B., Martincorena, I., Ning, Z., Tubio, J.M.C., Werner, E.I., Allen, J., De Nardi, A.B., Donelan, E.M., Marino, G., Fassati, A., Campbell, P.J., Yang, F., Burt, A., Weiss, R.A., Stratton, M.R., 2014. Transmissible Dog Cancer Genome Reveals the Origin and History of an Ancient Cell Lineage. Science 343, 437-440.

Muto, T., Wakui, S., Takahashi, H., Maekawa, S., Masaoka, T., Ushigome, S., Furusato, M., 2000. p53 gene mutations occurring in spontaneous benign and malignant mammary tumors of the dog. Veterinary Pathology Online 37, 248-253.

Nakamori, S., Yashima, K., Murakami, Y., Ishikawa, O., Ohigashi, H., Imaoka, S., Yaegashi, S., Konishi, Y., Sekiya, T., 1995. Association of p53 gene mutations with short survival in pancreatic adenocarcinoma. Cancer science 86, 174-181.

NetPrimer software. In, City.

North, S.M., Banks, T.A., 2009. Small Animal Oncology: An Introduction. Saunders/Elsevier.

Ooyama, A., Takechi, T., Toda, E., Nagase, H., Okayama, Y., Kitazato, K., Sugimoto, Y., Oka, T., Fukushima, M., 2006. Gene expression analysis using human cancer xenografts to identify novel predictive marker genes for the efficacy of 5-fluorouracil-based drugs. Cancer science 97, 510-522.

Paoloni, M.C., Khanna, C., 2007. Comparative oncology today. Veterinary Clinics of North America: Small Animal Practice 37, 1023-1032.

Rozen, S., Skaletsky, H., 1999. Primer3 on the WWW for general users and for biologist programmers. In, Bioinformatics methods and protocols. Springer, pp. 365-386.

Sanchez-Servin, A., Martinez, S., Cordova-Alarcon, E., Fajardo, R., 2009. TP53 Polymorphisms allow for genetic sub-grouping of the canine transmissible venereal tumor. J. Vet. Science 10, 353.

SequelPrep Long PCR kit with dNTPs. In, City.

Setoguchi, A., Sakai, T., Okuda, M., Minehata, K., Yazawa, M., Ishizaka, T., Watari, T., Nishimura, R., Sasaki, N., Hasegawa, A., 2001. Aberrations of the p53 tumor suppressor gene in various tumors in dogs. American J. Vet. Res. 62, 433-439.

Souza, D., Barros, M., Silva, J., Silva, M., Coleto, Z., Jimenez, G., Adriao, M., Wischral, A., 2012. Detection of mutations within exons 4 to 8 of the p53 tumor suppressor gene in canine mammary glands. Arquivo Brasileiro de Medicina Veterinaria e Zootecnia 64, 341-348.

Stockmann, D., Ferrari, H., Andrade, A., Cardoso, T., Luvizotto, M., 2011. Detection of the tumour suppressor gene TP53 and expression of p53, Bcl-2 and p63 proteins in canine transmissible venereal tumour. Veterinary and Comparative Oncology 9, 251-259.

Temam, S., Trassard, M., Leroux, G., Bosq, J., Luboinski, B., Lenoir, G., Benard, J., Janot, F., 2003. Cytology vs molecular analysis for the detection of head and neck squamous cell carcinoma in oesopharyngeal brush samples: a prospective study in 56 patients. British J. Cancer 88, 1740-1745.

Van Leeuwen, I.S., Hellmen, E., Cornelisse, C.J., Van Den Burgh, B., Rutteman, G.R., 1996. P53 mutations in mammary tumor cell lines and corresponding tumor tissues in the dog. Anticancer research 16, 3737-3744.

Veldhoen, N., Stewart, J., Brown, R., Milner, J., 1998. Mutations of the p53 gene in canine lymphoma and evidence for germ line p53 mutations in the dog. Oncogene 16, 249.

Vermooten, M., 1987. Canine transmissible venereal tumor (TVT): a review. J. The South African Veterinary Association 58, 147.

Vogelstein, B., Gillespie, D., 1979. Genomic DNA Mini Kit (Tissue). In. Proceedinds National Academy of Science, City.

Wakui, S., Muto, T., Yokoo, K., Yokoo, R., Takahashi, H., Masaoka, T., Hano, H., Furusato, M., 2001. Prognostic status of p53 gene mutation in canine mammary carcinoma. Anticancer research 21, 611.

Withrow, S.J., Vail, D.M., 2007. Withrow and MacEwen's small animal clinical oncology. WB Saunders Company.

Zoubeidi, A., Gleave, M., 2012. Small heat shock proteins in cancer therapy and prognosis. Int J Biochem Cell Biol 44, 1646-1656.
COPYRIGHT 2018 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Date:Oct 31, 2018
Words:5833
Previous Article:PRODUCTION OF CALLUS BIOMASS AND ANTIOXIDANT SECONDARY METABOLITES IN BLACK CUMIN.
Next Article:INVESTIGATIONS ON ONOSMA HISPIDUM WALL ROOT EXTRACTS FOR IN-VITRO ANTIDIABETIC, PROLIFERATIVE AND CYTOTOXIC EFFECTS.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |