Printer Friendly

Restriction enzyme-based method for transforming growth factor-[[beta].sub.1] genotyping: nonisotopic detection of polymorphisms in codons 10 and 25 and the 5'-flanking region.

Transforming growth factor-[[beta].sub.1] (TGF-[[beta].sub.1]) modulates a wide spectrum of biological activities, including cell proliferation, differentiation, and adhesion as well as extracellular matrix formation. The involvement of TGF-[[beta].sub.1] in inflammation and tissue repair has been established in the past few years, suggesting a crucial role for this cytokine in pathologies of the cardiovascular system, kidney (chronic allograft rejection in kidney transplantation, glomerulonephritis, and diabetic nephropathy), bones (osteoporosis), skin (systemic sclerosis), lung (idiopathic lung fibrosis and asthma), and liver (cirrhosis).

The human TGF-[[beta].sub.1] gene (TGFB1), located on chromosome 19813, contains seven exons that give rise to a precursor protein of 390 amino acids (1), which is proteolytically processed to generate the mature protein of 112 amino acids. The promoter for TGF-[[beta].sub.1] contains two major sites for the initiation of transcription and multiple regulatory motifs, but it lacks the typical TATA or CAAT boxes (2).

Seven TGFB1 polymorphisms recently have been reported as single-stranded conformational polymorphisms and applied to a multicenter study population, the Etude Cas-Temoin de L'Infarctus du Myocarde (ECTIM) study (3). Three of the seven allelic variations were localized in the 5'-flanking region of the TGFB1 gene (at positions -988, -800, and -509), three were in the coding region (codons 10, 25, and 263), and an insertion was also described in the 5'-untranslated region at position +72.

The analysis of candidate genes and/or polymorphisms has been widely applied in clinical genetics to study human diseases. A rapid and easy method for genotyping is essential in such studies, in which large numbers of cases and controls are needed. The ECTIM study used allele-specific oligonucleotides (ASOs). After amplification by PCR, products were blotted into a nylon membrane and hybridized with an ASO probe. The major disadvantage of this method is that it its time-consuming and requires radioactively labeled oligonucleotides.

We describe here a new, rapid, nonradioactive, and relatively inexpensive method for TGFB1 genotyping, using restriction site polymorphism (RSP) methodology. A fragment of the promoter or coding region of the TGFB1 gene is amplified by PCR and subsequently digested with restriction enzymes: MaeIII, AocI, MspA1I, and FseI for the allelic variants located at positions -800, -509, codon 10, and codon 25, respectively.

We studied DNA from 73 cadaver organ donors from our Institution with no associated medical disease (e.g., arterial hypertension, any type of nephropathy, chronic obstructive pulmonary diseases, and chronic liver diseases) and no chronic diseases. Blood samples (10 mL) were collected into EDTA tubes and used for the separation of white cells. Genomic DNA was purified from peripheral leukocytes by salting out (4).

Published sequence information of the TGF-[[beta].sub.1] promoter gene (2) was used to design a pair of primers spanning positions -800 and -590; this amplification will be referred to as F1-F2. Primers for codons 10 and 25 were kindly provided by I. Hutchinson (University of Manchester, UK), and this amplification will be referred to as F3-F4. The primer positions, sequences, and product sizes for the F1-F2 and F3-F4 amplifications are listed in Table 1, and a schematic showing the positions of both polymorphic and nonpolymorphic restriction sites is shown in Fig. 1A.

PCR conditions were the same for both amplifications: 1.5 mmol/L Mg[Cl.sub.2], 50 mmol/L KCl,10 mmol/L Tris-HCl (pH 8.3), 1 [mu]mol/L each primer, 0.2 mmol/L each dNTP, 25 ng of genomic DNA, 2.0 U of Taq DNA polymerase (Boehringer Mannheim), and 50 mL/L formamide in a 30-[micro]L reaction mixture. PCR contamination was checked by the inclusion of negative controls. PCR reactions were initially denatured at 94 [degrees]C for 5 min and subjected to 35 cycles in a PTC-100 thermal cycler (MJ Research) with 30 s of denaturing at 94 [degrees]C, 30 s of annealing at 60 [degrees]C, and 30 s of extension at 72 [degrees]C. A final elongation step of 5 min at 72 [degrees]C was also included. The identities of the F1-F2 and F3-F4 amplification products were confirmed by restriction enzyme digestion (data not shown).

Amplified DNA (5-10 [micro]L) was digested in a 20-[micro]L reaction mixture, using the buffers and temperatures recommended by the manufacturers. The enzymes used were as follows: MaeIII and AocI (Boehringer Mannheim), MspA1I and FseI (New England Biolabs). Digestions were carried out for at least 2 h. The amount of restriction enzyme required for each digestion was as follows: 1.5 U for MaeIII, 5.0 U for AocI, 10.0 U for MspA1I, and 2.0 U for FseI. Digested products were fractionated in 7.0% polyacrylamide gels and visualized by ethidium bromide staining and transillumination with ultraviolet light. The size marker was pBR322 cleaved with HaeIII (DNA molecular size marker V; Boehringer Mannheim).

[FIGURE 1 OMITTED]

Hardy-Weinberg equilibrium was tested by [X.sup.2] with one degree of freedom. Comparisons of genotype frequencies between the ECTIM control group and the present results were performed by [x.sup.2] with two degrees of freedom. In cases involving RSPs with low frequencies, groups were combined and subjected to the Fisher exact test.

Results for the AocI and MaeIII digestion for the 5'-end RSPs of the TGFB1 gene are shown in Fig. 1B. The G[right arrow]A transition at position -800 was detected by the loss of the restriction site for MaeIII: the G allele is defined by the presence of two polymorphic bands of 205 and 137 bp, whereas the A allele is defined by the absence of the MaeIII site and is detected by a 342-bp band. MaeIII digestion of the F1-F2 amplification product produces a constant 114-bp fragment.

The RSP located at position -509 was described as a C[right arrow]T transition. In this case, the C allele was detected by the presence of 429- and 26-bp bands, whereas the T allele is defined by the loss of the AocI site, yielding an undigested 455-bp fragment.

Band patterns for codons 10 and 25 are shown in Fig. 1B. A T[right arrow]C transition at codon 10 produces the Leu (10) [right arrow] Pro substitution in the signal peptide of the TGF-[[beta].sub.1] precursor protein and is detected by the MspA1I restriction enzyme. MspA1I restriction digestion of F3-F4 amplification produces four constant fragments of 67, 67, 41, and 40 bp. The Pro allele is defined by the presence of polymorphic bands of 273 and 12 bp, and the Len allele is defined by a 285-bp fragment.

The Arg25 [right arrow] Pro polymorphism, a G [right arrow] C transversion, was detected by the loss of the FseI site. The Pro allele is detected by an undigested PCR product of 500 bp, whereas the Arg allele produces two bands of 318 and 182 bp.

RSPs were determined in 73 unrelated healthy controls; the genotype frequencies are summarized in Fig. 1B. Genotype and allelic frequencies for the Mediterranean population analyzed do not statistically differ from frequencies reported in the ECTIM study (3) (P values not shown for the sake of simplicity). The frequency of the allele for the codon 10 polymorphism was 0.47% among healthy Japanese controls, 0.53% in the ECTIM, and 0.59% in the present studies; the differences are not statistically significant.

The major advantage of this method is its simplicity because only two PCR reactions are used to genotype four RSPs. This procedure replaces the three pairs of primers used by Cambien et al. (3) to amplify and determine the same polymorphisms (codons 10 and 25 are also amplified in the same PCR reaction) and the design and temperature optimization of eight ASOs. It also reduces the processing time per sample because the ASO method not only needs PCR amplification but also needs 6 h of hybridization, without taking into account the time for autoradiography. Digestion with restriction enzymes and polyacrylamide electrophoresis can be performed in 5 h. The present restriction enzyme method also avoids the use of radioactivity ([sup.32]p-labeled oligonucleotides).

Recently, a codon 10 polymorphism has been characterized by allele-specific amplification (5). Allele-specific amplification is based on two primers, each differing from the other in the terminal 3' nucleotide, which are specific for each allelic variant. Taq polymerase will not extend if a mismatch is present at the 3' end of the primer-template duplex. This method involves a limited effort because only one PCR reaction is necessary for each allele-specific primer. Direct visualization on agarose gels is the only postamplification processing. However, primer design and PCR conditions are critical because under some conditions, a single 3'-mismatched base permits amplification (6). Purine-purine and pyrimidine-pyrimidine mismatches are more refractory to extension than purine-pyrimidine mismatches; in such cases, additional mismatches can be introduced to destabilize the primer-template duplex and to increase specificity. Magnesium, dNTPs, Taq polymerase or primer concentrations, and the precise temperature of annealing must be carefully controlled to maintain the specificity of the reaction (7).

Another three polymorphisms were described by Cambien et al. (3) in the TGFB1 gene. A C[right arrow]A transversion was detected at position -988; this could be considered as a variant because it was present in only 2 of 1000 individuals. A "C" insertion was also reported at position +72 in the 5'-untranslated region. This polymorphism is in mutual association with a codon 25 polymorphism (as shown by the strong linkage disequilibrium coefficient of -1.0 reported); therefore, we decided to exclude it and to analyze codon 25 polymorphisms. The +72 polymorphism is more difficult to detect than the C[right arrow]G transversion at codon 25, the latter being easily detected by the loss of an FseI site. This allows us to use only one pair of primers to amplify codons 25 and 10 in one PCR reaction. Another variant was reported in codon 263. In this case, a C[right arrow]T transition produces a [Thr.sup.263] [right arrow] Ile substitution, the Thr allele being much more frequent, with only 6.7% of the subjects analyzed being heterozygous for this polymorphism. To our knowledge, there is no available enzyme capable of recognizing this substitution; therefore, the use of allele-specific primers or the design of a modified primer introducing an artificial restriction site (8) could be considered.

The genotyping system described here is simple, reliable, and relatively inexpensive when a large sample set needs to be genotyped, and it could be performed in laboratories without facilities for radioactivity. In the future, clinical studies on the TGFB1 polymorphisms could confirm suspicions of the crucial role of TGF-[[beta].sub.1] and genetic predisposition to several fibrotic diseases.

This work was supported in part by the following grants: Grant Pensa-Esteve/1998 from the Catalonian Society of Nephrology and Grant FIS 99/0176 from the Fondo de Investigaciones Sanitarias. We thank Drs. I. Hutchinson and V. Pravica (School of Biological Sciences, University of Manchester, Manchester, UK) for generously providing the sequences for the F3-F4 primers.

References

(1.) Derynck R, Rhee L, Chen EY, Van Tilburg A. Intron-exon structure of the human transforming growth factor-[beta] precursor gene. Nucleic Acids Res 1987;15:3187-9.

(2.) Kim SJ, Glick A, Sporn MB, Roberts AB. Characterization of the promoter region of the human transforming growth factor 0. gene. J Biol Chem 1989;264:402-8.

(3.) Cambien F, Ricard S, Troesch A, Mallet C, Gonerenaz L, Evans A, et al. Polymorphisms of the transforming growth factor-[[beta].sub.1] gene in relation to myocardial infarction and blood pressure. The Etude Cas-Temoin de L'Infarctus du Myocarde (ECTIM) study. Hypertension 1996;28:881-7.

(4.) Miller SA, Dykes DD, Polesky HF. A simple salting out procedure of extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

(5.) Yamada Y, Miyauchi A, Goto J, Takagi Y, Okuizumi H, Kanematsu M, et al. Association of a polymorphism of the transforming growth factor-[[beta].sub.1] gene with genetic susceptibility to osteoporosis in postmenopausal Japanese women. J Bone Miner Res 1998;13:1569-79.

(6.) Kwok S, Kellog DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ. Effects of primer-template mismatches on the polymerase chain reaction: human immunodefciency virus type 1 model studies. Nucleic Acids Res 1990;18:999-1005.

(7.) Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-16.

(8.) Haliassos A, Chomel JC, Tesson L, Baudis M, Kruh J, Kaplan JC, Kitzis A. Modification of enzymatically amplified DNA for the detection of point mutations. Nucleic Acids Res 1989;17:3606.

Sergi Lario, [1] Pablo Inigo, [1] Josep M. Campistol, [1] * Esteban Poch, [2] Francisca Rivera, [3] and Federico Oppenheimer [1] ([1] Renal Transplant Unit, [2] Nephrology Department, and [3] Hormonal Laboratory, Hospital Clinic, University of Barcelona, Institut d'Investigacio Biomediques August Pi i Sunyer, 08036 Barcelona, Spain; * address correspondence to this author at: Renal Transplant Unit, Hospital Clinic, 170 Villarroel, 08036 Barcelona, Spain; fax 34-93-2275498, e-mail jmcampis@medicina.ub.es)
Table 1. Primers and restriction enzymes used for detection of
the 5' end and coding region of TGFB1 polymorphisms.

 Primer 5' end
 length, position
Amplification Primer sequence S' to 3' nt (a) (b)

F1-F2 F1(S) GGGGACACCATCTACAGTG 19 -937
 F2(As) GGAGGAGGGGGCAACAGG 18 -500
F3-F4 F3(S) TTCAAGACCACCCACCTTCT 20 $597
 F4(As) TCGCGGGTGCTGTTGTACA 19 $1,078

 Product Recognition
 length, sequence, (c)
Amplification bp RSP Enzyme 5' to 3'

F1-F2 455 -800 MaeIII [down arrow] GTNAC
 -509 Aocl CC [down arrow] TNAGG
F3-F4 500 Codon 10 MspA1l CTG [down arrow] CTG (d)
 Codon 25 Fsel GGCCGG [down arrow] CC

 Base Restriction
Amplification substitution site

F1-F2 G [right arrow] A Present
 C [right arrow] T Present
F3-F4 T [right arrow] C (Leu [right arrow] Pro) Absent
 G [right arrow] C (Arg [right arrow] Pro) Present

(a) nt, nucleotides; S, sense; As, antisense.

(b) Nucleotides are numbered from the start of transcription.

(c) Underlined letters indicate the allelic substitutions determining
the absence or presence of the restriction site.

(d) The published sequence surrounding codon 10 is shown. The actual
MspA1l restriction site is C(A or C)G [down arrow] C(G or T)G.
COPYRIGHT 1999 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 1999 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Lario, Sergi; Inigo, Pablo; Campistol, Josep M.; Poch, Esteban; Rivera, Francisca; Oppenheimer, Fede
Publication:Clinical Chemistry
Date:Aug 1, 1999
Words:2366
Previous Article:Characteristics of clinical molecular-genetic testing laboratories in the United States.
Next Article:Analysis of cell-free Epstein-Barr virus-associated RNA in the plasma of patients with nasopharyngeal carcinoma.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |