Printer Friendly

SCREENING OF RICE LINES OF DIVERSE ORIGIN RESISTANT TO BACTERIAL LEAF BLIGHT UNDER LOCAL CONDITIONS.

Byline: M. Rizwan, M. Farooq, M.S. Akhter, M. Akhter and W. Hussain

ABSTRACT: Current study comprised of 20 donor parent lines and four indica elite strains resistant against bacterial leaf blight having diversity in origin viz. Bangladesh, Philippine, Indonesia, Senegal and India. The lines were tested to check resistance against Bacterial Leaf Blight (BLB), having BLB resistance genes Xa-4, xa-5, Xa-7 and xa-13. The experiment was conducted at Agronomic Research Station, Farooqabad, Sheikhupura. Artificial inoculation was done to study disease reaction. DNA marker analysis was also conducted to study the gene status of these lines. Results indicated that seven donor lines were completely resistant to Bacterial Leaf Blight whereas twelve lines exhibited moderate resistance. Among rest of the five susceptible genotypes, three were showing comparatively low susceptibility whereas two completely susceptible to BLB.

Most of the lines with three or four gene combinations showing resistant behavior against BLB except AUS-298 that showed moderately susceptible behavior. Combination of genes for Bacterial Leaf Blight resistance can be explored further in targeted research program for disease resistance.

Keywords: Bacterial Leaf Blight, Resistance, Artificial inoculation, Diversity, Gene.

INTRODUCTION

Rice is the staple food for one-third populace of the world (Tang et al., 2001). Rice production is constrained by several factors but various diseases of fungal, bacterial and viral origin proved to be the most devastating biotic threat to its overall yield. Oldest know disease of rice, Bacterial leaf blight, caused by Xanthomonas oryzae pv. Oryzae (Xoo), was first reported in Japan in 1884 (Dinh et al. 2010). The disease incidence was observed in Northern Australia, Asia, USA and Africa while no record of disease was reported in Europe (Shanti et al., 2001).

Studies regarding yield losses due to BLB revealed varying levels of reduction in grain yield, depending on various factors like crop stage, susceptibility of strain and favorable environmental conditions. Due to its high damage to the rice field, a lot of studies and observations have already been done for controlling this disease but effective control measures are yet to be found (Mubassir et al. 2016). BLB caused 70-80% infestation in some African countries. Yield losses ranged from 20-30% with peak of 50-90% in some parts of the world (Sere et al. 2005). In rice-irrigated areas, BLB can cause severe yield losses of 20% and 70% due to varietal susceptibility, growth stage of crop, geographic situation and climatic conditions (Wonni et al. 2016). Generally, BLB disease is more prevalent in some Asian countries during monsoon season. Usually plants are affected at the later stage of tillering, reducing rice yield from 10 to 20% (Shazia et al. 2009).

BLB incidence has started to rise in recent years in "Kaller" rice belt of Pakistan (Khan et al. 2000). Disease incidence on rice was recorded high during years between 1997-2008 in Central Punjab and Upper Northern areas (Khan et al. 2009). Susceptibility of basmati varieties to BLB is main contributing factor of its epidemic on wide scale. Development of resistant varieties had always been target of rice breeders. Screening of plants is common practice to develop resistant varieties against a particular stress (Ashfaq et al. 2016). Host-plant resistance would serve as a beneficial tool in managing BLB in rice crop (Banito et al. 2012). Host-plant resistance should be practiced in combination with other integrated practices to defend crop against menace of this disease (Singh et al. 2015). Severity of infection has stressed scientists to develop resistant strains to reduce yield losses.

MATERIALS AND METHODS

Seed of twenty parent lines having resistant genes against BLB belonging to different geographic locations viz. Bangladesh, India, Philippines, Indonesia and Senegal along with four indica elite lines was obtained from International Rice Research Institute, Philippines. The lines were screened for resistance against bacterial leaf blight at Agronomic Research Station Farooqabad, Sheikhupura, Pakistan. These lines were evaluated in augmented design during kharif 2012. Nursery was sown on 20-05-2012. Thirty-day old nursery transplanted in field at PxP and RxR distance of 20 cm. All standard agronomic practices were adopted. To create conducive environment for disease occurrence, double dose (100 kg per acre) of nitrogen was applied (Ashfaq et al. 2016).

Isolation of bacteria: Diseased leaf samples of rice were cut into 5-10 mm and sterilized with 70% ethanol for 10 seconds. Samples were washed twice with distilled water and left in a Petri plate dipped in distilled water for 15 minutes. Bacteria were streaked out on artificial nutrient media (Joint et al., 2016) with the help of sterilized wire loop. Yellow colonies appeared on streaked plates after three days incubation at 30 degC. The bacterial culture was then identified by gram's staining method (Gerhardt, 1981).

Inoculation: Aluminium wrapped flasks were used to protect inoculum from sunlight. Inoculation was carried out using clip method (Kauffman et al. 1973). 1-2 cm tips of expanded leaves of each plant were clipped with scissors dipped in inoculum. Sterilized distilled water was used to inoculate control plants.

Disease scoring: Fourteen days post inoculation, the plants were surveyed for 21 days with 24 hours' time interval to record onset of disease symptoms. At 21 DAI (days after inoculation), final data was recorded. Disease incidence (%) was calculated by following formula (Ganamanickam et al. 1999).

% Disease Incidence = Lesion Length / Total Leaf Length x 100

Following scale was used as standard to estimate host plant response (Sanchez et al. 2000).

Table 1. Score chart for Bacterial Leaf Blight infection

Infection %###Score###Host Response

0###0###Highly Resistant

1-10###1###Resistant

10-30###3###Moderately Resistant

30-50###5###Moderately Susceptible

50-75###7###Susceptible

75-100###9###Highly Susceptible

DNA Marker Analysis: At tillering, tissues from healthy leaves were harvested and kept at -80 oC to extract DNA. CTAB method was used to extract genomic DNA (Sambrook and Russell, 2001 and Dellaporta et al. 1983). Extracted DNA was examined on agarose gel (Fig-I). Status of BLB resistant genes was examined through previously published DNA markers (Table-2).

Polymerase Chain Reaction (PCR): Amplification reactions were carried out in 20 ul volume using the following recipe.

Table 2. Microsatellite (SSR) markers to evaluate BLB genes

Gene###Marker###Type of Marker###Primer sequence(5-3)###Reference

Xa4###MP 1###STS###ATCGATCGATCTTCACGAGG###Ma et al., 1999

###MP2###TCGTATAAAAGGCATTCGGG

xa5###RM122 F###SSR###GAGTCGATGTAATGTCATCAGTGC###Chen et al., 1997

###RM122 R###GAAGGAGGTATCGCTTTGTTGGAC

Xa7###M5 F###STS###CGATCTTACTGGCTCTGCAACTCTGT###Porter et al., 2003

###M5 R###GCATGTCTGTGTCGATTCGTCCGTACGA

xa13###RGI36 F###STS/###TCCCAGAAAGCTACTACAGC###Zhang et al., 1996

###RG136 R###HinfI###GCAGACTCCAGTTTGACTTC

Table 3. Volume and Concentration of Reagents.

Reagents###Conc.###Volume Used (ul)

###Xa-4###xa-5###Xa-7###xa-13

PCR buffer###10 X###2###2###2###2

MgCl2###25 mM###1.6###1.6###1.6###1.6

dNTPs###2.5 mM###1###2###2###2

Primer Forward###15 ng/ul###1###2###2###2.5

Primer Reverse###15 ng/ul###1###2###2###2.5

Taq DNA polymerase###5 units/ul###0.2###0.2###0.2###0.2

Template DNA###15 ng/ul###2###3###3###4

d3H2O###-###11.2###7.2###7.2###4.2

RESULTS AND DISCUSSION

Twenty donor parents for BLB and four Indica elite lines along with the resistance gene combination present in these lines were studied for their disease reaction against bacterial leaf blight. As indicated in Table-4, seven genotypes showed resistance against BLB. Among the resistant genotypes five lines including SPONJONA (xa5, Xa7, xa13), PURANUKNA (Xa4, xa5, Xa7), TUPA-501, JAWA-14 and IR02A127 with (Xa4, xa5, xa13) had three genes in combination. The line IR04A421 was also among resistant category having four genes in pyramid (Xa-4, xa-5, Xa-7, xa-13), whereas genotype CAS-209 possessed Xa-4 and xa-5 genes for BLB resistance.

Twelve lines including KALIMERIKRI (Xa-4, xa-5, xa-13), PULUT NANGKA (Xa-4, xa-5, Xa-7, xa-13), ARC 11204 (Xa-4, xa-5, Xa-7, xa-13), BERI (Xa-4, xa-5, Xa-7, xa-13), INGRA (Xa-4, xa-5, Xa-7, xa-13), LAKSMILOTA (Xa-4, xa-5, Xa-7, xa-13), AUS-307 (Xa-4, xa-5, Xa-7, xa-13), AUS-361 (Xa-4, xa-5, Xa-7, xa-13), RATA 21-3 (Xa-4, xa-5, Xa-7, xa-13), TUPA-730 (Xa-4, xa-5, xa-13), TRM-6 (Xa-4, xa-5, xa-13) and IR05A272 (Xa-4, xa-5, xa-13) had moderately resistant behavior against X. oryzae pv oryzae. Most of the MR lines had three or four gene combination. The genotypes AUS-80, AUS-298 and DJ-2 were found moderately susceptible in their response. Two genotypes BJ-1 and IR06A150 were susceptible to bacterial leaf blight.

Multiple resistance genes were used in crop breeding strategies to develop high resistance level (Samis et al. 2002; Huang et al. 1997). In a study of soybean crop, Shi et al. (2009) observed that high resistance was observed by three resistance genes (Rsv1, Rsv3, and Rsv4) against soybean mosaic virus. Wider resistance level was observed in combination of 4 resistance genes (Xa4, xa5, xa13, and Xa21) against Xoo strains (Kumar et al. 2008), whereas, increased lesion length was observed at 21 DAI in lines having two-gene combination, while three-gene combination lines depicted no increase in lesion length. In a study, Sundaram et al. (2008) made similar observations by indicating that possibility of critical mass of genetic resistance may inherent in such cases. This depicts importance of combining more than two genes for long-lasting resistance against pathogens. Gene interaction may exhibit higher resistance level (Sanchez et al. 2000; Yoshimura et al. 1995).

High level of resistance in combination of genes was observed in previous studies (Sundaram et al. 2008; Singh et al. 2001; Sanchez et al. 2000; Huang et al. 1997). This anomaly may be due to mutual combination of resistant genes in pyramid lines. Quantitative complementation involves high resistance level against single race by more than one gene (Sanchez et al. 2000). Similar studies were used to evaluate the best gene combinations showing wider resistance. These studies concluded that combination of four genes (i.e., Xa4, xa5, xa13, Xa21) was having durable resistance against various pathogen strains (Nayak et al. 2008; Shanti and Shenoy 2005).

Table 4. Rice germplasm under different reaction grades after inoculated by Xanthomonas oryzae pv Oryzae.

Sr. No.###Varieties/Lines###Gene Status###Disease Incidence (%)###Score

1###KALIMERIKRI###Xa-4, xa-5, xa-13###28.13###MR

2###PULUT NANGKA###Xa-4, xa-5, Xa-7, xa-13###29.27###MR

3###SOPONJONO###xa-5, Xa-7, xa-13###8.55###R

4###ARC 11204###Xa-4, xa-5, Xa-7, xa-13###21.01###MR

5###BERI###Xa-4, xa-5, Xa-7, xa-13###29.91###MR

6###PURA NUKNA###Xa-4, xa-5, Xa-7###9.43###R

7###INGRA###Xa-4, xa-5, Xa-7, xa-13###25.00###MR

8###LAKSMILOTA###Xa-4, xa-5, Xa-7, xa-13###28.85###MR

9###AUS-80###Xa-4, xa-13###49.17###MS

10###AUS-298###Xa-4, xa-5, xa-13###46.22###MS

11###AUS-307###Xa-4, xa-5, Xa-7, xa-13###25.85###MR

12###AUS-361###Xa-4, xa-5, Xa-7, xa-13###29.73###MR

13###RATA 21-3###Xa-4, xa-5, Xa-7, xa-13###29.66###MR

14###TUPA-501###Xa-4, xa-5, xa-13###9.93###R

15###TUPA-730###Xa-4, xa-5, xa-13###29.41###MR

16###JAWA-14###Xa-4, xa-5, xa-13###8.33###R

17###TKM-6###Xa-4, xa-5, xa-13###23.64###MR

18###DJ-2###Xa-4, xa-13###41.18###MS

19###CAS-209###Xa-4, xa-5###9.40###R

20###BJ-1###xa-5, xa-13###60.38###S

21###IR05A272###Xa-4, xa-5, xa-13###27.66###MR

22###IR02A127###Xa-4, xa-5, xa-13###8.63###R

23###IR04A421###Xa-4, xa-5, Xa-7, xa-13###9.24###R

24###IR06A150###xa-5###52.86###S

The study revealed that most of the combinations of genes exhibited strong resistance against Bacterial Leaf Blight. Therefore the lines having three gene pyramid and four gene pyramid could be selected further in breeding programs for incorporation of durable resistance in our local lines.

REFERENCES

Ashfaq, M., M. Rizwan, A. Rashid, M. Akhter, F. Khan, M. Ali, M.B. Chattha, M. Sajjad and U. Mubashar (2016). Disease response of exotic rice genotypes against Bacterial Leaf Blight and its effect on various morphological traits. Pak. J. Phytopathol. 28 (02): 269-274.

Banito, A., E.A. Kadai and Y. Sere (2012). Screening of rice varieties for resistance to bacterial leaf blight. J. Appl. Biosci. 53: 3742-3748.

Chen, X., S. Temnykh, Y. Xu, and Y.G. Cho (1997). Development of a microsatellite Framework map providing genome-wide coverage in rice (Oryza sativa L.). Theor. Appl. Genet. 95: 553-567.

Dellaporta, S.L., J. Wood and J.B. Hicks (1983). Mini prep for plant DNA isolation. Plant Mol. Biol. Rep. 4: 19-21.

Dinh, D.H., P.V. Du and L.C. Loan (2010). Study on the use of combination resistance genes in rice lines against Xanthomonas Oryzae Pv Oryzae in cuulong river delta. Omonrice 17: 147-151.

Gerhardt, P. (1981). Manual of methods of general bacteriology. American Society of Microbiology Washington, D.C.

Ganamanickam, S.S., V.B. Priyadarisini, N.N. Narayanan, P. Vasudevan and S. Kavita (1999). An overview of bacterial blight disease of rice and strategies for its management. Center for Advance Studies in Botany, University of Madras, Guindly Campus.Chennai 600025. India. Current Sci. 77 (11): 1435-1444.

Huang, N., E.R. Angeles, J. Domingo, G. Magpantay, S. Singh, Q. Zhang, N. Kumaravadivel, J. Bennett and G.S. Khush (1997). Pyramiding of bacterial resistance genes in rice: marker aided selection using RFLP and PCR. Theor. Appl. Genet. 95: 313-320.

Jonit, N.Q., Y.C. Low and G.H. Tan (2016). Xanthomonas oryzae pv. oryzae, Biochemical Tests, Rice (Oryza sativa), Bacterial Leaf Blight (BLB) Disease, Sekinchan. J. Appl. Envi. Microb. 4 (3): 63-69.

Kauffman, H.E., A. Reddy, S.P.Y. Hsieh, and S.D. Merea (1973). An improved technique for evaluating resistance of varieties to Xanthomonas oryzae pv. Oryzae. Plant Dis. Rep. 57: 537-541.

Khan, J.A., F.F. Jamil and M.A. Gill (2000). Screening of rice varieties/lines against Bakanae and Bacterial leaf blight (BLB). Pak. J. Phytopath. 12 (1): 6-11.

Khan, J.A., M.I. Arshad, F.F. Jamil and S. Hasnain (2009). Evaluation of rice genotypes against Bacterial Leaf Blight (BLB) Disease. Pak. J. Phytopath. 21: 26-30.

Kumar, B., S., R.S.D Paulraj, P.V. Brindha, S. Kavitha and S.S. Gnanamanickam (2008). Improvement of bacterial blight resistance in rice cultivars J. Yothi and IR50 via marker-assisted backcross breeding. J. Crop Improve. 21: 101-116.

Ma, B.J., W.M. Wang, B. Zhao and Y.L. Zhou (1999). Studies of PCR marker for rice bacterial blight resistance gene Xa-4. Hereditas. 21: 9-12.

Mubassir, M.H.M., K.M. Nasiruddin, N.H. Shahin, S.N. Begum, M.K. Saha and A.Q.M.B. Rashid (2016). Morpho-Molecular screening for bacterial leaf blight resistance in some rice lines and varieties. J. Plant Sci. 4(6): 146-152.

Nayak, D., M.L. Shanti, L.K. Bose, U.D. Singh and P. Nayak (2008). Pathogenicity association in Xanthomonas oryzae pv. oryzae the causal organism of rice bacterial blight disease. ARPN. J. Agric. Biol. Sci. 3: 12-26.

Porter, B. W., J. M. Chittoor, M. Yano, T. Sasaki and F.F. White (2003). Development and mapping of markers linked to the rice bacterial blight resistance gene Xa7. Crop Sci. 43: 1484-1492.

Sambrook, J.F. and D.W. Russell (2001). Molecular Cloning: A Laboratory Manual (3rd ed.), Cold Spring Harbor Laboratory Press.

Samis, K., S. Bowley and M. Kersie (2002). Pyramiding Mn superoxide dismutase transgenes to improve persistence and biomass production in alfalfa. J. Exp. Bot. 53: 1343-1350.

Sanchez, A.C., D.S. Brar, N. Huang and G.S. Khush (2000). Sequence tagged site markers-assisted selection for three bacterial blight resistance genes in rice. Crop Sci. 40: 792-797.

Sere, Y., A. Onasanya, V. Verdier, K. Akator and L.S. Ouedraogo (2005). Rice bacterial leaf blight in West Africa: preliminary studies on disease in farmer's field and screening. Asian J. Plant Sci. 4: 577-579.

Shanti, M.L., M.L.C. George, C.M.V. Cruz, M. Bernando, R.J. Nelson, H. Leung, J.N. Reddy and R. Sridhar (2001). Identification of resistance genes effective against rice bacterial blight pathogen. Plant Disease. 85: 506-512.

Shanti, M.L. and V.V. Shenoy (2005). Evaluation of resistance genes and their pyramids against rice bacterial leaf blight pathogen Xanthomonas oryzae pv. oryzae. Oryza. 42: 169-173.

Shazia, M., S.A. Malik, I. Ahmed, J.I. Mirza and M.A. Akhtar (2009). Studies on virulence reactions of local isolates of Xanthomonas oryzae pv. oryzae. Pak. J. Bot. 41(1): 391-402.

Shi, A., P. Chen, D.X. Li, C. Zheng, B. Zhang and A. Hou (2009). Pyramiding multiple genes for resistance to soybean mosaic virus in soybean using molecular markers. Mol. Breed. 23: 113- 124.

Singh, A.K., E. Dharmraj, R. Nayak, P.K. Singh and N.K. Singh (2015). Identification of bacterial leaf blight resistance genes in wild rice of eastern India. Turk. J. Bot. 39: 1060-1066.

Singh, S., J.S. Sidhu, N. Huang, Y. Vikal, Z. Li, D.S. Brar, H.S. Dhaliwal and G.S. Khush (2001). Pyramiding three bacterial blight resistance genes (xa-5, xa-13 and Xa-21) using marker assisted selection into indica rice cultivar PR-106. Theor. Appl. Genet. 102: 1011-1015.

Sundaram, R.M., M.R. Vishnupriya, S.K. Biradar, G.S. Laha, G. A. Reddy, N.S. Rani, N.P. Sarma and R.V. Sonti (2008). Marker-assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica. 80: 411- 422.

Tang, K., X. Sun, Q. Hu, A. Wu, C.H. Lin, H.J. Lin, R.M. Twyman, P. Christou and T. Feng (2001). Transgenic rice plants expressing the ferredoxin-like protein (AP1) from sweet pepper show enhanced resistance to Xanthomonas oryzae pv. Oryzae. Plant Sci. 160: 1035-1042.

Wonni, I., M. Hutin, L. Ouedrago, I. Somda, V. Verdier and B. Szurek (2016). Evaluation of Elite Rice Varieties Unmasks New Sources of Bacterial Blight and Leaf Streak Resistance for Africa. J. Rice Res. 4(1): 1-8.

Yoshimura, S., A. Yoshimura, N. Iwata, S.R.M. Couch, M.N. Abenes, M.R. Baraoidan, T.W. Mew and R.J. Nelson (1995). Tagging and combining bacterial leaf blight resistance genes using RAPD and RFLP markers. Mol. Breed. 1: 375- 387.

Zhang, G., E.R. Angeles, M.L.P. Abenes, G.S. Khush and N. Huang (1996). RAPD and RFLP mapping of the bacterial blight resistance gene xa-13 in rice. Theor. Appl. Genet. 93: 65-70.
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Pakistan Journal of Science
Geographic Code:9PAKI
Date:Jun 30, 2017
Words:3225
Previous Article:ANTIMICROBIAL POTENTIAL OF CATHARANTHUS ROSEUS EXTRACTS AGAINST PATHOGENIC BACTERIAL AND FUNGAL STRAINS.
Next Article:EFFECT OF SEEDING RATE AND SEED SOAKING DURATION ON PRODUCTIVITY OF RELAY - INTERCROPPED WHEAT IN COTTON.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters