Printer Friendly

Rickettsia rickettsii in Amblyomma patinoi Ticks, Colombia.

To the Editor: Rickettsia rickettsii is the etiologic agent of Rocky Mountain spotted fever (RMSF), a highly lethal tick-borne rickettsioses restricted to the Western Hemisphere (1,2). In Colombia, R. rickettsii was first reported during the 1930s, when 62 (95%) of 65 affected persons died of RMSF in Tobia town (Cundinamarca Department) (3), from where highly virulent strains of R. rickettsii were isolated through the inoculation of patient blood or of Amblyomma cajennense sensu lato (s.l.) extracts into guinea pigs (4). Thereafter, RMSF remained unnoticed in Colombia until the 21st century, when new outbreaks with high case-fatality rates were reported in different regions, including Villeta, a nearby locality of Tobia (1).

Recent studies have shown that A. cajennense s.l., widely distributed from the southern United States to Argentina, is actually a complex of 6 different species: A. cajennense sensu stricto (Amazonian region), A. mixtum (from Texas, USA, to western Ecuador), A. sculptum (northern Argentina, Bolivia, Paraguay, Brazil), A. interandinum (inter-Andean valley of Peru), A. tonelliae (dry areas of northern Argentina, Bolivia, and Paraguay), and A. patinoi (eastern cordillera of Colombia) (5). With this new classification, A. patinoi, originally described from Villeta, is the only species of this complex known to occur in the RMSF-endemic area of Cundinamarca, Colombia (5).

In August 2013, we collected 15 A. patinoi adult ticks from cattle in Naranjal village (5[degrees]3'31.52"N, 74[degrees]26'50.24"W), Villeta town, an area of Cundinamarca, Colombia, to which RMSF is endemic. Ticks were taken alive to the laboratory, where they were frozen at -80[degrees]C for further analysis. The 15 ticks were defrosted, surface sterilized with iodine alcohol, and processed individually by the shell vial technique for isolation of rickettsiae in Vero cells, as described (6). Infected cells were always incubated at 28[degrees]C. Rickettsiae were observed by Gimenez staining within cells (online Technical Appendix Figure 1, http:// from only 1 (inoculated from a female tick) of the 15 inoculated shell vials. This isolate was subjected to at least 7 Vero cell passages, each achieving >90% infected cells.

DNA was extracted from an aliquot of first passage-infected cells and tested by a battery of PCR protocols targeting fragments of the rickettsial genes gltA, ompA, and ompB and the intergenic regions RR0155-rpmB, RR1240-[tlc5.sup.b], and cspA-ksgA (Table). We sequenced 1,106 bp, 512 bp, and 799 bp of the gltA, ompA, and ompB genes, respectively. By BLAST analyses ( blast), these sequences were 100% identical to corresponding sequences of R. rickettsii from Colombia and Brazil (GenBank accession nos. CP003306, CP003305). Generated sequences for 2 intergenic regions, RR0155-rpmB (228 bp) and RR1240-[tlc5.sup.b] (306 bp), were 100% identical to corresponding sequences of the same 2 R. rickettsii isolates from Colombia and Brazil. A 337-bp sequence of the cspA-ksgA intergenic region was 100% (337/337 nt) identical to R. rickettsii from Brazil (CP003305) and 99.7% (336/337) to R. rickettsii from Colombia (CP003306). Partial sequences from R. rickettsii generated in this study were deposited into GenBank and assigned nucleotide accession nos. KJ735644-KJ735649.

Whole-body remnants of the 15 ticks used to inoculate shell vials were also subjected to DNA extraction and processed by PCR for the rickettsial gltA gene (Table); only 1 tick (the one that provided the rickettsial isolate) contained rickettsial DNA, indicating a 6.6% (1/15) infection rate. We confirmed the taxonomic identification of this tick as A. patinoi by generating mitochondrial 16S rRNA partial sequences from it and from an A. patinoi paratype that is deposited in the tick collection of the University of Sao Paulo (Brazil) (accession no. CNC-1585) (5). Both sequences were 100% identical to each other (deposited into GenBank under accession nos. KP036466-KP036467).

A 3 mL-aliquot of the second infected cell passage was inoculated intraperitoneally into an adult male guinea pig, in which high fever (rectal temperature >40.0[degrees]C) developed during days 5-8 days post inoculation. A total of 3 guinea pig passages were performed, always followed by high fever. A second passage animal survived; scrotal necrosis developed (online Technical Appendix Figure 2), and this animal sero-converted to R. rickettsii with 32,768 endpoint IgG titer through the immunofluorescence assay, as described (2).

A highly pathogenic strain of R. ricketsii was isolated from an A. patinoi specimen collected at Villeta, where recent human cases of RMSF have been reported (1). More than 70 years ago, the only previous R. rickettsii tick isolates in Colombia were obtained from A. cajennense s.l. in Tobia, only 20 km from Villeta (4). At that time, ticks of the A. cajennense complex were considered natural vectors of R. rickettsii in Tobia (4). Because the A. cajennense s.l. complex was recently found to be represented in the eastern cordillera of Colombia (which includes Tobia and Villeta) by the species A. patinoi (5), the tick isolates obtained >70 years ago also are highly likely to have been obtained from A. patinoi. Therefore, A. patinoi ticks should be considered the main vector of R. rickettsii to humans in this region of Colombia.


COLCIENCIAS provided financial support (code 120351929098). Regulatory permits for this work were as follows: Scientific research in biodiversity (Corporacion Automona Regional no. 005 of June 19/2012), and Ministerio de Ambiente y Desarrollo sostenible from Colombia (no. 85 of 2013).


(1.) Hidalgo M, Orejuela L, Fuya P, Carrillo P, Hernandez J, Parra E, et al. Rocky Mountain spotted fever, Colombia. Emerg Infect Dis. 2007; 13:1058-60.

(2.) Krawczak FS, Nieri-Bastos FA, Nunes FP, Soares JF, Moraes-Filho J, Labruna MB. Rickettsial infection in Amblyomma cajennense ticks and capybaras (Hydrochoerus hydrochaeris) in a Brazilian spotted fever-endemic area. Parasit Vectors. 2014; 7:7.

(3.) Patino L, Afanador A, Paul JH. A spotted fever in Tobia, Colombia. Am J Trop Med. 1937; 17:639-53.

(4.) Patino-Camargo L. Nuevas observaciones sobre un tercer foco de fiebre petequial (maculosa) en el hemisferio Americano. Bol De la Ofic Sanit Panamericana. 1941; 20:1112-24.

(5.) Nava S, Beati L, Labruna MB, Caceres AG, Mangold AJ, Guglielmone AA. Reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and resurrection of Amblyomma mixtum Koch, 1844 and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis. 2014; 5:252-76.

(6.) Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004; 42:90-8.

(7.) Eremeeva M, Yu X, Raoult D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994; 32:803-10.

(8.) Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000; 50:1449-55.

(9.) Karpathy SE, Dasch GA, Eremeeva ME. Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions. J Clin Microbiol. 2007; 45:2545-53.

(10.) Fournier PE, Zhu Y, Ogata H, Raoult D. Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains. J Clin Microbiol. 2004; 42:5757-66. http://dx.doi. org/10.1128/JCM.42.12.5757-5766.2004

Alvaro A. Faccini-Martinez, Francisco B. Costa, Tatiana E. Hayama-Ueno, Alejandro Ramirez-Hernandez, Jesus A. Cortes-Vecino, Marcelo B. Labruna, Marylin Hidalgo

Author affiliations: Pontificia Universidad Javeriana, Bogota, Colombia (A.A. Faccini-Martinez, M. Hidalgo); Universidade de Sao Paulo, Sao Paulo, Brazil (F.B. Costa, T.E. Hayama-Ueno, M.B. Labruna); Universidad Nacional de Colombia, Bogota (A. Ramirez-Hernandez, J.A. Cortes-Vecino)

Address for correspondence: Marylin Hidalgo, Microbiology Department, Building 50, Pontificia Universidad Javeriana, Carrera 7a No 43-82, Bogota, Colombia; email:
Table. Primer pairs used for amplification of rickettsial genes or
intergenic regions, Colombia, August 2013

Target, primer         Primer sequences,         Fragment   Reference
pairs, primers        5' [right arrow] 3'        size, bp

    CS-78           GCAAGTATCGGTGAGGATGTAAT        401         (6)
    CS-323       GCTTCCTTAAAATTCAATAAATCAGGAT                  (6)
    CS-239         GCTCTTCTCATCCTATGGCTATTAT       834         (6)
    CS-1069          CAGGGTCTTCGTGCATTTCTT                     (6)
    Rr190.70p        ATGGCGAATATTTCTCCAAAA         530         (7)
    Rr190.602n       AGTGCAGCATTCGCTCCCCCT                     (7)
    120-M59           CCGCAGGGTTGGTAACTGC          862         (8)
    120-807          CCTTTT AGATTACCGCCTAA                     (8)
    Forward        TTTCTAGCAGCGGTTGTTTTATCC        290         (9)
    Reverse        TTAGCCCATGTTGACAGGTTTACT                    (9)
    Forward          CGGGATAACGCCGAGTAATA          357        (10)
    Reverse          ATGCCGCTCTGAATTTGTTT                     (10)
    Forward          CATCACTGCTTCGCTTATTTT         405         (9)
    Reverse        ATTTCTTTTCTTCCTCTTCATCAA                    (9)
COPYRIGHT 2015 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:LETTERS
Author:Faccini-Martinez, Alvaro A.; Costa, Francisco B.; Hayama-Ueno, Tatiana E.; Ramirez-Hernandez, Alejan
Publication:Emerging Infectious Diseases
Article Type:Letter to the editor
Geographic Code:3COLO
Date:Mar 1, 2015
Previous Article:Treatment of Mycobacterium abscessus subsp. massiliense tricuspid valve endocarditis.
Next Article:Mycobacterium bovis BCG-associated Osteomyelitis/Osteitis, Taiwan.

Terms of use | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters