Printer Friendly

Resveratrol improves the anticancer effects of doxorubicin in vitro and in vivo models: a mechanistic insight.

ABSTRACT

Background: Resveratrol (RSVL), a well known dietary compound and in combination with doxorubicin (DOX) has gained a global importance for cancer prevention. However, mechanism of action by this combination is not well understood till date.

Hypothesis: The synergistic combination of RSVL and DOX might be more effective in anti-cancer activity by modulating the diverse cancer signaling pathways as compared to their alone treatments.

Methods: The cytotoxicity of alone and combination doses of RSVL and DOX were analyzed by colorimetric MTT(3-(4,5-Dimethylthiazol-2-yl)-2,5-Dipheny!tetrazolium Bromide) cell proliferation assay. The migration and colony forming abilities were evaluated by wound healing and donogenic assays. Apoptosis was detected by Annexin V/PI and DAPI stainings. The cell cycle and intracellular reactive oxygen species (ROS) generation were measured by flow cytometry. The differential expression of genes and proteins were measured by qRT-PCR and western blotting analyses. Finally, in-vivo studies were performed in Ehrlich ascitic carcinoma (EAC) mouse model.

Results: The synergistic combination of DOX (IC20) and RSVL (IC30) was selected based on the combination index values in MCF-7 and MDA-MB-231 cell lines. This combination showed potent growth inhibition with ~2.5 fold of dose advantage and also significantly decreased the wound healing and clonogenic potential of breast cancer cells. The combination treatment was also found to inhibit the inflammatory response (NF-kB, COX-2), autophagic flux (LC3, Beclin-1), redox regulation (Nrf2) and induces apoptosis (BAX: BCL-2 ratio and Caspase-9) in breast cancer cells. Further, combined dosages of DOX (5 mg/kg b.wt) and RSVL (10 mg/kg b.wt) inhibited tumor volume with increased life span (139%, p value <0.05) in Ehrlich ascitic carcinoma (EAC) cells bearing mice.

Conclusion: In brief, our results suggested that resveratrol chemosensitizes doxorubicin in combination, through inhibiting breast cancer cells proliferation and invasion, and inducing apoptosis via suppression of chronic inflammation and autophagy.

Keywords:

Breast cancer

Resveratrol

Cell signaling

Doxorubicin

Cytotoxicity

Ehrlich ascitic carcinoma

Introduction

At present, cancer is the major global health concern with persisted high incidence and mortality rate (Ferlay et al. 2015), despite the availability of wide therapeutic options particularly in chemotherapeutic regimen. Majority of chemotherapeutic drugs have been synthesized based on recognized target genes or proteins associated with cancer cells survival or proliferation pathways (Galustian and Dalgleish 2010). However, most of these drugs are having severe side effects due to cytotoxicity on normal nontarget cells. In addition, cancer cells also have capability to confer drug resistance due to increased expression of p-glycoprotein leading to increased efflux of these drugs (Lehne 2000). In the tumor initiation and progression, multiple signaling pathways are diverted to the oncogenic events by altering normal cellular homeostasis (Bianco et al. 2006). Continually studies on cancer depicted a complex network of signaling pathways assisting tumor progression by generating the favorable microenvironment for nourishment of cancer cells (Li et al. 2013; Wang et al. 2012). In the current scenario of chemotherapy, multiple combinations of anticancer drugs are being used for cancer patients, these combinations also evidenced to enhance survival rate. However, success of cancer chemotherapy is still limited due to persistence of several others reasons like drug resistance, target of non-cancer cells, metabolic stresses, which lead to severe side effects (Iwamoto 2013). Therefore, a novel combination of chemotherapeutic drugs is primarily required to solve all these issues (Kummar et al. 2010; Wang et al. 2010). From the last several years, combinations of chemotherapeutic drugs with phytochemicals have become a major area of research for all the oncologists. It is because; phytochemicals have reported to enhance chemo-sensitivity or therapeutic efficacy and limits high toxicity of chemotherapeutic drugs (Bolhassani 2015).

Doxorubicin (DOX) is widely used anticancer drug against different human malignancies; it has severe side effects in the form of typhlitis, cardiotoxicity, nephrotoxicity, hepatotoxicity and other toxicity (Pestalozzi et al. 1993; Rashid et al. 2013; Singal and Iliskovic 1998). Doxorubicin causes a high cellular level of ROS to kill cancer cells; however, necrotic cell death is most predominant in killing of cancer cells, which generated inflammatory microenvironment, which also become a reason for undesired cellular toxicity (Thakur et al. 2008). Hence, doxorubicin alone is not preferable drug. A range of phytochemicals available showed a chemo-preventive effect and sensitize cancer cells toward doxorubicin (Vinod et al. 2013). Among diverse group of phytochemicals, resveratrol (RSVL) has proven their strong chemo-preventive effects in various types of human tumors (Delmas et al. 2014; Kim et al. 2014; Siddiqui et al. 2015), and shown to prevent initiation, promotion and progression of cancer (George et al. 2011; Roy et al. 2009). RSLV is a well known antioxidant and phenolic compound, and promoted growth-arresting ability of anticancer drugs with minimizing cellular toxicity generated by chemotherapeutic drugs (Delmas et al. 2011; Kim et al. 2014). These research outcomes suggested that RSVL governs redox homeostasis, inflammation, cell proliferation and death by modulating cancer associated signaling pathways (Colin et al. 2014; Tosetti et al. 2009). However, the mode of action of RSVL in combination with DOX has not been well understood in depth. Motivated by the present understanding of combination effect of drugs and phytochemicals, we made an effort to delineate the molecular pathways modulated by combined effect of DOX and RSV in breast cancer cell lines and Ehrlich ascitic carcinoma (EAC) mice model.

Materials and methods

Cell culture and cytotoxicity assays

Human breast cancer cell lines, MCF-7 and MDA-MB-231 were obtained from National Centre for Cell Science (NCCS), Pune. Cells were grown in RPM1-1640 and supplemented with 10% fetal bovine serum (FBS), penicillin (100units/ml), streptomycin (100 [micro] g/ml) and culture was maintained. The cell viability assay was performed following Carmichael et al. (Carmichael et al. 1987) in both type of cells in range of doses of RSVL and DOX for 24 h and 48 h (Fig. 1). Selected doses of RSVL and DOX below its IC50 values were used to determine combination efficiency in both breast cancer cell lines (Table 2) and then, synergistic combination dose was selected on the basis of combinatorial index (Cl) for further studies (Chou 2010).

Wound healing and clonogenic assay

The migration ability of breast cancer cells (MCF-7 and MDA-MB-231 cells) were observed by performing wound-healing assay as described previously (Rodriguez et al. 2005). Cells were incubated with medium containing selected concentrations of RSVL and DOX for 48 h. The healing of scratched area was recorded microscopically at Oh, 24h and 48h after treatment and images were captured using phase contrast bright field microscope Olympus IX 51 (Olympus America Inc., Center Valley, P.A., U.S.A.) under 4X magnification and distances of healed scratches were measured by Image-Pro[R] Express Version 6.0. Clonogenic assay of breast cancer cells after treatment was performed in 6-well plate by following Pavelic et al. and repeated for three times (Pavelic et al. 1980).

Apoptosis assay

The apoptosis in EAC cells was evaluated by Annexin V/PI staining. Briefly, 1 x [10.sup.5] EAC cells were isolated from each group and washed with IX PBS. Further cells were stained with Annexin V/PI for 30 min in dark. Stained apoptotic cells were counted and analyzed by flow cytometer (BD biosciences, USA). Besides, apoptotic cells with fragmented or condensed nuclei was observed after staining with DAPI (lOng/ml) and fluorescence was captured in breast cancer cells using microscope Olympus IX 51 (Olympus America Inc., USA.) at excitation wavelength 350 nm.

Cell cycle analysis

Briefly, 1 x [10.sup.5] cells and fixed in 70% chilled ethanol and kept for 1 day at 4[degrees]C, further, cells were washed in lx PBS. Subsequently RNaseA (200 [micro]g/ml) was added and then stained with propidium iodide (PI) (20 [micro] g/ml) followed by incubation in the dark for 30 min at RT. The DNA content of the stained cells was analyzed by using CellQuest 3.3 Software with the FACS Calibur flow cytometry (BD Biosciences, CA, USA).

Measurement of intracellular reactive oxygen species (ROS)

Intracellular ROS level was determined by following Eruslanov et al. (Eruslanov and Kusmartsev 2010). EAC cells were harvested from different treated groups (mentioned in Table 4) and incubated with DCF-DA, an oxidation-sensitive fluorescent probe at the concentration of 10 [micro]M for 30 min in the dark at 37 [degrees]C. After that, fluorescence intensity was measured using flow cytometer (BD-LSR) equipped with Cell Quest software. A total of 10,000 events per sample were acquired at the excitation wavelength of 488 nm.

Quantitative real time-PCR

The expression of marker genes regulating, autophagy, inflammation, apoptosis and tumor suppressors at transcriptional level after exposure with RSVL and DOX was done by SYBR Green qRT-PCR as described by Kashyap et al. (2011). The threshold cycle (Ct) values for the triplicate reactions was averaged and normalized with GAPDH. The fold change of mRNA expression was calculated by [2.sup.-[DELTA][DELTA]Ct] value. The sequences of forward and reverse primers used are mentioned in Table 3.

Protein extraction and Western blot analysis

After the completion of treatment durations for 48 h, cells were harvested and centrifuged at 2000 rpm for 5 min. Cells were resuspended in RIPA Buffer (Sigma Aldrich) and incubated at 4[degrees]C for 10 min by vortexing. Solubilized protein in supernatant was collected by centrifugation at 10,000 x g for 10 min at 4[degrees]C and stored at -80 [degrees]C for further use. Protein concentration of each lysate was then measured using Bradford assay. Cell lysates of each groups were separated by 10% SDS-PAGE, and electrophoretically transferred to a PVDF membrane and blocked using lx blocking buffer. Further, each blot was incubated with monoclonal BCL-2, p53 (1:2000), p21-WAF1 (1:2000), BAX (1:2000), Beciln-1, LC3b, Caspase-9, and NF-kB, COX-2, PCNA, polyclonal [beta]-actin (1:2000) antibodies, washed with IX TBST and incubated with secondary antibody conjugated with peroxidase. The signal was then detected using chemiluminescent detection system (Bio-Rad).

Animals and treatment

Swiss albino mice (male, 25-30 g body weight) obtained from the CSIR-Indian Institute of Toxicology Research, Lucknow, India animal breeding colony prior ethical approval for the experiment was obtained from Institutional Ethical Committee. Animals were maintained at standard condition and exponentially grown 1 x [10.sup.6] EAC cells collected from peritoneal cavity from Ascitic mice (after the 10th day of ascites induction in healthy mice), and were inoculated into the peritoneal cavity of fresh healthy male Swiss Albino mice as described earlier (Ray et al. 2013). Prior injection of EAC cells, it was separated from macrophage cells and counted by trypan blue exclusion test. Swiss albino mice were categorized into five groups comprising 6 animals in each group (Detail of group mentioned in Table 4), and treated with different doses of DOX (5mg/kgb. wt.), RSVL (10mg/kg b.wt.) and RSVL+DOX (10mg/kg +5mg/kg b.wt.) and changes in body weight were observed up to 21 days from the day of treatment. After 24 h of injecting EAC cells, animals were treated with different doses (mentioned in Table 4) of drugs and phytochemicals, two times in a week through in traperitoneal (i.p.) route. Animals of group 1 and 2 were treated with saline (0.9% NaCl) solution. All the animals were monitored regularly for ascitic tumor growth and their overall survival till death. The mean survival time (MST), %increase in life span (% ILS) and reduction in tumor burden of EAC bearing mice treated with these anti-cancer compounds were also observed.

Statistical analysis

One way ANOVA with post hoc test and Kaplan Meier curve for survival analysis were performed for the significance (SPSS package v 10) and p value < 0.05 was considered as significant.

Results

Evaluation of cell viability and morphological changes in breast cancer cell lines after combination treatment of RSVL and DOX

The cytotoxicity activity of both DOX and RSVL were tested alone at a range of doses in MCF-7 and MDA-MB-231 breast cancer cell lines. It was observed that MCF-7 was more sensitive to administered drugs than MDA-MB-231 cells, as depicted from their *IC50 values (Fig. 1A-D, Table 1). Further, the synergistic effects of combinatorial treatment of DOX and RSVL were evaluated from their cumulative index (CI). It was observed that IC20 dose of DOX and IC30 dose of RSVL in combination (R30D20) had best synergism (CI< 1) as depicted from Fig. IE and F, (Table 2). It was also noted that R30D20 combination caused ~50% of growth inhibition of breast cancer cells (MCF-7 and MDA-MB-231) with a dose reduction of 2.5 fold in comparison to IC50 doses of DOX alone (Fig. IE and F) and thus, these combination doses were selected for subsequent comparative mechanistic study in both cell lines. TheR30D20 combination induces notable morphological changes with prominent shrinkage of both cancer cells and also causes loss of original confluency more effectively in comparison to alone doses (Fig. 2A and B). It was also observed that formation of apoptotic bodies with cell membrane shrinkage was more evident in case of MCF-7 cell line.

RSVL and DOX combination enhanced DNA fragmentation and chromatin condensation

In MCF-7 cell line, percentage of apoptotic cells for alone (R30, D20) and combination (R30D20) treatments were found to be 14.7 [+ or -] 1.3%, 21.6 [+ or -] 1.78% and 57 [+ or -] 0.97% respectively. While, percentage of apoptotic cells in alone and combination treated MDAMB-231 cells were found to be 3.37 [+ or -] 0.98%, 11.45 [+ or -] 1.8% and 22.23 [+ or -] 4.57% respectively. Thus, the results of DAP1 staining revealed a significant (p<0.05) increase in the percentage of apoptotic cells in R30D20 combination treated MCF-7 and MDA-MB-231 cells in comparison to alone treatments (Fig. 2C, D and E). It was also found that percentage of subGl population in combination (R30D20) treated MCF-7 cells was 32.45%, while in MDA-MB-231 cells it was found to be 30.34% (p < 0.05) (Fig. 4 A and B).

RSVL and DOX combination markedly reduced wound healing and clonogenic efficiency of breast cancer cells

In comparison to untreated control (~51 [+ or -] 0.32%), the percentage of wound healing ability in alone (D20, R30) and R30D20 combination treated MCF-7 cells were -31.44 [+ or -] 0.49%, ~17.27[+ or -] 0.37% and ~12.80 [+ or -] 1.5% respectively after 48 h of wounds generation. However, in case of MDA-MB-231 cells, untreated control, alone and combination of R30 and D20 treated cells showed percentage wound healing of 76.83 [+ or -]0.55%, 73.65 [+ or -] 0.035%, 58.83 [+ or -] 0.013%, 29.02 [+ or -] 0.51% respectively, after 48 h of scratch generation. Moreover, it was also noted that the wound healing capability was more decreased in MCF-7 cells as compared to MDA-MB-231 (Supplementary Fig. 1A-D). In MCF-7 cells, it was found that as compared to untreated control, alone (R30, D20) and combination (R30D20) treatments reduced the colony forming abilities by ~3.4, ~3.7 and ~13 folds respectively. While, in comparison to untreated control, in MDA-MB-231 cells, alone and combination treatments decreased the colony forming abilities by ~3.6, ~5 and ~14 folds respectively. It could be proposed that the selected synergistic dose of RSVL and DOX were more effective in inhibiting the cell proliferation and invasive properties of breast cancer cell lines (Fig. 3A-D).

RSVL and DOX combination dosage modulated the expression of genes associated with chronic inflammation, cancer cell survival, apoptosis and autophagy

Chronic inflammation is associated with high expression of NF-[kappa]B and COX-2. It was observed that both COX-2 and NF-[kappa]B showed insignificant (p [greater than or equal to] 0.05) change in gene expression in alone doses in comparison to untreated control MDA-MB-231 cells; while the combination dose (R30D20) decreased the transcripts level of NF-kappa]B by 2.8 fold (p[greater than or equal to] 0.05). However, in MCF-7 cells, combinatorial treatment caused down regulation of COX-2 and NF-kB transcripts by ~42 and -23 folds respectively (Fig. 5A, B). Akt and PTEN are one of the important representative markers associated with breast cancer cells growth and survival. It was observed that AKT was significantly ((p< 0.05) downregulated (-28 fold) in MDA-MB-231 in combination dose (R30D20) as compared to control. However, in alone treatment of D20 and R30, AKT was significantly downregulated by ~45 fold and ~5.6 fold respectively. In MCF-7 cells, combinatorial treatment caused -2.8 fold down regulation of AKT, while alone doses of RSVL and DOX reduced the expression of Akt gene by ~4.9 and ~5.7 folds respectively (p < 0.05). There was insignificant change in gene expression of PTEN in both MCF-7 and MDA-MB-231 cell lines (p [greater than or equal to] 0.05) (Fig. 5A and B). BCL-2 (and-apoptotic), BAX (pro-apoptotic) and Caspase-9 are known to be as representative apoptotic markers. BCL-2 expression in MDA-MB-231 cells was found to be downregulated by ~19 fold after combination treatment of R30D20, whereas, alone treatment with D20 and R30 caused down-regulation of BCL-2by ~2.5 and ~2.9 fold, respectively. There was insignificant change in BCL-2 gene expression in both alone and combination treated MCF-7 cells (Fig. 5A and B). The gene expression of BAX and Caspase-9 was significantly increased by ~2.2 and ~3.4 folds respectively in MCF-7 cells after combination treatment (R30D20). On the other, alone administration with R30 and D20 dose showed increased expression of BAX by ~2.2 and ~4.2 folds respectively. However, in contrast to untreated MCF-7 cells, there was insignificant change in transcript level of caspases-9 in alone treatment (p [greater than or equal to] 0.05) (Fig. 5A and B). The expression of autophagic gene (LC3B) in combination treatment was significantly reduced by ~58 and ~9.8 fold respectively as compared to alone doses, in both cell lines. Whereas, gene expression of P53 and P21 transcripts were found to be upregulated by ~3.6 and ~7.3 fold respectively in R30D20 combination treated MCF-7 cells. However, combinatorial treatment of R30D20 caused insignificant change in expression of p53, while significant upregulation of p53 was observed in alone treated cells in comparison to untreated MDA-MB-231 cells. As it was reported that, p53 is present in MDA-MB-231 cells in dominant mutant form and acts as tumor promoter via initiation of chronic inflammation (Cooks et al. 2013; McCarthy 2013),therefore our data suggest that the synergistic combination of DOX with RSVL caused down regulation of dominant mutant form of P53 in comparison to alone treatments (Fig. 5A and B).

Combination dosage of RSVL and DOX altered inflammatory, pro-apoptotic, autophagy and tumor suppressor associated proteins in MCF-7 cells

Further to confirm above results at protein level, the expression inflammatory, pro-apoptotic, autophagy and tumor suppressor associated proteins were evaluated by western blotting in MCF7 cell (Fig. 5C). The R30D20 combination dose decreased of the expression of phosphorylated form of NF-kB (~1.72 fold), COX2 (~4.5 fold) in comparison to untreated control (p<0.05) (Fig. 5D). Autophagy regulated proteins such as LC3B and Bedin-1 was downregulated by ~3 and ~2.27 folds respectively in combination dosages (Fig. 5E). It was also found that BAX/BCL-2 ratio was increased by ~17 fold in combination dose. Alone treatment of RSVL (R30) showed insignificant change in this ratio, while D20 treatment showed ~3.7 fold increased in BAX/BCL-2 expression level (Fig. 5F). Moreover, the combinatorial effects of R30D20 combination on protein expression of p53 and p21 were also evaluated. It was found that the combinatorial treatment increased the levels of p53 and p21 by ~3.2 and ~1.43 folds respectively, while alone dose of R30 induced the p53 by ~3.9 fold and p21 by -2.6 fold, respectively. However, D20 alone treatment induced p53 and p21 level by~2 and ~1.8 fold respectively (Fig. 5G). The protein level of Nrf2 (A major redox regulator) was also downregulated by ~1.42 fold change after combination treatment (R30D20). While in alone treatment with R30, a 1.4 fold change increased expression was found and insignificant change was seen in D20 treatment (Fig. 5G).

Combinatorial effects of RSVL and DOX in EAC bearing Swiss albino mice

In-vitro study was further translated into in-vivo model to observe the combinatorial effects of RSVL and DOX on EAC bearing Swiss albino mice. It was noted that the body weight of EAC group (Group 5) treated with RSVL (10mg/kg b.wt.) and DOX (5 mg/kg b.wt.) combination reduced significantly by ~3.7 fold in comparison to untreated EAC mice (Group 2). While in case of EAC mice treated with alone doses of RSVL (Group 3: 10 mg/kg.b.wt) and DOX (Group 4: 5 mg/kg.bwt), a significant decrease in body weight by ~3.4 and ~2.9 fold was observed respectively in comparison to untreated group (Group 2). These outcomes showed that the therapeutic efficiency of the antitumor drug (DOX) was increased significantly in the presence of an antioxidant (RSVL) in EAC bearing mice. We observed that DOX in combination with RSVL (Group 5) significantly increased the life span of EAC bearing mice (139%; ~50 days) by 2.39 fold as compared to untreated EAC bearing mice (Group 2). However, alone treatment with RSVL (Group 3) and DOX (Group 4) increased the lifespan by ~1.7 fold (71.62%; ~36 days) and ~1.85 fold (87.4%; ~39.6 days) respectively (Figs. 6A-E and Table 4).

We quantify the necrotic versus apoptotic populations by using Annexin-V/PI assay kit. It was found that in combination treated group, necrotic versus apoptotic population was 17.81:7.23%. While on the other hand, the percentage of necrotic versus apoptotic populations in RSVL (Group 3) and DOX treated (Group 4) were found to be 10.75:8.30%, 18.41:0.30% respectively in comparison to untreated group (Supplementary Fig. 2A). It showed that DOX in single dose kill the cell by increased necrosis while in combination with RSVL there is significant increase in apoptotic mode of killing in Ehrlich cells. The apoptosis inducing potentiality of RSVL and DOX, either alone or in combination treatments in EAC cells was analyzed by the evaluation of percentage of cells with Sub-G1 DNA content after 2nd week of treatment as isolated from the peritoneal cavity of EAC bearing mice (Supplementary Fig. 2B and 2D). It was observed that the combinatorial treatment of RSVL and DOX (Group 5) caused significant (p<0.05) increase in sub diploid DNA containing cells by ~6.25 fold as compared to untreated control (Group 2). However, alone treatment of RSVL (Group 3) and DOX (Group 4) caused significant increase in the percentage population of Sub-G1 cells by ~3.7 fold and ~5 fold respectively in comparison to untreated group (Group 2) (Supplementary Fig. 2B and 2D). It was also observed that the combinatorial treatments of RSVL and DOX significantly increased the intracellular ROS generation in EAC cells (p<0.05) (Supplementary Fig. 2C and 2E). It was noted that the % of DCFDA (+) ve EAC cells in RSVL and DOX combination was 18.19% as compared to untreated group (4.45%). However, we found an insignificant (p [greater than or equal to] 0.05) change in ROS generation in RES treated group as compared to untreated group. While on the other hand, DOX treated group showed a significant increase in the percentage of DCFDA (+) ve EAC cells (12.26%) as compared to untreated EAC group. Therefore, this outcome showed that the combinatorial treatment of RSVL and DOX can be used as a novel therapeutic combination in the treatment of human breast cancer, which has close resemblance with EAC mice model.

Discussion

Chemotherapy is one of the most common therapeutic regimens for cancer; however, in majority of cases it causes severe side effects. Thus, novel therapeutic strategies are required, which have lesser side effects with enhanced anticancer activity. The use of phytochemicals with therapeutic drug is one of the novel strategies to achieve this goal. RSLV, a well-known polyphenolic compound have investigated its potential as chemo sensitizer for doxorubicin both in-vitro and in-vivo systems (Kim et al. 2014; Osman et al. 2013). In the present study, we demonstrated that RSVL in combination with DOX potentiated its anticancer effect synergistically both in-vitro and in-vivo model. In the cell viability assay, 2.5 fold dose reduction for DOX in the presence of RSVL (IC30 dose) was found to achieve ~50% growth inhibition in both breast cancer cell lines .It shows that in synergistic combination of DOX with RSVL, a less cytotoxic dose of DOX (IC20) is required to achieve the therapeutic efficacy equivalent to higher doses of DOX.

Anchorage independent growth and increased cell migration are two major hallmarks of cancer (Pickup et al. 2014). In-vitro study showed that this novel combinations have reduced wound healing and colony formation abilities in both cell lines. This combination was also found to enhance the apoptosis as indicated by increased percentage of chromatin condensation and DNA fragmentation in both cell lines as compared to alone treatment of RSVL and DOX. Further, a significant increase in sub G1 population was also observed in both cell lines. The combination dose also enhanced apoptosis in EAC cells as evidenced by Annexin-V/PI study. In-vivo study showed the increased life span of ~139% in combination treated animals (Group 5) in comparison to untreated EAC bearing animals (Group 2). In addition to this, mean survival time (MST) for untreated (Group 2) was ~21 day, but in combination treated group (Group 5), MST was increased to ~50 days (2.38 fold). Moreover, ~3.7 fold decrease in tumor burden was also observed after combinatorial treatment in Group 5. Thus, both invitro and in-vivo studies showed enhanced chemotherapeutic potential of combined dose of RSVL and DOX in comparison to alone dose of DOX.

The molecular mode of action of RSVL and DOX against breast cancer has still a curiosity among researchers. Taking this note, we evaluated the expression of molecular markers associated with inflammation, autophagy, apoptosis and cell survival at both transcript and protein level. It is reported that chronic inflammatory environment is favorable for tumor growth and proliferation (Shacter and Weitzman 2002). Chronic inflammation also modulates several others signaling pathways associated with tumor survival (Hoesel and Schmid 2013) such as COX-2 in association with transcription factor NF-kB regulates the chronic inflammatory environment by infiltration of cytokines secreting immune cells in surroundings tumor and indirectly enhances the tumor cells proliferation and invasion (Landskron et al. 2014). Chronic inflammation in advanced stage cancer also induces autophagy for cancer cell survival (Yang et al. 2015). However, autophagy possess dual role in cancer, it causes degradation of damaged cells and suppress tumor development in early stage breast cancer, however in advanced stage, it helps in survival of cancer cells by recycling of nutrients in hypoxic environment (Cook et al. 2011). Autophagy was also reported to be associated with the emergence of drug resistance in cancer cells. Qadir et al., showed that autophagy protects MCF-7 cells against tamoxifen mediated death and inhibition of autophagy (Qadir et al. 2008) via knockdown of autophagy associated genes (BECLIN1, Atg5 and Atg7) resulted in restoration of tamoxifen sensitivity in breast cancer cells (Qadir et al. 2008). Thus, targeting autophagy can be supportive to restore chemotherapeutic drug sensitivity and promote breast cancer cell death. In the present study, a significant decreased expression of inflammatory associated genes (NF-kB, and COX-2) was observed both at transcript and protein level. Combinatorial treatment of RSVL and DOX also modulated autophagy associated genes and protein as marked by~58 and ~9.8 fold reduction of LC3B gene expression in MCF-7 and MDA-MB-231 cells respectively and significant decreased expression of LC3B(~3 fold) and Beclin-1(~2.27fold) proteins in MCF7 cells. An increase in apoptosis associated protein (BAX/BCL-2 ratio) was also noticed (~17 fold) in combinatorial treated MCF-7 cells.

In conclusion, after studying several parameters based on in-vitro and in-vivo studies, it has been shown that RSVL enhanced cancer chemotherapeutic potential of DOX. The molecular level analysis of the present study suggested that this combination may potentiate the effects of each other in synergistic manner and causes induction of apoptosis, which is mediated by down regulation of genes and proteins associated with inflammation (NF[kappa]B, COX-2) and autophagy (LC3B, Beclin-1). Thus, our finding suggested not only the crosstalk of signaling pathways associated with chronic inflammation, autophagy and apoptosis altered during breast cancer pathogenesis but also make better understanding to demonstrate novel targets of breast cancer for successful chemotherapy.

http://dx.doi.org/10.1016/j.phymed.2015.12.020

ARTICLE INFO

Article history:

Received 24 September 2015

Revised 29 December 2015

Accepted 31 December 2015

Conflict of interest

None

Acknowledgment

Authors are thankful to Council of Scientific & Industrial Research, New Delhi for funding this work from network project BSC0111, and we are also thankful to UGC for providing senior research fellowship to Mr. Girish Rai. Mr. Puneet Khare is highly acknowledged for flow cytometery and Mr. S. H. N Naqvi is also acknowledged for helping in animal study.

Supplementary materials

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2015.12.020.

References

Bianco, R., Melisi, D., Ciardiello, F., Tortora, G., 2006. Key cancer cell signal transduction pathways as therapeutic targets. Eur. J Cancer 42. 290-294.

Bolhassani, A., 2015. Cancer chemoprevention by natural carotenoids as an efficient strategy. Anticancer Agents Med. Chem 15 (8), 1026-1031.

Carmichael, J., DeGraff, W.G., Gazdar, A.F., Minna. J.D., Mitchell, J.B., 1987. Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res. 47, 936-942.

Chou, T.C., 2010. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 70, 440-446.

Colin, D.J., Limagne, E., Ragot, K., Lizard, G., Ghiringhelli, F., Solary, E., Chauffert, B., Latruffe, N., Delmas, D., 2014. The role of reactive oxygen species and subsequent DNA-damage response in the emergence of resistance towards resveratrol in colon cancer models. Cell Death Dis. 5, e1533.

Cook, K.L., Shajahan, A.N., Clarke, R., 2011. Autophagy and endocrine resistance in breast cancer. Expert Rev. Anticancer Ther. 11, 1283-1294.

Cooks, T., Pateras, IoannisA S., Tarcic, O., Solomon, H., Schetter, AaronA J., Wilder, S., Lozano, G., Pikarsky, E., Forshew, T., Rozenfetd, N., Harpaz, N., Itzkowitz, S., Harris, CurtisA C., Rotter, V., Gorgoulis, VassilisA G., Oren, M., 2013. Mutant p53 prolongs NF-IB activation and promotes chronic inflammation and inflammation-associated colorectal cancer. Cancer Cell 23, 634-646.

Delmas, D., Solary, E., Latruffe, N., 2011. Resveratrol, a phytochemical inducer of multiple cell death pathways: apoptosis, autophagy and mitotic catastrophe. Curr. Med. Chem. 18, 1100-1121.

Delmas, D., Solary, E., Latruffe. N., 2014. Resveratrol, a phytochemical inducer of multiple cell death pathways: apoptosis, autophagy and mitotic catastrophe. Curr. Med. Chem. 18, 1100-1121.

Eruslanov, E., Kusmartsev, S., 2010. Identification of ROS using oxidized DCFDA and flow-cytometry. Methods Mol. Biol. 594, 57-72.

Ferlay, J., Soerjomataram, I., Dikshit, R., Eser, S., Mathers, C., Rebelo, M., Parkin, D.M., Forman, D., Bray, F., 2015. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. int. J. Cancer 136, E359-E386.

Galustian, C., Dalgleish, A.G., 2010. The power of the web in cancer drug discovery and clinical trial design: research without a laboratory? Cancer Inf. 9, 31-35.

George, J., Singh, M., Srivastava, A.K., Bhui, K., Roy, P., Chaturvedi, P.K., Shukla, Y., 2011. Resveratrol and black tea polyphenol combination synergistically suppress mouse skin tumors growth by inhibition of activated MAPKs and p53. PLoS One 6, e23395.

Hoesel, B., Schmid, J.A., 2013. The complexity of NF-kappaB signaling in inflammation and cancer. Mol. Cancer 12, 86.

Iwamoto, T., 2013. Clinical application of drug delivery systems in cancer chemotherapy: review of the efficacy and side effects of approved drugs. Biol. Pharm. Bull. 36, 715-718.

Kim, T.H., Shin, Y.J., Won, A.J., Lee, B.M., Choi, W.S., Jung, J.H., Chung, H.Y., Kim, H.S., 2014. Resveratrol enhances chemosensitivity of doxorubicin in multidrug-resistant human breast cancer cells via increased cellular influx of doxorubicin. Biochim. Biophys. Acta. 1840, 615-625.

Kummar, S., Chen, H.X., Wright, J., Holbeck, S., Millin, M.D., Tomaszewski, J., Zweibel, J., Collins, J., Doroshow, J.H., 2010. Utilizing targeted cancer therapeutic agents in combination: novel approaches and urgent requirements. Nat. Rev. Drug Discov. 9, 843-856.

Landskron, G., De la Fuente, M., Thuwajit, P., Thuwajit, C., Hermoso, M.A., 2014. Chronic inflammation and cytokines in the tumor microenvironment. J. Immunol. Res. 2014, 149185.

Lehne, G., 2000. P-glycoprotein as a drug target in the treatment of multidrug resistant cancer. Curr. Drug Targets 1, 85-99.

Li, W., Chen, L., Li, X., Jia, X., Feng, C., Zhang, L, He, W., Lv, J., He, Y., Qu, X., Zhou, Y., Shi. Y., 2013. Cancer-related marketing centrality motifs acting as pivot units in the human signaling network and mediating cross-talk between biological pathways. Mol. Biosyst. 9, 3026-3035.

McCarthy, N., 2013. Inflammation: Mutant p53 fans the flames. Nat. Rev. Cancer 13, 441.

Osman, A.-M., Al-Harthi, S., AlArabi, O., Elshal, M., Ramadan, W., Alaama, M., Al-Kreathy, H., Damanhouri, Z., Osman, O., 2013. Chemosensetizing and cardioprotective effects of resveratrol in doxorubicin- treated animals. Cancer Cell Int. 13, 52.

Pavelic, Z.P., Slocum, H.K., Rustum, Y.M., Creaven, P.J., Karakousis, C., Takita, H., 1980. Colony growth in soft agar of human melanoma, sarcoma, and lung carcinoma cells disaggregated by mechanical and enzymatic methods. Cancer Res. 40, 2160-2164.

Pestalozzi, B.C., Sotos, G.A., Choyke, P.L., Fisherman, J.S., Cowan, K.H., O'Shaughnessy, J.A., 1993. Typhlitis resulting from treatment with taxol and doxorubicin in patients with metastatic breast cancer. Cancer 71, 1797-1800.

Pickup, M.W., Mouw, J.K., Weaver, V.M., 2014. The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 15, 1243-1253.

Qadir, M.A., Kwok, B., Dragowska, W.H., To, K.H., Le, D., Bally, M.B., Gorski, S.M., 2008. Macroautophagy inhibition sensitizes tamoxifen-resistant breast cancer cells and enhances mitochondrial depolarization. Breast Cancer Res. Treat 112, 389-403.

Rashid, S., Ali, N., Nafees, S., Ahmad, S.T., Arjumand, W., Hasan, S.K., Sultana, S., 2013. Alleviation of doxorubicin-induced nephrotoxicity and hepatotoxicity by chrysin in Wistar rats. Toxicol. Mech. Methods 23, 337-345.

Ray, L., Kumar, P., Gupta, K.C., 2013. The activity against Ehrlich's ascites tumors of doxorubicin contained in self assembled, cell receptor targeted nanoparticle with simultaneous oral delivery of the green tea polyphenol epigallocatechin-3-gallate. Biomaterials 34, 3064-3076.

Rodriguez, L.G., Wu, X., Guan, J.L., 2005. Wound-healing assay. Methods Mol. Biol. 294, 23-29.

Roy, P., Kalra, N., Prasad, S., George, J., Shukla, Y., 2009. Chemopreventive potential of resveratrol in mouse skin tumors through regulation of mitochondrial and P13K/AKT signaling pathways. Pharm. Res. 26, 211-217.

Shacter, E., Weitzman, S.A., 2002. Chronic inflammation and cancer. Oncology (Williston Park) 16, 217-226, 229; discussion 230-212.

Siddiqui, I.A., Sanna, V., Ahmad, N., Sechi, M., Mukhtar, H., 2015. Resveratrol nanoformulation for cancer prevention and therapy. Ann. N Y Acad. Sci 1348, 20-31.

Singal, P.K., Iliskovic, N., 1998. Doxorubicin-induced cardiomyopathy. N. Engl. J. Med. 339, 900-905.

Thakur, J.S., Chauhan, C.G., Diwana, V.K., Chauhan, D.C., Thakur, A., 2008. Extravasational side effects of cytotoxic drugs: A preventable catastrophe. Indian J. Plast. Surg. 41, 145-150.

Tosetti, F., Noonan, D.M., Albini, A., 2009. Metabolic regulation and redox activity as mechanisms for angioprevention by dietary phytochemicals. Int. J. Cancer 125, 1997-2003.

Vinod, B.S., Maliekal, T.T., Anto, R.J., 2013. Phytochemicals as chemosensitizers: from molecular mechanism to clinical significance. Antioxid. Redox. Signal 18, 13071-348.

Wang, B., Rosano, J.M., Cheheltani, R., Achary, M.P., Kiani, M.F., 2010. Towards a targeted multi-drug delivery approach to improve therapeutic efficacy in breast cancer. Expert Opin. Drug Deliv. 7, 1159-1173.

Wang, N., Xu, H.L., Zhao, X., Wen, X., Wang, FT., Wang, S.Y., Fu, L.L., Liu, B., Bao, J.K., 2012. Network-based identification of novel connections among apoptotic signaling pathways in cancer. Appl. Biochem. Biotechnol. 167, 621-631.

Yang, X., Yu, D.D., Yan, F., Jing, Y.Y., Han, Z.P., Sun, K., Liang, L., Hou, J., Wei, L.X., 2015. The role of autophagy induced by tumor microenvironment in different cells and stages of cancer. Cell Biosci. 5, 14.

Girish Rai (a,b), Sanjay Mishra (a,b), Shankar Suman (a,b), Yogeshwer Shukla (a,b), *

(a) Proteomics and Environmental Carcinogenesis Laboratory, Food, Drug and Chemical Toxicology Group, CSIR-Indian Institute of Toxicology Research, M.G. Marg, Lucknow, Uttar Pradesh 226001, India

(b) Academy of scientific and Innovative Research (AcSIR) CSIR-IITR Campus, Lucknow, Uttar Pradesh 226001, India

Abbreviations: BCL-2, (B-cell lymphoma-2); COX-2, cyclooxygenase-2; DCFDA, 2',7'-dichlorofluorescin diacetate; DOX, doxorubicin; EAC, Ehrlich ascites carcinoma: IC50, half maximal inhibitory concentration; NRF2, nuclear factor (elytroid-derived 2)-like-2; PI, propidium iodide; RSVL, resveratrol; ROS, reactive oxygen species.

* Corresponding author at: Proteomics and Environmental Carcinogenesis Laboratory, Food, Drug and Chemical Toxicology Group, CSIR-Indian Institute of Toxicology Research, M.G. Marg, Lucknow, Uttar Pradesh-226001, India. Tel.: +91 522 2963827; fax: +91 522 2628227.

E-mail address: yshukla@iitr.res.in, yogeshwer_shukla@hotmail.com (Y. Shukla).

Table 1
Comparison of cytotoxicity of RSVL and DOX in breast cancer
cell lines.

Cell lines   RSVL   Dose ([micro]M)   DOX   Dose (nM)

MDA-MB-231   R30    108               D20   312
             R50    180               D50   781

MCF-7        R30    84.6              D20   216
             R50    141               D50   541

Abbreviations: R30, IC30 of resveratrol; R50, IC50 of resveratrol;
D20, IC20 of doxorubicin; D50, IC50 of doxorubicin

Table 2
Combination index of RSVL and DOX combination in MCF-7 and MDA-MB-231
treated cells.

Breast cancer   Combination   Combination   Effects
cell lines      dose          index (CI)

MCF-7           R20D20        0.965         Synergistic
                R20D30        1.223         --
                R20D10        0.849         Synergistic
                R30D20        0.691         Synergistic

MDAMB-231       R20D20        1.196         --
                R20D30        1.270         --
                R20D10        0.664         Synergistic
                R30D20        0.849         Synergistic
                R10D20        0.493         Synergistic

Table 3
List of genes with their forward and reverse primer sequences used for
the gene expression analysis by qReal-Time PCR.

Gene         Forward primer           Reverse primer
             sequence (5'-3')         sequence (5'- 3')

P53          CCCCAGCCAAAGAAGAAAC      CTCACGCCCACGGATAAT
P21          GCTGGTGGCTATTTGTCCT      CATGCGTTCTGACGGACAT
COX-2        CTTCACGCATCAGTTTTTCAAG   TCACCGTAAATATGATTTAAGTCCAC
NFkB         CTGGCAGCTCTTCTCAAAGC     TCCAGGTCATAGAGAGGCTCA
BCL-2        AGTACCTGAACCGGCACCT      GCCGTACAGTTCCACAAAGG
BAX          AGCAAACTGGTGCTCAAGG      TCTTGGATCCAGCCCAAC
CASPASE-9    AAGCCCAAGCTCTTTTTCATC    AGCAAACTGGTGCTCAAGG
AKT2         CTCACACAGTCACCGAGAGC     TGGGTCTGGAAGGCATACTT
PTEN         GCACAAGAGGCCCTAGATTTC    CGCCTCTGACTGGGAATAGT
LC3          CATGAGCGAGTTGGTCAAGA     CCATGCTGTGCTGGTTCA
GAPDH        AGCCACATCGCTCAGACAC      GCCCAATACGACCAAATCC

Table 4
Treatment groups.

Groups     Dosing schedule of treated drugs

Group 1    Control
Group 2    EAC tumor-bearing untreated mice
Group 3    RSVL (10 mg/kg b.wt.)
Group 4    DOX (5 mg/kg b.wt.)
Group 5    RSVL (10 mg/kg b.wt.) and DOX (5 mg/kg b.wt.)
COPYRIGHT 2016 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rai, Girish; Mishra, Sanjay; Suman, Shankar; Shukla, Yogeshwer
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Mar 15, 2016
Words:6394
Previous Article:NF-[kappa]B pathway inhibition by anthrocyclic glycoside aloin is key event in preventing osteoclastogenesis in RAW264.7 cells.
Next Article:Diosgenin induces ROS-dependent autophagy and cytotoxicity via mTOR signaling pathway in chronic myeloid leukemia cells.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters