Printer Friendly

Resistance of Strains Producing Extended-Spectrum b-lactamases and Genotype Distribution Among Escherichia coli in China.

Byline: Yuan Xue, Jianfei Chen and Yuping Hua

Abstract

Extended-spectrum b-lactamases (ESBLs) are an increasing cause of resistance to third-generation cephalosporins in Enterobacteriaceae. In order to investigate the resistance of Escherichia coli (E. coli) strains producing ESBLs and the genotyping of ESBLs from swine in Heilongjiang province in China, 220 E. coli strains were isolated consecutively from health swine herds during May to November 2010. Results of antimicrobial susceptibility test showed that most of the isolates were highly susceptible to polymyxin B and aztreonam, but high resistant incidence rates were exhibited to ampicillin. The incidence of ESBL-producing strains was 36.37% among Escherichia coli (80/220). The genotypes of ESBLs were analyzed by polymerase chain reaction (PCR), DNA sequencing. PCR and sequence analysis showed that eighty strains produced four type of ESBLs, including CTX-M (27 strains), TEM (36 strains), SHV (2 strains), OXA (2 strains).

The resistance of E. coli strains producing ESBLs in Heilongjiang Province was a serious issue, and TEM and CTX-M type ESBLs were the most common genotypes. Some ESBLs-producing Escherichia coli strains produced more than one type of b-lactamases. These data confirm that ESBL producers are common among nursery strains of Escherichia coli in Heilongjiang Province in China. It is important to monitor such strains closely and prevent their spread.

Keywords: b-Lactamases, genotype, Escherichia coli, antimicrobial resistance.

INTRODUCTION

Extended-spectrum b-lactamases (ESBLs) represent an important mechanism of resistance in Enterobacteriaceae. ESBLs capable of degrading the extended-spectrum cephalosporins and monobactams are among the most relevant determinants of resistance emerging worldwide in the Enterobacteriaceae. Because ESBL-generating strains often exhibit multidrug resistance, including resistance to aminoglycosides and fluoroquinolones, the therapeutic options associated with these strains are fairly limited. ESBLs are detected most commonly in Klebsiellae pneumoniae and Escherichia coli. Escherichia coli is an important pathogen of humans and animals and is common in their intestinal tracts.

Since the discovery of ESBLs in 1983 (Kliebe et al., 1985), their prevalence has been reported in many countries. In recent years, the prevalence of ESBLs-producing Escherichia coli is increasing, and the resistance becomes more and more serious. Until the late 1990s, ESBLs were described mainly as members of the TEM or SHV b-lactamase families in Klebsiella and Enterobacter spp (Yoo et al., 2010). Since antibiotic prescription pattern varies in different regions, the prevalent genotype of ESBLs is variable (Yu et al., 2007). But there are few such reports from swine in China. With this consideration, we investigated the resistance and probable gene type of ESBLs in 220 E. coli isolates collected from swine in Heilongjiang province in China.

MATERIALS AND METHODS

Bacterial isolates

During May and November 2010, 220 E. coli strains were isolated consecutively from health swine in Heilongjiang Province of China. The production of ESBLs in the clinical isolates of E.coli was studied by the CLSI diffusion method (CLSI, 2006), as reference test. E. coli ATCC25922 was used as reference strains. These strains were stored at -80degC until analysis.

ESBL-producing strains testing

The disk diffusion method was used on Mueller-Hinton agar plates inoculated with isolates in a 0.5 McFarland bacterial suspension. ESBL- producing strains were detected by the double-disk synergy test performed as a standardized disk diffusion assay in which an amoxicillin-clavulanic acid disk was placed at the centre of a plate and ceftazidime, cefotaxime,ceftriaxone and aztreonam disks, 25 mm away (centre to centre) from the amoxicillin-clavulanic acid disk.

Their presence was confirmed by the demonstration of synergy between cephalosporin with reduced inhibition zone and clavulanic acid (Synergy was defined when the inhibition zone of the disk of cephalosporin plus clavulanic acid was [greater than or equal to]5 mm greater than that of the disk of cephalosporin alone) by the Clinical and Laboratory Standards Institute (CLSI, 2006). Quality control was performed using E. coli ATCC25922.

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed using the disk diffusion method on Mueller-Hinton agar. The following antimicrobials were tested: ampicillin, amoxicillin/clavulanic acid, cefalotin, aztreonam, gentamicin, kanamycin, apramycin, neomycin, ciprofloxacin, norfloxacin, enrofloxacinbase, doxycycline, chloramphenicol, florfenicol, polymyxin B, trimesulf, tetracycline.

Molecular characterization of b-lactamase determinants

Detection of genes encoding ESBLs was performed by PCR amplification with the primers listed in Table I. PCR was performed under the following conditions: 94degC for 5 min, 30 cycles of 94degC for 30 s, 56degC for 20s, and 72degC for 40 s followed by 72degC for 7min.

DNA sequencing and data analysis

PCR products were excised from 1.0% agarose gels and purified using AxyPrepTM DNA Gel Extraction Kit (Axygen Scientific, inc., USA) and then cloned into a T-tailed vector, pMD18-T and transformed using JM109 competent cells (TaKaRa, Dalian, China). Three recombinant DNA clones of each product were sequenced by Beijing Genomics Institute (China). The nucleotide sequences were edited, analyzed with EditSeq software (version 7.1.0, DNASTAR Inc., USA) and the program NCBI-BLAST (www.ncbi.nlm.nih.gov).

Table I.- Sequences of primers for PCR used in this study

Primers###Primer sequence (5'- 3')###Size###Ref.

###(bp)

TEM-F###GTATCCGCTCATGAGACAATA###717###This study

TEM-R###AGAAGTGGTCCTGCAACTTT

SHV-F###TCTCCCTGTTAGCCACCCTG###593###This study

SHV-R###CCACTGCAGCAGCTGCCGTT

CTX-M-F###GGGCTGAGATGGTGACAAAGAG###905###This study

CTX-M-R###CGTGCGAGTTCGATTTATTCAAC

OXA-F###GCAGCGCCAGTGCATCAAC###198###Thi Thu

###Hao et al.

###(2008)

OXA-R CCGCATCAAATGCCATAAGTG

Nucleotide sequence accession numbers

The nucleotide sequence data in this paper have been submitted to the GenBank nucleotide sequence database. The accession numbers are as follows. CTX-M-14: HZ17 (HQ162125), HZ22 (HQ162126), JZ9 (HQ162127), JZ28 (HQ162128). TEM-2: MZ28 (HQ162129), HZ54 (HQ162130), JZ37 (HQ162131). SHV-7: JZ14 (HQ162132), JZ16 (HQ162133). OXA-1: JZ13 (HQ162134), HZ29 (HQ162135).

RESULTS

Antimicrobial resistance rates

Antimicrobial susceptibility results of 80 ESBL-producing E. coli strains isolated from swine to 17 antimicrobial agents are shown in Table II and Table III. Most of the isolates were highly susceptible to polymyxin B (91.25%), apramycin (88.25%), aztreonam (86.25%). But high resistant incidence rates were exhibited to ampicillin (90.5%). Such higher resistance rates in the ESBL- producing isolates were also observed in each species.

Genotyping of ESBLs

In this study, we identified 4 different types of ESBL genes detected: 36 TEMs, 27 CTX-Ms, 2 SHVs and 2OXAs.TEM was the main type of b- lactamase among ESBL producing E. coli followed by CTX-M of ESBLs. Some ESBL-producing E. coli produced more than one type of b-lactamase (Such as TEM+CTX-M type) in Table IV.

Table II.- In vitro susceptibilities of 80 E. coli strains isolated from health swine herds to 17 antimicrobial agents

Antimicrobial agents###No. of resistant strains (%)

###R###I###S

Ampicillin###90.50###2.50###7.00

Amoxicillin/clavulanic acid###70.50###7.00###22.50

Cefalotin###51.25###7.50###41.25

Aztreonam###12.50###1.25###86.25

Gentamicin###32.50###2.50###65.00

Kanamycin###20.00###2.50###77.50

Apramycin###8.25###3.50###88.25

Neomycin###38.75###3.75###57.50

Norfloxacin###32.50###6.25###61.25

Ciprofloxacin###38.75###5.25###56.00

Enrofloxacin base###36.25###8.75###55.00

Tetracycline###56.25###3.75###40.00

Doxycycline###68.75###1.25###30.00

Chloramphenicol###18.75###5.00###76.25

Florfenicol###22.25###7.50###70.25

Trimesulf###78.75###5.00###16.25

Polymyxin B###3.75###5.00###91.25

R, resistant; I, intermediate ; S, susceptible.

Table III.- Antibiotic resistance patterns of 80 E. coli strains.

Resistant patterns###No. of drug

###resistant strains

AMC-AMP-DOX###3

AMC-AMP-TET-DOX###4

AMP-DOX-CEF-FFC-PB###5

AMP-TET-CEF-SXT-APR-KAN###6

AMC-AMP-DOX-TET-CEF-SXT###6

AMC-ATM-DOX-TET-KAN-SXT-NE###7

AMP-NOR-DOX-CIP-TET-KAN-SXT-EN###8

AMC-AMP-NOR-CH-TET-KAN-SXT-###9

FFC-PB

AMP-AMC-DOX-CIP-TET-KAN-SXT-###9

CEF-NOR

AMC-AMP-DOX-CIP-CEF-KAN-SXT-###11

ATM-CH-CN-NOR

AMC-AMP-DOX-CIP-TET-CEF-KAN-###12

SXT-EN-CN-NE-NOR

AMP-AMC-DOX-TET-KAN-SXT-EN-###13

NE-NOR-CN-CH-FFC-ATM

Abbreviation for antimicrobial agents: AMP, ampicillin; AMC, amoxicillin/clavulanic acid; CEF, cefalotin; ATM, aztr- eonam;CN, gentamicin; KAN, kanamycin; APR, apramycin; NE, neomycin; CIP, cip-rofloxacin; NOR, norfloxacin; EN, enrofloxacinbase; DOX, doxycycline; CH, chloramphenicol; FFC, Fl-orfenicol; B,PB, Polymyxin SXT, Trimesulf; TET, tetracycline.

Table IV.- Distribution of genotypes of ESBLs in 80 E. coli strains.

Genotype###Total

TEM###36

CTX-M###27

SHV###2

OXA###2

TEM+CTX-M###4

TEM+SHV###1

TEM+OXA###1

CTX-M+SHV###1

Not detect the ESBLs genotype###13

DISCUSSION

The ESBL producers usually carry a multi- resistant plasmid. As shown in Table 2, most of the isolates were high susceptible to polymyxin B, aztreonam, apramycin. On the other hand, the existence of high resistant incidence rates to ampicillin, amoxicillin/clavulanic acid, doxycycline and trimesulf may be derived from the numerous, long-term and widely use of these antimicrobials in the studied farms. These results for amoxicillin/ clavulanic acid were similar to previous report (Spanu et al., 2002).

ESBLs are divided into five types: TEM, SHV, CTX-M, OXA and others, based on the homogeneity of coding genes. Most ESBLs derived from plasmid-mediated penicillinases belonging to TEM or SHV families. Recently, the CTX-M group with a typical ESBL resistance phenotype but that does not originate from TEM or SHV families have been described. The CTX-M group is a new family of plasmid-mediated ESBLs that preferentially hydrolyze Cefotaxime (Xiong et al., 2002).

In recent years, ESBL producing strains have been reported more and more frequently in China (Xiong et al., 2004). The predominant genotype of ESBLs was TEM and CTX-M in chicken breeding farms of Henan province, but SHV was not found (Yuan et al., 2009). There were 17 strains produced TEM type ESBLs , 14 strains produced SHV type ESBLs and 15 strains produced CTX-M type ESBLs from cattle in Ningxia (Zhou et al., 2010). The predominant genotype of ESBLs was TEM (100% detection rate) in chicken breeding farms in Liaoning Province, and then were CTX-M, but SHV was not found (Zhang et al., 2011). TEM and CTX- M are major genotype in Chongqing (Zhang et al., 2009).

The prevalent genotypes vary in different countries, such as the major genotypes TEM-10, TEM-12 and TEM-26 in U.S., (Jacoby and Medeiros, 1991).TEM-10 and TEM-12 in United Kingdom.SHV-3, SHV-4 and TEM-3 in France. Previously, the most prevalent ESBLs in E. coli isolates from Korea were recognized as SHV-12 and CTX-M, as well as a prototype of b-lactams, TEM-1 (Kim and Lin, 2005). TEM- and SHV-type ESBLs remain more common in North American. CTX-M type ESBLs have been mainly detected in South America, Eastern Europe, Japan and more recently, in Spain and Kenya (Yu et al., 2007).

In 2000, a Spanish multicenter study reported a much lower frequency of ESBLs than that detected in the present study (Herna'ndez et al., 2005). In Korea, ESBL rates in E. coli were 10.2% and 14.2% in previous studies (Ko et al., 2008; Song et al., 2009). On the basis of several recent reports from Korea, the prevalence of ESBL- producing isolates in E. coli was reported as 9.2% to 11.7% (Jeong et al., 2004; Kim and Lin, 2005).

Although the present ESBL production rates in E. coli isolates from Korea were lower than those in China and Hong Kong (24.5% and 14.3%, respectively), they were higher than those in other Asia-Pacific countries, including Australia, Japan, Philippines, and Taiwan (0.5-5.9%) (Hirakata et al., 2005). Differences between the provinces come from the differences in the use of antibacterial agents and prevalence of plasmids which harbor ESBLs genes.

In this study, we determined most of 80 E. coli isolates were the prevalent TEM-type ESBLs. TEM was the main type of b-lactamase, and CTX- M was the second. SHV was detected in 2 isolates. In addition to OXA was detected in 2 isolates. Most ESBL-producing E. coli were resistant. Another interesting point is that some ESBL-producing E. coli produced more than one type b-lactamase, which is rare in countries other than China.

In conclusion, genotypes of ESBLs in Heilongjiang Province of China have a very high prevalence of E. coli. TEM was main type of b-lactamase, and the CTX-M type of ESBL was common among these isolates. Many hypotheses suggest that resistant bacteria or resistance genes could spread from food animals to humans. Thus, public health efforts are necessary to prevent the spread of ESBL-producing between farms. In addition, studies to assess the risk factors for ESBL carriers in China from swine and regular antimicrobial resistance surveillance for swine are required. It is important to monitor such strains closely to prevent their spread.

ACKNOWLEDGMENTS

We thank Di Hu and Wei Xia for the collection of isolates. This study was supported by the Fundamental Research Funds for the Central Universities (DL09AA05).

REFERENCES

CLINICAL AND LABORATORY STANDARDS INSTITUTE CLSI, 2006. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. Document M100-S16.CLSI,Wayne,PA.

HERNANDEZ, J.R., MARTINEZ-MARTINEZ, L., CANTON, R., COQUE, T.M. AND PASCUAL, A., 2005. Nation- wide Study of Escherichia coli and K. pneumoniae producing extended-spectrum b-lactamases in Spain. Antimicrob. Agents Chemother., 49:2122-2125.

HIRAKATA Y., MATSUDA, J., MIYAZAKI, Y., KAMIHIRA, S., KAWAKAMI, S., MIYAZAWA, Y., ONO, Y., NAKAZAKI, N., HIRATA, Y., INOUE, M., TURNIDGE, J.D., BELL, J.M., JONES, R.N., KOHNO, S. AND THE SENTRY ASIA-PACIFIC PARTICIPANTS, 2005. Regional variation in the prevalence of extended-spectrum b-lactamase- producing clinical isolates in the Asia-Pacific region (SENTRY 1998-2002). Diagn. Microbiol. Infect. Dis., 52: 323[?]329.

JACOBY, G.A. AND MEDEIROS, A.A., 1991. More extended-spectrum b-lactamases. Antimicrobial. Agents Chemother., 35:1697-1704.

JEONG, S.H., BAE, I.K., KWON, S.B., LEE, J.H., JUNG, H.I., SONG, J.S., JEONG, B.C., KIM, S.J. AND LEE, S.H., 2004. Investigation of extended-spectrum b-lactamases produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli in Korea. Lett. appl. Microbiol., 39:41-47.

KIM, J. AND LIM, Y.M., 2005. Prevalence of derepressed AmpC mutants and extended-spectrum b-lactamase producers among clinical isolates of Citrobacter freundii, Enterobacter spp., and Serratia marcescens in Korea: dissemination of CTX-M-3, TEM-52, and SHV-12. J. Clin. Microbiol., 43:2452[?]2455.

KLIEBE, C., NIES, B.A., MEYER, J.F., TOLXDORFF- NEUTZLING, R.M. AND WIEDEMANN, B., 1985. Evolution of plasmid-coded resistance to broad spectrum cephalosporins. Antimicrob. Agents Chemother., 28: 302-307.

KO, K.S., LEE, M.Y., SONG, J.H., LEE, H., JUNG, D.S., JUNG, S.I., KIM, S.W., CHANG, H.H., YEOM, J.S., KIM, Y.S., KI, H.K., CHUNG, D.R., KWON, K.T., PECK, K.R. AND LEE, N.Y., 2008. Prevalence and characterization of extended-spectrum b-lactamase- producing Enterobacteri-aceae isolated in Korean hospitals. Diagn. Microbiol. Infect. Dis., 61:453-459.

SONG, W., LEE, H., LEE, K., JEONG, S.H., BAE , I.K., KIM, J.S. AND KWAK, H.S., 2009. CTXM-14 and CTX-M-15 enzymes are the dominant type of extended spectrum b-lactamase in clinical isolates of Escherichia coli from Korea. J. med. Microbiol., 58:261-266.

SPANU, T., LUZZARO, F., PERILLI, M., AMICOSANTE, G. AND TONIOLO, A., 2002. Occurrence of extended-spectrum b-lactamases in members of the family Enterobacteriaceae in Italy: Implications for resistance to b-lactamase and other antimicrobial drugs. Antimicrob. Agents Chemother., 46:196-202.

THI THU HAO,VAN., CHIN, J., TONI, C., TRAN, L. T. AND COLOE, P.J., 2008. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. International J. Fd. Microbiol., 124: 217-223.

YOO, J. S., BYEON, J., YANG, J., YOO, J.I., CHUNG, G.T. AND LEE, Y.S., 2010. High prevalence of extended- spectrub-lactamases and plasmid-mediated AmpC b- lactamases in Enterobacteria-ceae isolated from long- term care facilities in Korea. Diagn. Microbiol. Infect. Dis., 67:261-265.

YUAN, L., LIU, J., HU, G., LIU, Z., MO, J., PAN, Y., KANG, Y. AND WEI, Y., 2009. Detection of extended- spectrum b-lactamases genotype and antibiotic resistance analysis among 30 E.coli isolates from chicken. Chinese J. Prev. Vet. Med., 31:438-443.

YU, Y., JI, S., CHEN, Y., ZHOU, W., WEI, Z., LI, L. AND MA. Y., 2007. Resistance of strains producing extended-spectrum b-lactamases and genotype distribution in China. J. Infect., 54:53-57.

XIONG, Z., ZHU, D., WANG, F., ZHANG, Y., OKAMOTO, R. AND INOUE, M., 2004. A Klebsiella pneumoniae producing three kinds of class A b-lactamases encoded by one single plasmid isolated from a patient in Huashan Hospital, Shanghai, China. Int. J. Antimicrobial. Agents, 23:262-267.

XIONG, Z., ZHU, D., WANG, F., ZHANG, Y., OKAMOTO, R. AND INOUE, M., 2002. Investigation of extended- spectrum b-lactamase in Klebsiella pneumoniae and Escherichia coli from China .Diagn. Microbiol. Infect. Dis., 44 :195-200.

ZHANG, L., LIU, Y., QIAO, C. AND GAO, S., 2011. Genotype distribution of extended-spectrum b-lactamases produced by Escherichia coli isolated from the fowl in Dalian area of Liaoning. Chinese Agric. Sci. Bull., 27:76-78.

ZHOU, X., ZHANG, R., JIA, F. AND WU, Y., 2010. Detection and genotype distribution of Klebsiella pneumonia and Escherichia coli Producing Extended-spectrum b- lactamases Isolated from Cattle in Ningxia. J. Ningxia Univ., 31:260-264.

ZHANG, Z., WU, J., WEI, S., TANG, J., CHEN, H. AND LI, S., 2009. Analysis of genotype of Escherichia coli- producing ESBLs and AmpC b-lactamases isolated from farm animals. Chinese J. Anim. Vet. Sci., 40:898-903.

1 College of Wildlife Resource of Northeast Forest University, Harbin 150040, People's Republic of China, 2 Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary, Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, People's Republic of China, Corresponding author: huayuping@yeah.net
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Xue, Yuan; Chen, Jianfei; Hua, Yuping
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9CHIN
Date:Apr 30, 2012
Words:2828
Previous Article:Chemotherapeutic Efficacy of Oxytetracycline, Enrofloxacin and Imidocarb for the Elimination of Persistent Anaplasma marginale Infection in Naturally...
Next Article:Comparison of Antibiosis of Spotted Bollworm, Earias vittella (Fab.), on Two Bt- and One Non Bt- Cotton Varieties.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters