Printer Friendly

Respuesta fisiologica y molecular de Anadara tuberculosa (Arcoida: Arcidae) al estres de salinidad.

Physiological and molecular response of Anadara tuberculosa (Arcoida: Arcidae) to salinity stress.

Anadara tuberculosa (Sowerby, 1833), popularmente conocida en la region Tumbes como concha negra, es un molusco bivalvo perteneciente a la familia Arcidae, que se distribuye a lo largo de la costa del Oceano Pacifico, desde Baja California, Mexico hasta Tumbes, Peru (Espinosa, Delgado, Orobio, Mejia-Ladino, & Gil-Agudelo, 2010; Cruz, Fonseca, & Chavarria-Solera, 2012); habita la zona intermareal, asociada a los sustratos fangosos, arcillosos o limo-arcillosos del ecosistema de manglar (Mendoza & Peralta, 2004). Se explota artesanalmente por extractores conocidos como "concheros" quienes sustentan parte de su economia con la extraccion y venta de este molusco; sin embargo, la mayoria de los bancos naturales actualmente se encuentran sobreexplotados y algunas poblaciones, en la mayoria de los paises, cercanas al colapso (Lucero, Cantera, & Neira, 2012). En Peru, las poblaciones de A. tuberculosa se han reducido en un 73.2 % durante el periodo de 1996 al 2007 (Ordinola, Montero, Aleman, & Llanos, 2007). Por este motivo, se estan realizando actividades alternativas como la produccion de semillas en laboratorio, cuyas experiencias favorables han sido posibles en Mexico, El Salvador, Peru y Ecuador. En Peru, el engorde en el manglar de semillas producidas en laboratorio ha sido un exito, aunque con problemas de elevadas mortalidades, asociadas al descenso de la salinidad, en los meses de lluvia (Diringer, Vasquez, Moreno, Pretell, & Sahuquet, 2012; Pretell, 2015-comunicacion personal).

A pesar de las diferencias de sensibilidad a variaciones de salinidades, todos los bivalvos son osmoconformes, es decir poseen poca o nula capacidad para la regulacion osmotica de su hemolinfa, motivo por lo que, las celulas soportan la carga de la regulacion del volumen ajustando las concentraciones intracelulares de amino acidos libres (FAAs) y otras moleculas organicas pequenas; sin embargo, los FAAs son principalmente obtenidos del catabolismo de proteinas (autofagia) cuya excesiva perdida provoca la muerte del animal (Gosling, 2015). A. tuberculosa adultas, muestran gran adaptacion a salinidades de 20 a 40 ppt, sin mortalidades asociadas (Nieves et al., 2009); pero experiencias realizadas sobre semillas de 5 mm, mostraron que a salinidades inferiores a 25 ppt provocan importantes mortalidades despues de unos dias (Diringer et al., 2012).

Los principales mecanismos de adaptacion a diferentes salinidades de la ostra y del mejillon han sido caracterizados a nivel molecular (Cross, Merlo, Rodriguez, Portela-Bens, & Rebordinos, 2014; Eierman & Hare, 2014); en particular, Meng et al. (2013), resaltaron la primordial importancia de las vias de metabolismo de los FAAs para la adaptacion eurihalina de la ostra Crassostrea gigas. A pesar que la mayoria de los trabajos han sido realizados en diferentes especies de bivalvos, es muy probable que los mecanismos de osmorregulacion se conserven a nivel inter-especifico. Recientemente, tecnologias de proteomica se han presentado como una alternativa para estudiar la respuesta de bivalvos frente a estres abioticos (Artigaud et al., 2015; Rocher et al., 2015).

Por lo anterior, es que el objetivo de este trabajo fue determinar la respuesta fisiologica y molecular de A. tuberculosa sometida a un estres de baja salinidad. Adultos de A. tuberculosa fueron sometidos a salinidades de 5 a 33 ppt mediante desafios experimentales de diferentes rangos de salinidad. Asimismo, en paralelo se caracterizo los genes asociados a la osmorregulacion con tecnicas de genomica y de proteomica comparativas, permitiendo caracterizar la respuesta de concha negra al estres de salinidad, tanto en lo ecofisiologico como en lo molecular, para entender los mecanismos de adaptacion, que permitiran a futuro seleccionar marcadores para programas de mejoramiento genetico de este importante recurso en la Region Tumbes.

MATERIALES Y METODOS

Un total de 150 ejemplares de A. tuberculosa fueron recolectados entre agosto 2015 y enero 2016 en los bancos naturales del manglar colindante a la Bahia de Puerto Pizarro (3[grados]30'12.96" S-80[grados]23'55.87" W), Tumbes, Peru. Los esteros que conforman este ecosistema poseen una salinidad de 33 ppt en marea alta, llegando a alcanzar una altura promedio de 1.20 m, con una fluctuacion entre la alta y baja marea de 6 horas. Se seleccionaron los ejemplares que presentaban un tamano [mayor que o igual a] 45 mm de longitud de valva para luego ser transportados al Centro Colectivo Educativo Experimental de Biologia y Biotecnologia Acuatica y Acuicola de Puerto Pizarro (CEBAP).

Aclimatacion y desafios experimentales: Se realizo un primer ensayo en agosto 2015. La parte ventral de la concha de los ejemplares seleccionados fue limada con la finalidad de que las branquias queden expuestas (Zhao, Yu, Kong, & Li, 2012). Posteriormente, todos ellos se aclimataron por 24 horas a 33 ppt de salinidad en agua de mar filtrada a 1[micron]m y tratada (AMFT) con 10 ppm de Ca[(ClO).sub.2] y neutralizada con 0.9 ppm de [Na.sub.2][S.sub.2][O.sub.2] Transcurrido este periodo, se formaron grupos de diez animales por triplicado y se colocaron en recipientes con 20 litros de agua de mar previamente mezclada con diferentes proporciones de agua dulce para obtener los diferentes grados de salinidad. Los individuos fueron directamente sometidos a condiciones de estres hipo-osmotico (extremo: 5 y 10 ppt); (moderado: 15 y 25 ppt) y sin estres (grupo control: 33 ppt). Las muestras fueron evaluadas por un periodo de 16 dias con 100 % de recambio de agua cada 48 h, o en caso de presentar mortalidad. Los animales fueron alimentados durante el tiempo del bioensayo con un mix de microalgas (Isocrisis sp. y Chaetoceros spp.) a una concentracion de 50 000 cel/mL de cada cepa, una vez al dia. Estas muestras sirvieron para las evaluaciones geneticas.

En enero 2016, se realizo una segunda prueba utilizando el mismo procedimiento antes mencionado para la evaluacion proteomica, con la diferencia de que los animales fueron expuestos solamente por periodos de 4, 8 y 12 horas, sin alimentacion.

Extraccion de ADN: Se uso 80 mg de tejido branquial macerado de A. tuberculosa, mediante el metodo de extraccion CTAB 2 % (Bromuro de hexadeciltrimetilamonio), complementado con proteinasa K (Gardes & Bruns, 1993). El ADN genomico se obtuvo con fenol, cloroformo y alcohol isoamil en proporcion (25:24:1 v/v). Se precipito con etanol frio al 95 %, y se realizo un lavado con etanol al 75 %. El ADN obtenido se resuspendio en 50 [micron]L de buffer TE Tris/EDTA (Tris 10 mM, EDTA 1 mM) y fue conservado a -20[grados]C.

Amplificacion por PCR de genes de referencia y genes de interes: La calidad del ADN genomico se evaluo por amplificacion del gen constitutivo mitocondrial COI con los iniciadores LCO (GGTCAACAAATCATAAAGATATTGG') y HCO (TAAACTTCAGGG TGACCAAA AAATCA). Los genes de interes evaluados para este estudio fueron: Aminomethyltransferase, Glycine dehydrogenase, Glycine hydroxymethyltransferase, [DELTA]-1-pyrroline-5-carboxylate synthase, Ornithine aminotransferase, Arginase, Alanine transaminase, Alanine-glyoxylate transaminase, Glutamate decarboxylase, Glutamate decarboxylase 1-2, Spermidine synthase, Aldehyde dehydrogenase, ATP-grasp domain-containing protein, Cysteine sulfinic acid decarboxylase1-2, Taurine transporter, HSP beta 1, Sodium- and chloride-dependent glycine transporter (Meng et al., 2013; Cross et al., 2014; Eierman & Hare, 2014).

El mix de PCR "Thermo Scientific DNA Polymerase" (Invitrogen) contenia 15 pmol por cada juego de iniciador en un volumen final de 25 [micron]L: Buffer de PCR (1X), [Cl.sub.2]Mg (1.5 mM), taq polimerasa (2 U) y dNTPs (0.2 mM). Se utilizo un termociclador (Biometra UNO thermoblock) con una programacion de 95[grados]C por 5 min para la desnaturalizacion inicial; 35 ciclos a 94[grados]C por 30 s; para la desnaturalizacion, 50 [grados]C por 45 s para la hibridacion y 72[grados]C por 45 s para la polimerizacion. Se uso como control positivo ADN extraido a partir de branquias de Crassostrea gigas.

Extraccion de proteinas a partir de tejido branquial: Fragmentos de la parte blanda de las branquias fueron extraidas a las 4, 8 y 12 horas de exposicion a partir de animales expuestos y aclimatados a salinidades de 0, 5, 15 y 25 ppt, y almacenadas en PMSF 0.1 mM (fluoruro de fenilmetilsulfonilo) a -20[grados]C. Para la extraccion de proteinas se utilizo el metodo PBS 1X (buffer fosfato salino), con 1 mM de PMSF, y se uso como agentes de precipitacion TCA (acido tricloroacetico) con acetona para luego ser resuspendido en 100 gL de buffer de rehidratacion (Agua grado HPLC/0.1 % TFA Acido trifluroacetico), almacenandolo a -20[grados]C.

Migracion en SDS page y visualizacion de bandas: Las proteinas purificadas fueron luego tratadas segun el protocolo descrito por Shevchenko, Henrik, Jan, Jesper y Matthias (2006). Brevemente, de la muestra anterior se tomo 25 [micron]L y se mezclo con 10 [micron]L de buffer de carga (1M de Tris pH 6.8, 10 % SDS, 10 % glicerol, 0.02 % azul de bromofenol, 0.71 M DTT y agua bidestilada) a 2x. Se llevo a migrar en gel SDS PAGE al 12 %. Las bandas de interes fueron extraidas y digeridas. Las muestras fueron hidratadas con agua grado HPLC con TCA y se les adiciono el mismo volumen de matriz CHCA, se homogenizo cuidadosamente y fue colocada en el spot de la OptiTOF[R] sample plate.

Analisis proteomico por espectrometria de masas: A traves de un espectrometro de masa MALDI TOF/TOF MS Analyzer 5800 (Applied Biosystems) en modo MS Linear High Mass Positive y MS Reflector Positive con un laser Nd:YAG de [lambda] a 335 nm, frecuencia 200 Hz. La placa Opti-Tof fue calibrada en un rango de 800-1 800 m/z utilizando una mezcla de calibrantes, los espectros se obtuvieron con 500 disparos con 3 200 U internas de intensidad de laser en un rango de 600-4 000 m/z. En modo TOF/TOF, los iones fueron acelerados a 8 kV y el analisis se realizo usando el programa 4000 Series Explorer version 3.5.3 (Applied Biosystem). Se uso los iones de autolisis de la tripsina 842,510 m/z y 2 211,105 m/z para calibracion interna del equipo.

RESULTADOS

Efecto de cambios de salinidad sobre A. tuberculosa: No se reporto mortalidades en los tratamientos con salinidades de 15 a 33 ppt durante el periodo evaluado. El primer ejemplar muerto aparecio al tercer dia a 5 ppt; luego, la disminucion de supervivencia fue progresiva, hasta que el ultimo animal murio a los 15 dias del ensayo. La mortalidad a 10 ppt inicio a los 12 dias, pero fue mas severa con la desaparicion del 90 % de los ejemplares a los cuatro dias. Se observo mortalidades en los adultos mantenidos a una salinidad de 20 ppt despues de 18 dias.

Desde un punto de vista de comportamiento, los animales expuestos a salinidades hipo-osmoticas extremas (5 y 10 ppt), cerraron las valvas y la filtracion del alimento fue minima. A partir del tercer dia presentaron una motilidad aletargada y dano en el tejido branquial, asi tambien, desangramiento parcial. Los animales expuestos a estres hipo-osmotico moderado 15 ppt y 25 ppt, asi como el control a 33 ppt, presentaron actividad frecuente (movilidad, alimentacion), y formacion de biso.

Amplificacion de genes osmoreguladores: En este estudio se evaluo la presencia de 19 genes asociados a la osmorregulacion en ostras y mejillones (Cuadro 1). De estos, se evidencio que 15 son enzimas claves del metabolismos de los FAAs (2 al 16), tres son transportadores de los principales FAAs (17 al 19), uno esta relacionado al mecanismo de estres (20), y se incluyo un control positivo que habia sido utilizado en estudios anteriores sobre A. tuberculosa (1).

De todos los genes evaluados, el gen COI fue el unico en ser amplificado mediante PCR en A. tuberculosa, lo que valida la calidad de la extraccion de ADN para este molusco. Luego, 18 de los 20 genes fueron exitosamente amplificados para la muestra de C. gigas, incluyendo el gen COI, lo que valido tambien los protocolos de amplificacion de la mayoria de los genes, pero [DELTA]-1-pyrroline-5-carboxylate synthase y Glycine hydroxymethyltransferase fueron los unicos que no amplificaron.

Estos resultados evidencian diferencias, al menos a nivel genomico, de los genes involucrados en la osmorregulacion de A. tuberculosa con C. gigas.

Identificacion de secuencias peptidicas: De los individuos expuestos a salinidades de 0, 5, 15 y 25 ppt durante la segunda evaluacion, se extrajo proteinas a partir de las branquias. Se obtuvo un total 26 secuencias, de las cuales 10 se expresaron unicamente en los individuos mantenidos a 0 y 5 ppt (diferencial), y 16 expresadas en todos los grupos (presencial) (Cuadro 2). De todas estas, se encontro que dos estan relacionadas al mecanismo de osmorregulacion en invertebrados marinos. La primera secuencia corresponde a un fragmento de una heat shock protein de 70 Kda (HSP70), que se encontro de manera presencial en todas las muestras a diferentes salinidades, cualitativamente la HSP70 presento una mayor expresion a 0 y 5 ppt, cuando se comparaba las intensidades de las bandas extraidas del gel de SDS Page. Por su parte, la segunda corresponde a una secuencia de seis peptidos, que pertenecen a canales de cloro (chloride channel protein), que aparece como un candidato valido del mecanismo de osmoregulacion para la concha negra A. tuberculosa.

DISCUSION

La comprension de los mecanismos por los cuales los organismos pueden adaptarse a los desafios ambientales y los factores que limitan sus capacidades de distribucion, han sido durante mucho tiempo la interrogante de la biologia. La supervivencia de los organismos marinos requerira la aclimatacion y adaptacion a estas variantes ambientales. En el ecosistema manglar de Tumbes, donde habita el bivalvo A. tuberculosa existen eventos de descensos bruscos de salinidad, que suelen acontecer principalmente durante el verano con la entrada de agua dulce. En estas zonas de encuentro, la salinidad puede disminuir drasticamente en un lapso de unas horas y hasta ser completamente dulce durante las mareas bajas (Nieves et al., 2009).

El presente trabajo complementa los resultados obtenidos por Nieves et al. (2009), quienes evaluaron por 15 dias al bivalvo A. tuberculosa, y monstraron crecimiento en adultos mantenidos entre 20 a 50 ppt de salinidad a distintas temperaturas, concluyendo que las salinidades altas (40 a 50 ppt) perjudican el crecimiento, y que las condiciones optimas de cultivo son 20 ppt y 32[grados]C. Sin embargo, al finalizar estos experimentos, los individuos que se mantuvieron a salinidades de 20 ppt mostraron mortalidades despues de 18 dias (resultados no mostrados). Por otro lado, los resultados de Diringer et al. (2012) quienes evaluaron la supervivencia de semillas de A. tuberculosa producidas en laboratorio y mantenidas de 45 a 0 ppt por 20 dias, demostraron que la supervivencia fue severamente afectada a salinidades inferiores o igual a 20 ppt (100 % de mortalidad entre 2 a 11 dias) y moderadamente afectadas a salinidad de 45 ppt (20 % de mortalidad a los 18 dias). En conjunto, estos resultados demuestran que A. tuberculosa es una especie eurihalina. Se sugiere que la supervivencia a salinidades inferiores o iguales a 20 ppt esta relacionada a la capacidad del bivalvo a reajustar su volumen celular a traves de la excrecion de FAAs, que y que depende de las reservas energeticas inicial de cada individuo, tal como lo menciona Gosling (2015). Esta hipotesis se ajusta a los resultados obtenidos con semillas de A. tuberculosa que poseen menos reservas o que poseen un desgaste mas acelerado que un adulto.

Estudios previos han demostrado que los FAAs intracelulares son los principales contribuyentes a la regulacion de la osmolaridad intracelular y del volumen celular en bivalvos (Gosling, 2015). En este trabajo se diseno 18 marcadores moleculares asociados al sistema de regulacion por FAAs, y uno a partir de la proteina de estres (HSP70), usando las secuencias disponibles publicadas de cuatro bivalvos modelos: las ostras C. gigas, C. angulata, C. virginica y el mejillon M. galloprovincialis (Meng et al., 2013; Cross et al., 2014; Eierman & Hare, 2014).

La utilizacion de dos controles positivos (COI para bivalvos y ADN de ostras) permitio confirmar que la ausencia de amplificacion de los genes evaluados se debe o a diferencias geneticas en las regiones conservadas evaluadas, o a la ausencia de estos genes en A. tuberculosa. La primera hipotesis aparece como la mas probable debido al predominio del sistema de osmorregulacion mediante la utilizacion de FAAs en bivalvos y gasteropodos marinos; asi como, porque importantes diferencias a nivel genetico, en particular en los genes asociados a mecanismos de respuestas a estres abioticos, se encontraron entre las secuencias nucleotidicas de C. angulata y C. virginica con C. gigas (Cross et al., 2014; Eierman & Hare, 2014).

Existen diferentes alternativas para a futuro identificar a nivel nucleotidico los genes especificos involucrados en la osmoregulacion en A. tuberculosa. Los trabajos realizados a nivel genomico o transcriptomico por Cross et al. (2014), o Meng et al. (2013) y Eierman y Hare (2014) en ostras, abrieron el camino para la identificacion de marcadores geneticos especificos de bivalvos, mediante la aplicacion de herramientas de Next Generation Sequencing (NGS) y podrian ser aplicados a A. tuberculosa. Es importante resaltar un estudio realizado por Barman et al. (2012) en el camaron Macrobrachium rosenbergii, que evaluo la expresion de ARNm del crustaceo expuesto a diferentes salinidades, por transcriptomica diferencial, mediante la tecnica de Hibridacion Substractiva y Supresiva (SSH), que permite resaltar a los transcriptos mas discretos.

Como alternativa al trabajo genetico, se exploro el proteoma diferencial de A. tuberculosa sometida a diferentes salinidades, lograndose identificar a 16 proteinas "presenciales" y 10 proteinas expresadas de forma diferenciales (38.5 %) al control, mediante separacion por electroforesis SDS PAGE 1D. El unico trabajo similar realizado en bivalvos fue presentado por Tomanek, Zuzow, Hitt, Serafini, y Valenzuela Tomanek, (2012) que compararon la respuesta al estres hipo-osmotico en dos especies de mejillon. A pesar de que este equipo obtuvo mas proteinas aisladas gracias a un sistema de separacion SDS PAGE 2D, la proporcion de proteinas diferenciales fue de 29 % para M. galloprovincialis y 39 % para M. trossulus, lo que esta dentro del rango del presente estudio.

La familia de HSP es comunmente encontrada en moluscos sometidos a estres abioticos y ha sido reiteradamente propuesta como biomarcador (Gracey et al., 2008; Yang et al., 2014; Patterson, Boettcher, & Carmichael, 2014; Liu, He, Chi, & Lv, 2015; Shiel, Hall, Cooke, Robinson, & Strugnell, 2015). En este trabajo se intento sin exito amplificar por PCR una region conservada de esta chaperona, mientras que esta proteina pudo ser detectada mediante proteomica, esto se debe al caracter muy variable de HSP70 que presenta mucha variabilidad intra e inter especifica, tal como lo menciona Yang et al. (2014).

El canal a cloro encontrado en A. tuberculosa, presento grandes similitudes con una proteina de C. gigas (chloride channel protein 2-like isoform X2) sometida a condiciones de estres de salinidad (Damiens et al., 2006). Estos canales cumplen una variedad de importantes roles celulares y fisiologicos entre los que se encuentran la regulacion del pH, regulacion del volumen en la homeostasis, transporte de solutos organicos, migracion celular y diferenciacion por lo que parece como un candidato valido del mecanismo de osmoregulacion para A. tuberculosa.

La no amplificacion de los genes evaluados por PCR revela diferencias geneticas entre A. tuberculosa y los bivalvos previamente estudiados (C. gigas, C. angulata, O. edulis y M. galloprovincialis), sin poder determinar si estas corresponden a diferencias nucleotidicas de las regiones conservadas, o por la ausencia de estos genes en A. tuberculosa.

Las secuencias aminoacidicas obtenidas por espectrometria de masas identificaron HSP 70, canal de cloro, y al piruvato kinasa como posibles biomarcadores del sistema de osmorregulacion en A. tuberculosa, y permitiran disenar iniciadores especificos para la puesta en marcha de futuros programas de mejoramiento genetico de este importante recurso.

AGRADECIMIENTOS

El presente estudio fue posible gracias al aporte de financiamientos por parte de la Universidad Nacional de Tumbes a traves del proyecto CANON Resolucion No. 00723-2014/UNT-R., K.P y VC. recibieron una beca de CONCYTEC (CONVENIO DE GESTION No. 015-2013- FONDECYT, y R.P.No. 206-2013-CONCYTEC-P.), y B.D de la Escuela Doctoral Franco-Peruana en Ciencias de la Vida.

REFERENCIAS

Artigaud, S., Lacroix, C., Richard, J., Flye-Sainte-Marie, J., Bargelloni, L., & Pichereau, V. (2015). Proteomic responses to hypoxia at different temperatures in the great scallop (Pecten maximus). PeerJ, 3, e871. doi: 10.7717/peerj.871

Barman, H. K., Patra, S. K., Das, V., Mohapatra, S. D., Jayasankar, P., Mohapatra, Ch., Mohanta, R., Panda, R. P, & Rath. S. N. (2012). Identification and Characterization of Differentially Expressed Transcripts in the Gills of Freshwater Prawn (Macrobrachium rosenbergii) under Salt Stress. The Scientific World Journal, doi:10.1100/2012/ 149361

Cruz, R., Fonseca, R. & Chavarria-Solera, F. (2012). Comparacion de la composicion quimica proximal de la carne de A. tuberculosa y A. similis (Bivalvia: Arcidae) de Chomes, Puntarenas, Costa Rica. Revista de Ciencias Marinas y Costeras, 4, 95-103. Recuperado de http://wwwrevistas.una.ac.cr/index.php/revmar/ article/view/4801

Cross, I., Merlo, M., Rodriguez, M. E., Portela-Bens, S., & Rebordinos, L. (2014). Adaptation to abiotic stress in the oyster Crassostrea angulata relays on genetic polymorphisms. Fish Shellfish Immunology, 41(2), 618-24. doi: 10.1016/j.fsi.2014.10.011

Damiens, G., Mouneyrac, C., Quiniou, F., His, E., Gnassia-Barelli, M., & Romeo, M. (2006). Metal bioaccumulation and metallothionein concentrations in larvae of Crassostrea gigas. Environmental Pollution, 140(3), 492-9, doi: 10.1016/j.envpol.2005.08.006

Diringer, B., Vasquez, R., Moreno, V., Pretell, K., & Sahuquet, M. (2012). Peru Project Studies Blood cockles for stock enhancement, Aquaculture. Global Aquaculture Advocate, Ju-Agt, 48-50. Recuperado de http://pdf.gaalliance.org/pdf/GAA-DiringerJuly12.pdf.

Eierman, L. E., & Hare, P M. (2014). Transcriptomic analysis of candidate osmoregulatory genes in the eastern oyster Crassostrea virginica. Bio Med Central Genomics, 15, 503, doi: 10.1186/1471-2164-15-503

Espinosa, S. G., Delgado, M. H., Orobio, B. R., Mejia-Ladino, L. & Gil-Agudelo, D. (2010). Estado de la poblacion y valoracion de algunas estrategias de conservacion del recurso piangua Anadara tuberculosa (Sowerby) en sectores de Bazan y Nerete, costa pacifica narinense de Colombia. Boletin Investigacion Marina Costera, 39(1), 161-176. Recuperado de http://wwwscielo.org.co/pdf/mar/v39n1/ v39n1a09.pdf

Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes--applications to the identification of mycorrhizae and rusts. Molecular Ecology, 2, 113-118. Recuperado de https://nature.berkeley.edu/brunslab/papers/ gardes1993.pdf

Gosling, E. (2015). Marine Bivalve Molluscs (2nd ed). Oxford, U.K.: Editorial offices.

Gracey, Y, Chaney, M. L., Boomhower, J. P, Tyburczy, W. R., Connor, K., & Somero, G. N. (2008). Rhythms of Gene Expression in a Fluctuating Intertidal Environment. Current Biology, 18, 1501-1507, doi:10.1016/j. cub.2008.08.049

Liu, H., He, J., Chi, C., & Lv, Z. (2015). Identification and analysis of HSP70 from Sepiella maindroni under stress of Vibrio harveyi and Cd2+. Epub 1, 572(1), 146-52. Recuperado de http://dx.doi.org.sci-hub. bz/10.1016/j.gene.2015.07.056

Lucero, C., Cantera, J., & Neira, R. (2012). Pesqueria y crecimiento de la piangua (Arcoida: Arcidae) Anadara tuberculosa en la Bahia de Malaga del Pacifico colombiano, 2005-2007. Revista Biologia Tropical, 60(1), 203-217.

Mendoza, O. & Peralta, T. (2004). Primeros ensayos sobre reproduccion inducida y obtencion de semillas de Anadara tuberculosa (Sowerby, 1833) en laboratorio. Revista Manglar, 2(1), 87-94.

Meng, J., Zhu, Q., Zhang, L., Li, Ch., Li, L., She, Z., Huang, B., & Zhang, G. (2013). Genome and Transcriptome Analyses Provide Insight into the Euryhaline Adaptation Mechanism of Crassostrea gigas. PLoS One, 8(3), e58563, doi: 10.1371/journal. pone.0058563

Nieves, M., Roman, J. C., Pina, P, Medina, A., Leal, S., Miranda, A., & Munoz, G. (2009). Balance energetico de Anadara tuberculosa (SOWERBY, 1833) a diferentes temperaturas. Revista de Investigaciones Marinas, 30, 135-144. Recuperado de http://www rim.uh.cu/index.php/IM/article/viewFile/131/130

Ordinola, E., Montero, P., Aleman, S., & Llanos, J. (2007). Prospeccion del recurso concha negra (Anadara tuberculosa) en los manglares de Tumbes. Tumbes: IMARPE.

Patterson, K., Boettcher, A., & Carmichael, R. (2014). Biomarkers of dissolved oxygen stress in oysters: a tool for restoration and management efforts. PLoS One, 12, 9, e104440. doi: 10.1371/journal.pone.0104440

Rocher, B., Bultelle, F., Chan, Ph., Le Foll, F., Letendre, J., Monsinjon, T., Olivier, S., ..., & Knigge, T. (2015). 2-DE Mapping of the Blue Mussel Gill Proteome: The Usual Suspects Revisited. Proteomes, 3(1), 3-41, doi: 10.3390/proteomes3010003

Shevchenko, A., Henrik, T., Jan, H., Jesper, V., & Matthias, M. (2006). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols, 6(1), 2856-2860. doi: 10.1038/ nprot.2006.468

Shiel, B., Hall, N., Cooke, I., Robinson, N., & Strugnell, J. (2015). De novo characterisation of the greenlip abalone transcriptome (Haliotis laevigata) with a focus on the heat shock protein 70 (HSP70) family. Marine Biotecnology (NY), 17(1), 23-32. doi: 10.1007/ s10126-014-9591-y

Tomanek, L., Zuzow, M. J., Hitt, L., Serafini, L., & Valenzuela, J. J. (2012). Proteomics of hyposaline stress in blue mussel congeners (genus Mytilus): implications for biogeographic range limits in response to climate change. The Journal of Experimental Biology, 215, 3905-3916. doi:10.1242/jeb.076448

Yang, C., Wang, L., Wang, J., Jiang, Q., Qiu, L., Zhang, H., & Song, L. (2014). The polymorphism in the promoter of HSP70 gene is associated with heat tolerance of two congener endemic bay scallops (Argopecten irradians irradians and A. i. concentricus). PLoS One, 9(7), e102332. Recuperado de https://www ncbi.nlm.nih.gov/pmc/articles/PMC4100766/pdf/ pone.0102332.pdf

Zhao, X., Yu, H., Kong, L., & Li, Q. (2012). Transcriptomic responses to salinity stress in the pacific oyster Crassostrea gigas. PLoS One, 7(9), e46244, doi: 10.1371/journal.pone.0046244

Oscar Mendoza (1), Krizia Pretell (1), Benoit Diringer (2,4), Ricardo Avellan (3), Karina Zapata (2), Angelita Marchan (1), Virna Cedeno (1,3), Tessy Peralta (1), Alberto Ordinola (1) & Eric Mialhe (2,3)

(1.) Facultad de Ingenieria Pesquera y Ciencias del Mar, Universidad Nacional de Tumbes, Peru; omendozan@untumbes.edu.pe, krizmar_5@hotmail.com, tauro_27_193@hotmail.com, tesymar765@gmail.com, alordin@gmail.com, karinazapatavidaurre@gmail.com

(2.) Inca Biotec SAC, Peru; diringerb@yahoo.fr, ericmialhe@yahoo.fr

(3.) Concepto Azul AS, Ecuador; ravellan21@yahoo.com,virna.cedenoescobar@gmail.com

(4.) EPHE, Pathologie Comparee des Invertebres, Montpellier (France).

Recibido 27-VIII-2016. Corregido 27-IV-2017. Aceptado 31-V-2017.
CUADRO 1
Resultados de las amplificaciones de genes que intervienen en la
sintesis de aminoacidos libres obtenidos por PCR en este estudio

TABLE 1
Amplification results of genes involved in the synthesis of free
amino acids obtained by PCR in this study

                                                          Especie

No.   Gen evaluado                                     A. tuberculosa

1     Cytochrome c oxidase subunit I (COI)                Positivo
2     Aminomethyltransferase                              Negativo
3     Glycine dehydrogenase                               Negativo
4     Glycine hydroxymethyltransferase                    Negativo
5     [DELTA]-1-pyrroline-5-carboxylate synthase          Negativo
6     [DELTA] A 1 -pyrroline-5-carboxylate reductase      Negativo
7     Ornithine aminotransferase                          Negativo
8     Arginase                                            Negativo
9     Alanine transaminase                                Negativo
10    Alanine-glyoxylate transaminase 2                   Negativo
11    Glutamate decarboxylase                             Negativo
12    Glutamate decarboxylase                             Negativo
13    Spermidine synthase                                 Negativo
14    Aldehyde dehydrogenase                              Negativo
15    Cysteine sulfinic acid decarboxylase                Negativo
16    Cysteine sulfinic acid decarboxylase                Negativo
17    Taurine transporter                                 Negativo
18    Sodium- and chloride-dependent glycine              Negativo
        transporter
19    ATP-grasp domain-containing protein                 Negativo
20    HSP beta                                            Negativo

                                                       Especie

No.   Gen evaluado                                     C. gigas

1     Cytochrome c oxidase subunit I (COI)             Positivo
2     Aminomethyltransferase                           Positivo
3     Glycine dehydrogenase                            Positivo
4     Glycine hydroxymethyltransferase                 Negativo
5     [DELTA]-1-pyrroline-5-carboxylate synthase       Negativo
6     [DELTA] A 1 -pyrroline-5-carboxylate reductase   Positivo
7     Ornithine aminotransferase                       Positivo
8     Arginase                                         Positivo
9     Alanine transaminase                             Positivo
10    Alanine-glyoxylate transaminase 2                Positivo
11    Glutamate decarboxylase                          Positivo
12    Glutamate decarboxylase                          Positivo
13    Spermidine synthase                              Positivo
14    Aldehyde dehydrogenase                           Positivo
15    Cysteine sulfinic acid decarboxylase             Positivo
16    Cysteine sulfinic acid decarboxylase             Positivo
17    Taurine transporter                              Positivo
18    Sodium- and chloride-dependent glycine           Positivo
        transporter
19    ATP-grasp domain-containing protein              Positivo
20    HSP beta                                         Positivo

CUADRO 2
Peptidos biomarcadores putativos del sistema de osmorregulacion de A.
tuberculosa sometida a diferentes condiciones de estres identificados
en la presente investigacion

TABLE 2

Peptides putative biomarkers of the osmoregulation system of A.
tuberculosa under various stress conditions identified in this
research

Secuencia      Proteina putativa           Funcion             Tipo

VSITSK        actin-binding          Proteinas              Presencial
              protein anillin-       involucradas en la
              like isoform X4        localizacion del
                                     nucleo durante la
                                     interfase y la
                                     cytokinesis.

DPVLFNR       cytochrome c oxidase   Enzima clave en el     Presencial
              subunit I              metabolismo
                                     aerobico.
                                     Involucrado en la
                                     respu-esta a metales
                                     pesados en moluscos.

WLTSK         sn1-specific           Involucrado en         Presencial
              diacylglycerol         sistema nervioso.
              lipase beta-like       Cataliza la
              isoform X1             hidrolisis de
                                     diacilglic-erol
                                     (DAG) a 2-
                                     araquidonoil-
                                     glicerol (2-AG), el
                                     endocannabinoide mas
                                     abundante en los
                                     tejidos.

GHLCR         secretin receptor-     La familia del         Diferencial
              like                   receptor a secretina   0 y 5 ppt
                                     activa las vias de
                                     adenilato ciclasa y
                                     de fosfatidil-
                                     inositol-calcio.

WVDSK         Beta-1,3-glucan-       Proteina de            Diferencial
              binding protein        reconocimiento de      0 y 5 ppt
                                     lipopolysaccharides
                                     y p-1, 3-glucan, que
                                     active la cascada
                                     proPO cascade en
                                     artropodos, juega un
                                     papel esencial en
                                     respuesta inmune.

TTLTSK        integumentary mucin    Precursor de           Diferencial
              C.1-like               proteinas secretadas   0 y 5 ppt
                                     (mucus) en ranas.

LPPCR         General                Implicado en la        Presencial
              transcription factor   transcripcion
              3C polypeptide 5       mediada por la ARN
                                     polimerasa 3.
                                     Componente,
                                     fuertemente asociado
                                     a la proteina TFIIIC
                                     2 que se une
                                     directamente ARNt y
                                     a promotores
                                     asociados a virus de
                                     ARN.

NPIDFVR       deoxynucleoside        Nucleasa de            Presencial
              triphosphate           restriccion que
              triphosphohydrolase    bloquea la
              SAMHD1-like            replicacion de virus
                                     en etapa temprana en

                                     dendritos y otras
                                     celulas mieloides.
                                     Del mismo modo,
                                     suprima a
                                     retrotransposones.
                                     Podria actuar en la
                                     mediacion de
                                     respuestas
                                     proinflamatorias.

VLKKPKFDFR    40S ribosomal          Componente de la       Presencial
              protein S3a            subunidad del
                                     pequeno ribosoma.

QTSKKMR       tRNA (uracil-5-)-      Metiltransferasa del   Presencial
              methyltransferase-     ARNt.
              like protein A

CFTSK         Synaptobrevin,         Pertenece a las        Diferencial
              partial                proteinas SNARE que    0 y 5 ppt
                                     son componentes
                                     clave de la fusion
                                     de las membranas en
                                     la exocitosis. Su
                                     funcion, sin embargo
                                     esta sujeto a un
                                     ajuste efectuado por
                                     varias proteinas
                                     reguladoras que se
                                     refiere
                                     colectivamente como
                                     maestros SNARE.

VVVVSK        cytochrome b-245       En la mitocondria de   Presencial
              heavy chain-like,      eucariotas y en
              partial                procariotas
                                     aerobicos, el cito-
                                     cromo b es un
                                     componente del
                                     complejo de la
                                     cadena respiratoria
                                     II. Estos complejos
                                     estan involucrados
                                     en el transporte de
                                     electrones y el
                                     bombeo de protones.

GELTSK        chloride channel       Proteina del canal     Presencial
              protein 2-like         de cloruro que
              isoform X2             regulan el volumen
                                     celular; el
                                     potencial de
                                     membrana, la
                                     transduccion de
                                     senales y el
                                     transporte trans
                                     epitelial.

EITSK         adenosylmethionine     Cataliza la            Presencial
              synthase isoform       formacion de S-
              type-2-like isoform    adenosilmetionina a
              X3                     partir de metionina
                                     y ATP.

GQITSK        glycine N-             Aciltransferasa que    Presencial
              acyltransferase-       transfiere un grupo
              like [Crassostrea      acilo a la N-
              gigas]                 terminal de la
                                     glutamina. Puede
                                     utilizar
                                     fenilacetil-CoA como
                                     donador de acilo.
                                     Identificada del
                                     genoma de ostra C.
                                     gigas.

HGITSK        EF-hand calcium-       El motivo de mano EF   Diferencial
              binding domain-        es el motivo de        0 y 5 ppt
              containing protein     union al calcio mas
              6-like isoform X3      comun encontrado en
              [Crassostrea gigas]    las proteinas, esta
                                     probablemente
                                     involucrada en la
                                     relajacion muscular
                                     a traves de su
                                     actividad de union a
                                     calcio.

DADVSK        trichohyalin-like      Tricohialina           Diferencial
                                     confiere resistencia   0 y 5 ppt
                                     mecanica al foliculo
                                     del pelo y a otros
                                     tejidos epiteliales.
                                     Esta involucrado en
                                     los velos
                                     sensoriales de
                                     moluscos.

ETVFDLR       multidrug              Bomba de               Diferencial
              resistance-            desintoxicacion        0 y 5 ppt
              associated protein     celular. Reportada
              4-like                 para eliminacion de
                                     toxinas en moluscos
                                     depredadores.

ELTSK         Tripartite motif-      Probablemente          Diferencial
              containing protein 3   implicados en el       0 y 5 ppt
                                     trafico vesicular a
                                     traves de su
                                     asociacion con el
                                     complejo de CART.
                                     Identificada del
                                     genoma de ostra C.
                                     gigas.

GIGCEWR       Krueppel-like factor   La familia Kruppel-    Presencial
              5                      como de factores de
                                     transcripcion (FCE)
                                     son un conjunto de
                                     proteinas de union
                                     al ADN de dedos de
                                     zinc que regulan la
                                     expresion genica.

LEGTNT        heat shock 70 kDa      Proteinas de choque    Presencial
              protein 12A-like       termico (HSP) son
                                     una familia de
                                     proteinas chaperonas
                                     que son producidas
                                     por las celulas en
                                     respuesta a la
                                     exposicion a
                                     condiciones de
                                     estres y durante la
                                     curacion de heridas
                                     o la remodelacion
                                     tisular. Varias son
                                     descriptas en
                                     bivalvos.

EGLTSK        Uncharacterized        Funcion desconocida.   Presencial
              protein C7orf58

AMVDTN        Rotatin                Grande proteina de     Diferencial
                                     funcion desconocida.   0 y 5 ppt

LVAVRDVPRPR   gelsolin-like          La gelsolina es una    Presencial
              protein, partial       proteina de union a
                                     actina que es un
                                     regulador clave del
                                     asambleamiento y
                                     desasambleamiento de
                                     filamentos de
                                     actina. Gelsolin se
                                     encuentra
                                     intracelularmente
                                     (en citosol y mito-
                                     condrias) y
                                     extracelularmente
                                     (en el plasma
                                     sanguineo).

VSLTSK        pyruvate kinase        Esta enzima esta       Diferencial
                                     implicada en la        0 y 5 ppt
                                     ultima etapa de la
                                     glucolisis para
                                     catalizar la
                                     fosforilacion de una
                                     molecula de ADP en
                                     ATP.

HGLCR         Serine/                Este gen codifica      Presencial
              threonine-protein      una de serina
              kinase SRPK1           arginina quinasa. La
                                     proteina se localiza
                                     en el nucleo y el
                                     citoplasma. Se cree
                                     que desempenan un
                                     papel en la
                                     regulacion del
                                     episaje constitutivo
                                     y alternativo.
COPYRIGHT 2017 Universidad de Costa Rica
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Mendoza, Oscar; Pretell, Krizia; Diringer, Benoit; Avellan, Ricardo; Zapata, Karina; Marchan, Angeli
Publication:Revista de Biologia Tropical
Date:Sep 1, 2017
Words:5734
Previous Article:Grupos funcionales de fitoplancton en una represa tropical de una region semiarida de Brazil.
Next Article:Fuerte efecto negativo de las lluvias diurnas sobre la actividad nocturna de una arana errante en la Amazonia Central.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |