Printer Friendly

Retrotransposon Marker Systems as a Tool to Analyze Molecular Diversity of Mediterranean Pistacia Species.

Byline: Emrah Kirdok and Yelda Ozden Ciftci

Abstract

Retrotransposon movements could lead to major genome rearrangements because of their special transposition mechanism and may be used to analyze differences between species as a marker system. In this context inter primer binding site (iPBS), inter-retrotransposon amplified polymorphism (IRAP) and retrotransposon-microsatellite amplified polymorphism (REMAP) marker systems were used to resolve genetic differences in 7 Mediterranean Pistacia species (P. vera L. cv. Siirt, P. khinjuk Stocks, P. mutica Fischer, P. atlantica Desf., P. palaestina Boiss., P. terebinthus L. and P. lentiscus L.). High level of polymorphism ratio observed in all tested marker systems. Except REMAP, iPBS and IRAP marker systems showed strong mantel correlations. Phylogenetic tree with neighbor joining (NJ) method depicted that Mediterranean Pistacia species may be divided into three clades: (i) P. vera - P. khinjuk, (ii) P. mutica - P. atlantica and (iii) P. palaestina - P. terebinthus with P. lentiscus.

Principal component analysis (PCA) plots showed 4 distinct clusters. In conclusion, retrotransposon based marker systems could be useful for analyzing molecular diversity in Pistacia genus due to their highly polymorphic nature and ease of use.

Keywords: Pistacia; Retrotransposon marker system; Characterization; iPBS; IRAP; REMAP

Introduction

Transposons are the main genetic properties of higher eukaryotes as well as plants and consist of two different major groups (DNA and RNA transposons or retrotransposons) according to their transposition mechanism. Upon discovery of DNA transposons by Barbara McClintock (McClintock, 1951), it was found that they are one of the major genome reshaping elements via transcriptional activation and transposition under environmental stress conditions (Grandbastien, 2015). Among other types of transposons, retrotransposons (especially long terminal repeat, LTR retrotransposons) provides a very big contribution to this phenomenon because of their special type of transposition mechanism with their capability to integrate various copies through the genome while preserving the original copy (Schulman, 2013).

Having this retrotransposition ability, retrotransposons can induce massive chromosomal rearrangements thus influence an increase, change and functionality of genome shape which have been documented extensively in different type of plant species (Grandbastien, 2015). Currently these genetic elements drive too much attention for using as a DNA marker system due to their structural characteristics including conserved PBS (primer binding site, initiation site for reverse transcription of retrotransposon mRNA) region and LTRs at both ends. Moreover their abundance in plant genomes, dispersity, demonstration of Mendelian inheritance, detection of big chromosomal rearrangements and ease of use make them suitable for genetic markers (Fig. 1a; Kalendar et al., 2011; Kalendar and Schulman, 2014).

In this context Kalendar et al. (1999; 2010) developed three retrotransposon based marker systems (Fig. 1b, c and d): IRAP (primers designed to amplify between LTR regions), REMAP (primers designed for both LTR and adjacent SSR region) and iPBS (primers designed to amplify between PBS regions).

Pistacia genus belongs to the Anacardiaceae family consists of at least 11 species (Kafkas and Perl-Treves, 2002) that are mostly dioecious and evergreen or deciduous trees which was extensively studied using both morphological and molecular aspects. Two different diversity centers are available for Pistacia: (i) Mediterranean region of South Europe, Northern Africa, Middle East (ii) West and Central Asia (Al-Saghir and Porter, 2012). The most complete characterization study was conducted by Zohary (1952) who divided the genus into 4 main sections with using morphological markers: Lenticella (P. mexicana and P. texana), Eu-Lentiscus (P. lentiscus, P. saportae and P. weinmannifolia), Butmela (P. atlantica), Eu-Terebinthus (P. chinensis, P. khinjuk, P. palaestina, P. terebinthus and P. vera). Lately with 19 different morphological markers, Al-Saghir and Porter (2012) revised the status of the genus and clustered the species in 2 main sections.

In addition various molecular characterization studies were also carried on different species, cultivars and accessions of Pistacia including RAPD (Kafkas and Perl-Treves, 2001; Kafkas and Perl- Treves, 2002; Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004), AFLP (Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004; Kafkas, 2006; Karimi et al., 2009), ISSR (Kafkas, 2006), SSR, SRAP (Talebi et al., 2012), IRAP (Ghaemmaghami et al., 2013) and restriction analysis of chloroplast fragments (Parfitt and Badenes, 1997) in order to resolve the phylogenetic relationships. These studies were mostly dealt with classification of Pistacia species, which were originated from Middle East region and tried to classify either 4 (as Lenticella, Eu-Lentiscus, Butmela and Eu-Terebinthus) or 2 (as Terebinthus and Lentiscus) groups.

Moreover numerous plastid (trnL-F, ndhF, psA-ycf3, rps16, rpl16, atpB-rbcL, psbA-trnH) and nuclear (ITS, ETS) markers were also sequenced for molecular characterization (Yi et al., 2008; Xie et al., 2014) and it was found that these two studies support neither 2 nor 4 sections but showed a reticulate evolution in Pistacia genus. Those studies showed strong similarity between P. vera - P. khinjuk, P. atlantica - P. mutica and P. terebinthus - P. palaestina in Pistacia species for both morphological and molecular aspects. However, previous classifications did not seem to have strong supports (Xie et al., 2014). Besides presence of a high ratio of interspecific hybridizations in Pistacia genus makes very hard to resolve phylogenetic relationships (Al- Saghir and Porter, 2012).

As retrotransposon marker systems were successfully used for molecular characterization of Diospyros kaki (Guo et al., 2006), wheat (Carvalho et al., 2010), Citrus (Biswas et al., 2010), grapevine species and cultivars (D'Onofrio et al., 2010; Guo et al., 2014), flax (Smykal et al., 2011), alfalfa (Abdollahi Mandoulakani et al., 2011), cocoyam (Doungous et al., 2015), taro (Doungous et al., 2015), lilium (Lee et al., 2015) and howtron (Rahmani et al., 2015). The aim of the study was to use three iPBS, IRAP and REMAP retrotransposon based marker systems for the first time to analyze the genetic diversity, to compare three different marker systems in order to reveal their diversity indices, to construct phylogenetic trees in order to resolve the relationships in Mediterranean Pistacia species.

Material and Methods

Plant Materials

Seeds which were obtained under controlled pollination from 6 different Pistacia species (P vera cv. Siirt, P. mutica, P. khinjuk, P. terebinthus, P. palaestina, P. lentiscus L.) kindly obtained from Pistachio Research Institute (Gaziantep) by Msc Veysel Suzerer. P. atlantica seeds were kindly obtained from Algeria by Dr. Limane Abdulkerim (Mouloud Mammeri University of Tizi Ouzou) and P. lentiscus in vitro samples which were originated from Cesme, Izmir were provided by Ibrahim Koc.

Sterilization, in Vitro Germination and DNA Isolation and PCR Reactions

Pistacia seeds were sterilized as described in Ozden-Tokatli et al. (2005). For in vitro germination, sterilized seeds were cultured on MS (Murashige and Skoog, 1962) medium devoid of growth regulators for 2-4 weeks. DNA isolation of 5 germinated plantlets from each species based on CTAB (cetyltrimethylammonium bromide) protocol was carried out according to Lodhi et al. (1994). Isolated genomic DNAs were visualized on 1.5% agarose gel electrophoresis along with 1 kb + 100 bp DNA Ladders (Invitrogen) and quantified with Shimadzu Biotech, Biospec Nano spectrometer.

PCR protocol for all tested marker systems was based on Kalendar et al. (2010): 95C for 3 min pre- denaturation; 30 cycle of; 15 sec 95C denaturation, 1 min for annealing temperature (30' for IRAP and REMAP PCR, annealing temperatures were presented in Table 1), 1 min for 68C extension (for IRAP and REMAP PCR, extension time is 3 min) and 72C 10 min for final extension step. PCR final concentrations were: 1 X PCR buffer, 2.5 mM MgCl2, 0.4 mM dNTP, 1 uM primer (for REMAP PCR, 0.5 uM for both primers indicated in Table 2), 50 ng gDNA and 2 U Taq polymerase (iTaq, IntronBio CAT. 25022) in 25 uL final volume. PCR products were visualized on 1.5% agarose gel electrophoresis that run at 80 volt for 6 h and gel images were recorded with ChemiDoc XRS+ (Biorad) imaging system.

Statistical Approach

Gel images were analyzed and each band treated as a di allelic locus, 1 for presence and 0 for absence. Then discrimination capacity of the marker systems calculated as described in Table 3 (Roldan-Ruiz et al., 2000; Belaj et al., 2003; Campbell et al., 2010). Similarity matrices between species calculated by Jaccard coefficient (Jaccard, 1908) with MVSP (Multivariate Statistics Package, Kovacs computing) software. Neigbour-joining (NJ) phylogenetic trees were constructed using Darwin (Dissimilarity Analysis and Representation for Windows), with Jaccard distance, and 900 bootstrap replicates. Mantel permutation test was conducted using R statistical package (64 bit version) with vegan library installed (implementation based on Legendre and Legendre, 1998). Principal component analysis (PCA) was conducted for individual and all marker systems using Mat Lab (64 bit, version 2013a).

Table 1: List of primer sequences used in this study

Primer Name Sequence###Annealing

###temperature

###(C)

iPBS Marker System (Kalendar et al. 2010)

iPBS - 1###GCTCTGATACCA###53

iPBS - 2###CTCATGATGCCA###53

iPBS - 4###CTCACGATGCCA###54.3

iPBS - 5###GCGGAGTCGCCA###62.9

iPBS - 6###AGGTGGGCGCCA###62.6

iPBS - 7###GCTCGGATACCA###55

iPBS - 8###CCCAGCAAACCA###54.3

iPBS - 9###TCGCATCAACCA###53

iPBS - 10###TAGATGGCACCA###51.4

IRAP Marker System (Smykal et al. 2011)

LTR - 2###CTTGCTGGAAAGTGTGTGAGAGG###55

LTR - 3###TGTTAATCGCGCGCTCGGGTGGGAGCA###55

LTR - 4###AGCCTGAAAGTGTTGGGTTGTCG###55

LTR - 5###CTGGCATTTCCATTGTCGTCGATGC###55

LTR - 6###GCATCAGCCTGGACCAGTCCTCGTCC###55

LTR - 7###CACTTCAAATTTTGGCAGCAGCGGATC###55

LTR - 10###TGAGTTGCAAGGTCCAGGCATCA###55

ISSR Primers

ISSR-10###GAAGAAGAAGAAGAAGG###55

ISSR-13###AGAGAGAGAGAGAGAGT###55

Table 2: Combinations for REMAP marker system used in this study

Primer Set###Combination###Primer Set###Combination

###LTR###ISSR###LTR###ISSR

REMAP 1###2###10###REMAP 8###2###13

REMAP 2###3###10###REMAP 9###3###13

REMAP 3###4###10###REMAP 10###4###13

REMAP 4###5###10###REMAP 11###5###13

REMAP 5###6###10###REMAP 12###6###13

REMAP 6###7###10###REMAP 13###7###13

REMAP 7###10###10###REMAP 14###10###13

Results

Diversity Indices and Mantel Correlation of Marker Systems

Among primer sets, iPBS marker system supplied the most locus information (319 total loci, 35.44 loci per assay and 35.44 polymorphic loci per assay) and discrimination capacity in comparison with the other markers (as it resulted in high total number of alleles, efficiency index and resolving power). However, polymorphism proportions (0.94, 0.93 and 0.93), expected heterozygosity (0.35, 0.32 and 0.3) and PIC values (0.35, 0.35 and 0.32) were nearly similar for all tested markers (Table 4). Mantel correlations with 1000 permutations showed that the correlation between iPBS and IRAP markers were quite strong (0.79) (Table 5). Moreover, mantel correlation values were quite high in between iPBS (0.96), IRAP (0.91) but very low in REMAP (0.47) in comparison with combined marker data.

Analysis of Genetic Similarities and Phylogenetic Relationships in Pistacia Species

Using all the marker information; the closest species pairs were found to be P. vera - P. khinjuk (0.587), P. mutica - P. atlantica (0.540) and P. khinjuk - P. terebinthus (0.564) (Table 6). Construction of a phylogenetic tree by using combined marker dataset resolved 3 clades: (Clade-I) P. vera - P. khinjuk cluster has the most bootstrap support (98%) followed by (Clade-II) P. mutica - P. atlantica (59%) and (Clade-III) P. lentiscus - P. palaestina - P. terebinthus (23%) cluster (Fig. 2).

Table 3: Description of diversity indices for analyzing marker systems

###Diversity indices

Total number of primers###U

Number of loci###L

Number of polymorphic loci###np

Number of monomorphic loci###nnp

Proportion of polymorphic loci###Pp:

Number of loci per primer###nu=L/U

Expected heterozygosity###He =1-pi2

Effective number of alleles per locus (ne):###ne =1/ pi2

Total number of effective alleles (Ne):###Ne= ne

Assay efficiency index (Ai):###Ai= Ne/U

Effective multiplex ratio (E):###E=nu x Pp

Marker index (M):###M=He x L

Resolving power (Rp):###Rp= (1-(2 x |0.5 - pi|))

Polymorphism information content###PIC= ( 2fi(1-fi))/L

pi is the frequency for ith allele

Table 4: Diversity indices of 3 different retrotransposonal marker systems

Diversity Indices###iPBS###IRAP###REMAP

Number of Assays###9###7###8

Number of Polymorphic Bands###319###145###116

Number of Monomorphic Bands###21###9###9

Total Number of Loci###340###154###125

Proportion of Polymorphic Bands###0.94###0.94###0.93

Proportion of Polymorphic Bands per Assay###35.44###20.71###14.5

Proportion of Loci per Assay###37.78###22###15.62

Expected Heterozygosity###0.35###0.32###0.3

Effective Number of Alleles per Locus###1.61###1.53###1.5

Total Number of Effective Alleles###548.29###235.94###188.01

Efficiency Index###60.92###33.71###23.5

Effective Multiplex Ratio###35.51###20.68###14.53

Resolving Power###180.57###79.89###59.37

PIC###0.35###0.35###0.32

Principal Component Analysis of Pistacia Species

After calculation of eigenvalues and eigenvectors; the first three principal coordinates covered 50.26% of the total variability for combined marker data (Table 7) and species were clustered in 4 different groups in PCA plot: P. vera - P. khinjuk, P. terebinthus - P. palaestina and P. mutica - P. atlantica formed three clusters, while P. lentiscus remained as individual (Fig. 3).

Discussion

In this research, 3 different retrotransposon based marker systems were used for the analysis of genetic diversity and phylogenetic relationships in 7 Mediterranean Pistacia species. There was just one report dealing with using retrotransposon based marker systems for characterization of Pistacia genus from Iranian Pistacia species (P. vera, P. khinjuk, P. atlantica) at the time manuscript was written and resolved 89.6% polymorphism in IRAP marker system (Ghaemmaghami et al., 2013). Retrotransposon based marker systems showed a high proportion of polymorphism ratio similar with RAPD (Golan-Goldhirsh et al., 2004; Kafkas, 2006) and AFLP (Golan-Goldhirsh et al., 2004) while revealed out relatively greater heterozygosity and Rp than AFLP (Shanjani et al., 2009; Kafkas, 2006; Karimi et al., 2009) marker systems. However, PIC values were lower than the ones reported in the literature (Kafkas, 2006; Karimi et al., 2009).

Table 5: Jaccard similarity matrices both (iPBS + IRAP + REMAP) marker systems

Species###P. vera###P. mutica###P. khinjuk###P. terebinthus###P. atlantica###P. palaestina###P. lentiscus

P. vera###0.855

P. mutica###0.512###0.797

P. khinjuk###0.587###0.538###0.860

P. terebinthus###0.439###0.491###0.564###0.767

P. atlantica###0.449###0.540###0.503###0.490###0.846

P. palaestina###0.452###0.476###0.532###0.532###0.497###0.878

P. lentiscus###0.368###0.370###0.414###0.414###0.415###0.414###0.841

Table 6: Pairwise Mantel correlations of the 3 marker systems

###iPBS###IRAP###REMAP###ALL

iPBS###1

IRAP###0.79###1

REMAP###0.39###0.51###1

ALL###0.96###0.90###0.47###1

Table 7: Relative explained variance and cumulative variability of all primer sets

Principal Coordinates###Relative###Explained Cumulative

###Variance###Variability (%)

All Primer Sets###1###0.1883###18.83

###2###0.1653###35.36

###3###0.1490###50,26

Our mantel correlation test results between marker systems were not high in comparison with the literature (Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004), however this could be due to the different mobile retrotransposon regions targeted in each marker system.

Recently, Xie et al. (2014) pointed out that the evolution in Pistacia genus was not likely to be previous classification but to be a reticulated pattern based on geographical locations as (i) North and Central America, (ii) Mediterranean and adjacent areas and (iii) Asia. Here, reconstruction of phylogeny with combined marker data showed that Pistacia genus is likely to be a reticulated pattern. PCA plot was able to clearly separate the species except P. lentiscus, which was remained individual. Our results showed a good agreement between other marker systems which were used previously to analyze molecular relationships between Pistacia species. We found that P. vera and P. khinjuk were closely related with each other as consistent with the previous studies by using RAPD (Kafkas and Perl-Treves, 2002; Golan-Goldhirsh et al., 2004) and AFLP (Golan-Goldhirsh et al., 2004) marker systems also showing a high bootstrapping clustering ratio (Kafkas and Perl-Treves, 2002).

Restriction analyses of chloroplast genome (Parfitt and Badenes, 1997) together with NIA-i3, ITS and plastid genes (Yi et al., 2008) demonstrated the closer relationship between these two species. It is known that P. khinjuk not only shares the dispersion locations (Afghanistan, Iran, Iraq, Syria, Palestine and Egypt) but also it shows similar morphological variation patterns with P. vera (Zohary, 1952). Previously, P. atlantica and P. mutica species pair also clustered together in numerous marker studies (Kafkas, 2006; Karimi et al., 2009). In our phylogenetic reconstruction and PCA plot the closer relationship between P. atlantica and P. mutica could be easily observed. However, there was an ongoing debate about classification of P atlantica in a separate section Butmela which was classified by Zohary (1952), because of rachis wing character. Parfitt and Badenes (1997) suggested that the Butmela section could be eliminated and merged with section Terebinthus.

On the contrary, Golan-Goldhirsh et al. (2004) found that P. atlantica clustered in a separate section and suggested that Butmela section could not be eliminated. Third clade was formed as P. terebinthus - P. palaestina species pair and P. lentiscus. Previous studies showed that P. terebinthus and P. palaestina were clustered together with high similarity values like RAPD (Kafkas and Perl-Treves, 2002; Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004), AFLP (Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004; Kafkas, 2006). Sequencing of ITS4, NIA-3 and plastid marker data showed that these two species could not be separated at sequence level (Yi et al., 2008). While P. lentiscus clustered in Clade 3 with a low bootstrapping support, it remained individual in PCA plot.

Previous molecular marker studies showed that clustering patterns of P. lentiscus varied as RAPD and AFLP (Kafkas and Perl- Treves, 2002; Kafkas, 2006) analyses suggested P. lentiscus clustered with P. palaestina and P. terebinthus while some other studies concluded P. lentiscus is separated from other species and formed an individual cluster (Katsiotis et al., 2003; Golan-Goldhirsh et al., 2004). In a morphological view, P. lentiscus was the most divergent species in our study in comparison with other specimens that we used (Katsiotis et al., 2003).

Conclusion

Results showed a high similarity between P. vera - P. khinjuk, P. atlantica - P. mutica and P. terebinthus - P palaestina species pairs. Among other tested markers, iPBS was supplied the most polymorphism ratio and correlated with IRAP. Phylogenic reconstructions depicted that Mediterranean Pistacia species may be divided in 3 different clades, which was supported with previous molecular marker studies. Thus retrotransposon based molecular markers may be used for molecular characterization and molecular breeding studies for other Pistacia species.

Acknowledgements

Authors are thankful to Dr. Hulya Akdemir Koc for useful talks in PCR optimizations, Dr. Ergun Kaya for his help, MSc Jafar Khatibipour for useful comments in PCA analysis, MSc Ebru Turhanlar for gel image analysis, MSc Veysel Suzerer, MSc Ibrahim Koc and Dr. Limane Abdulkerim for Pistacia seeds or microshoots. This project is supported by GTU, 2015-A-13 BAP Research Project.

References

Abdollahi Mandoulakani, B., Y. Piri, R. Darvishzadeh, I. Bernoosi and M. Jafari, 2011. Retroelement Insertional Polymorphism and Genetic Diversity in Medicago sativa Populations Revealed by IRAP and REMAP Markers. Plant Mol. Biol. Report, 30: 286-296

Al-Saghir, M.G. and D.M. Porter, 2012. Taxonomic revision of the genus Pistacia L. (Anacardiaceae). Amer. J. Plant. Sci., 03: 12-32

Belaj, A., Z. Satovic, G. Cipriani, L. Baldoni, R. Testolin, L. Rallo and I. Trujillo, 2003. Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic relationships in olive. Theor. Appl. Genet., 107: 736-744

Biswas, M.K., Q. Xu and X.X. Deng, 2010. Utility of RAPD, ISSR, IRAP and REMAP markers for the genetic analysis of Citrus spp. Sci. Hortic., 124: 254-261

Campbell, B.C., S. LeMare, G. Piperidis and I.D. Godwin, 2010. IRAP, a retrotransposon-based marker system for the detection of somaclonal variation in barley. Mol. Breed., 27: 193-206

Carvalho, A., H. Guedes-Pinto, P. Martins-Lopes and J. Lima-Brito, 2010. Genetic variability of Old Portuguese bread wheat cultivars assayed by IRAP and REMAP markers. Ann. Appl. Biol., 156: 337-345

D'Onofrio, C., G. De Lorenzis, T. Giordani, L. Natali, A. Cavallini and G. Scalabrelli, 2010. Retrotransposon-based molecular markers for grapevine species and cultivars identification. Tree Genet. Genom., 6: 451-466

Doungous, O., R. Kalendar, A. Adiobo and A.H. Schulman, 2015. Retrotransposon molecular markers resolve cocoyam (Xanthosoma sagittifolium) and taro (Colocasia esculenta) by type and variety. Euphytica, 206: 541-554

Ghaemmaghami, L., F. Attar and M. Rahiminejad, 2013. Distinctness and Inter Relationships of Pistacia L. Species in Iran as evidenced by retroelement insertional polymorphisms (IRAP Method). Iran. J. Bot., 19: 78-85

Golan-Goldhirsh, A., O. Barazani, Z.S. Wang, D.K. Khadka, J.A. Saunders, V. Kostiukovsky and L.J. Rowland, 2004. Genetic relationships among Mediterranean Pistacia species evaluated by RAPD and AFLP markers. Plant. Syst. Evol., 246: 9-18

Grandbastien, M.A., 2015. LTR retrotransposons, handy hitchhikers of plant regulation and stress response. Biochim. Biophys. Acta, 1849: 403-416

Guo, D., H. Zhang and Z. Luo, 2006. Genetic relationships of Diospyros kaki Thunb. and related species revealed by IRAP and REMAP analysis. Plant. Sci., 170: 528-533

Guo, D.L., M.X. Guo, X.G. Hou and G.H. Zhang, 2014. Molecular diversity analysis of grape varieties based on iPBS markers. Biochem. Syst. Ecol., 52: 27-32

Jaccard, P., 1908. Nouvelles recherches sur la distribution florale. Bull. Soc. Vaudoise. Sci. Nat., 44: 223-270

Kafkas, S., 2006. Phylogenetic analysis of the genus Pistacia by AFLP markers. Plant. Syst. Evol., 262: 113-124

Kafkas, S. and R. Perl-Treves, 2001. Morphological and molecular phylogeny of Pistacia species in Turkey. Theor. Appl. Genet., 102: 908-915

Kafkas, S. and R. Perl-Treves, 2002. Interspecific relationships in Pistacia based on RAPD fingerprinting. HortScience, 37: 168-171

Kalendar, R., K. Antonius, P. Smykal and A.H. Schulman, 2010. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation. Theor. Appl. Genet., 121: 1419-1430

Kalendar, R., A.J. Flavell, T.H. Ellis, T. Sjakste, C. Moisy and A.H. Schulman, 2011. Analysis of plant diversity with retrotransposon-based molecular markers. Heredity (Edinb), 106: 520-530

Kalendar, R., T. Grob, M. Regina, A. Suoniemi and A.H. Schulman, 1999. IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet., 98: 704-711

Kalendar, R. and A. Schulman 2014. Transposon-Based Tagging: IRAP, REMAP, and iPBS. Molecular Plant Taxonomy. P. Besse, Humana Press, 1115: 233-255

Karimi, H.R., S. Kafkas, Z. Zamani, A. Ebadi and M.R. Fatahi Moghadam, 2009. Genetic relationships among Pistacia species using AFLP markers. Plant. Syst. Evol., 279: 21-28

Katsiotis, A., M. Hagidimitriou, A. Drossou, C. Pontikis and M. Loukas, 2003. Genetic relationships among species and cultivars of Pistacia using RAPDs and AFLPs. Euphytica, 132: 279-286

Lee, S.I., J.H. Kim, K.C. Park and N.S. Kim, 2015. LTR-retrotransposons and inter-retrotransposon amplified polymorphism (IRAP) analysis in Lilium species. Genetica, 143: 343-352

Legendre, P. and L. Legendre, 1998. Numerical Ecology Lodhi, M.A., G.N. Ye, N.F. Weeden and B.I. Reisch, 1994. A Simple and Efficient Method for DNA Extraction from Grapevine Cultivars and Vitis Species. Plant. Mol. Biol. Rep., 12: 6-13

McClintock, B., 1951. Chromosome organization and genic expression. Cold Spring Harb. Symp. Quant. Biol., 16: 13-47

Murashige, T. and F. Skoog, 1962. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant., 15: 473-497

Ozden-Tokatli, Y., E.A. Ozudogru and A. Akcin, 2005. In vitro response of pistachio nodal explants to silver nitrate. Sci. Hortic., 106: 415-426

Parfitt, D.E. and M.L. Badenes, 1997. Phylogeny of the genus Pistacia as detrermined from analysis of the chloroplast genome. Proc. Natl. Acad. Sci. USA, 94: 7987-7992

Rahmani, M. S., N. Shabanian, A. Khadivi-Khub, K. E. Woeste, H. Badakhshan and L. Alikhani, 2015. Population structure and genotypic variation of Crataegus pontica inferred by molecular markers. Gene, 572: 123-129

Roldan-Ruiz, I., E. Calsyn, T.J. Gilliland, R. Coll, M.J.T. van Eijk and M. De Loose, 2000. Estimating genetic conformity between related ryegrass (Lolium) varieties. 2 AFLP characterization. Mol. Breed., 6: 593-602

Schulman, A.H., 2013. Retrotransposon replication in plants. Curr. Opin. Virol., 3: 604-614

Shanjani, P.S., M. Mardi, L. Pazouki, M. Hagidimitriou, D. Avanzato, S.M. Pirseyedi, M.R. Ghaffari and S.M. Khayam Nekoui, 2009. Analysis of the molecular variation between and within cultivated and wild Pistacia species using AFLPs. Tree. Genet. Genom., 5: 447-458

Smykal, P., N. Bacova-Kerteszova, R. Kalendar, J. Corander, A.H. Schulman and M. Pavelek, 2011. Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers. Theor. Appl. Genet., 122: 1385-1397

Talebi, M., M. Kazemi and B.E. Sayed-Tabatabaei, 2012. Molecular diversity and phylogenetic relationships of Pistacia vera, Pistacia atlantica subsp. mutica and Pistacia khinjuk using SRAP markers. Biochem. Syst. Ecol., 44: 179-185

Xie, L., Z.Y. Yang, J. Wen, D.Z. Li and T.S. Yi, 2014. Biogeographic history of Pistacia (Anacardiaceae), emphasizing the evolution of the Madrean-Tethyan and the eastern Asian-Tethyan disjunctions. Mol. Phylogenet. Evol., 77: 136-146

Yi, T., J. Wen, A. Golan-Goldhirsh and D.E. Parfitt, 2008. Phylogenetics and reticulate evolution in Pistacia (Anacardiaceae). Amer. J. Bot., 95: 241-251

Zohary, M., 1952. A Monographical Study of the Genus Pistacia. Palest. J. Bot., 5: 187-228
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Kirdok, Emrah; Ciftci, Yelda Ozden
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Jun 30, 2016
Words:4520
Previous Article:Microsporogenesis, Megasporogensis and Male and Female Gametophyte Development in Feijoa sellowiana (Myrtaceae).
Next Article:Regional Isoprenoid Emission from Eucalyptus grandis Forests in Northeastern Argentina.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters