Printer Friendly

Removal of phorbol esters present in jatropha curcas kernel by fungal isolates.

Byline: Azhar Najjar Norhani Abdullah Wan Zuhainis Saad Syahida Ahmad Ehsan Oskoueian and Youssuf Gherbawy

Abstract

Seed kernel from Jatropha curcas L. cannot be utilized as animal feed due to the presence of toxic phorbol esters. However biological treatments may alleviate the concentration of phorbol esters to a safe level. In the present study two fungal isolates obtained from garden soil and five endophytes from Achillea fragrantissima plant in Saudi Arabia were used for treatments of J. curcas kernel. These fungi were identified as Cladosporium cladosporioides (isolate TUC9) Fusarium chlamydosporum (isolates TUF1 TUF10 and TUF11) Paecilomyces sinensis (isolate TUP8) and Trichoderma harzianum (isolates TUT1 and TUT2) based on their morphological characteristics and internal transcribed spacer regions sequence analysis. Fungal extracts at 250 g mL-1 of all isolates grown in potato dextrose broth (PDB) did not show cytotoxic effect against both human Chang liver and mouse NIH 3T3 fibroblasts cell lines. Treatment of J. curcas kernel in submerged fermentation showed the ability of all isolates to grow in 30 ml PDB supplemented with 14 g ground Jatropha kernel (5.6 g dry matter) containing 15.57 mg phorbol esters. The levels of phorbol esters decreased from 2.78 mg g-1dry matter of kernel to 0.06 mg g-1of spent substrate (97.8%) after 30 d incubation at 28C by T. harzianum TUT1. Lipase activity was observed in all fungal isolates but only P. sinensis TUP8 C. cladosporioides TUC9 and F. chlamydosporum TUF10 showed both lipase and esterase activities. Both enzyme activities were significantly higher (pless than 0.05) in the presence of phorbol esters. Copyright 2014 Friends Science Publishers

Keywords: Trichoderma spp.; Endophytes; Submerged fermentation; Cytotoxicity; Lipase; Esterase.

Introduction

Jatropha (Jatropha curcas L.) produces seeds rich in oil and protein. The kernel contains about 60% oil and 30% protein. However the seed kernel could not be used safely as animal feed due to the presence of phorbol esters that have been recognized as the main toxic compounds (Oskoueian et al.2011). The need for an effective treatment either by physical or biological means to eliminate the phorbol esters is a prerequisite to convert this nutritious material to a useful product in particular as animal feed.Specific genera of phylum Ascomycota such as Trichoderma Paecilomyces Cladosporium and Fusarium contain numerous species that have attracted a great deal of attention as non-toxic biological agents. T. harzianum P. sinensis C. cladosporioides and F. chlamydosporum are inhabitants of nearly every types of soil decaying wood compost or other organic matter and plant tissues (Persoh et al. 2010). Many of these fungal species are non-toxic and non-pathogenic to humans and animals. The soil treated with T. harzianum stimulated plant growth (Harman et al.2004) while endophytic fungal species such as P. sinensisC. cladosporioides and F. chlamydosporum are non- infectious and are important in both agriculture and industrial applications(Moore et al. 2002; Meincke et al.2010; Nalini et al. 2005; Sunitha et al. 2013).Many of these fungi produce enzymes to degrade recalcitrant substrates as defense mechanism as well as to gather nutrients for their survival in adverse environmental conditions. Certain enzymes such as lipase and esterase are involved in degrading a variety of plant natural lipids similar in structures to phorbol esters (Joshi et al. 2011). Recently bacterial and fungal species have been evaluated for their ability to degrade phorbol esters under solid or submerged state fermentation. Bacillus spp. could detoxify the toxic and anti-nutritional compounds in J. curcas seed cake with submerged fermentation better than solid state (Phengnuam and Suntornsuk 2013) while Pseudomonas aeruginosa PseA strain could degrade phorbol esters completely during solid state fermentation (Joshi et al. 2011). Similarly using solid fermentation fungal species such Aspergillus niger and Neurospora sitophila showed the ability to degrade phorbol esters from seed cake of J. curcas (Kurniati 2012). The edible mushroom (Pleurotus ostreatus) grown on J. curcas cake with solid fermentation could reduce the phorbol esters by 99% (Rodrigues da Luz et al. 2013) while three white- rot fungi (Bjerkandera adusta Ganoderma resinaceum and Phlebia rufa) could remove phorbol ester compounds fromJ. curcas in the range of 2097% under submergedfermentation (Barros et al. 2011). Submerged fermentationprocess could provide microorganisms with soluble nutrients and flowing liquid is more efficient for fungal growth compared to solid state fermentation which results in high degradation of different compounds within a short time (Phengnuam and Suntornsuk 2013).Phorbol esters are polycyclic diterpeneswith two hydroxyl groups esterified to fatty acid (Abdel-Hafez et al.2002). Hydrolysis of the ester bond would release the fatty acids from the non-toxic parent compound. Hence the present study was conducted to evaluate other fungal species in particular the Trichoderma spp. and the endophytes for their ability to remove phorbol esters by producing enzymes involved in phorbol esters hydrolysis.

Materials and Methods

Ripe J. curcas L. seeds were supplied by the Malaysian Agricultural Research and Development Institute (MARDI) Serdang. The seeds were dehisced and ground using a laboratory food grinder (Guangzhou Xulang Machinery China) before used. The ground kernel was air dried at room temperature 25C for 3 days. The weight of dried ground kernel was recorded.

Fungal Isolates

Fungal isolates were obtained from the Fungi Center Taif University Saudi Arabia. Isolates were tentatively identified as two Trichoderma spp. from garden soil and five endophytes from Achillea fragrantissima plant(common name Lavender cotton). All the isolates were collected in2010 and stored in potato dextrose agar (PDA) (Bokhari et al. 2009).

Morphological Characteristics

Fungal isolates were identified based on morphological characteristics up to the genus level. All isolates were cultivated on PDA to measure the growth and sporulation. The size and pigmentation of colonies were recorded and fungal tissues were studied under the light microscope with lactophenol cotton blue (LPCB) staining for micro morphological characteristics (Najjar 2007). The size and shape of conidia and phailides were measured. The macro and micro morphological features were compared to the identification key (Pitt and Hocking 2009).

PCR Amplification of ITS Region

Mandles Andreoti medium 20 mL was prepared in 100-mL Erlenmeyer flasks to cultivate fungal strain for 7 d usinganorbital shaker incubator (28C 150 rpm). The mycelia were ground with mortar and pestle in liquid nitrogen. The frozen powdered mycelia were then transferred into a 1.5 mL eppendorf microcentrifuge. DNA was extracted using Genomic BYF DNA Extraction Mini Kit (iNtRON Biotechnology Korea). Polymerase chain reaction (PCR) was conducted to amplify the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) using a thermal Cycler (Peltir MJ Research PTC-200 INC USA). The reactioncomposition (50 L) contained 3 L of extracted DNA 2 L each of the primers 25 L of green PCR mix (Fermentas Dream TaqTm Green DNA Polymerase U.S.) and 18 L of PCR grade water. The cycling conditions were as follows: aninitial denaturation of 2 min at 94C followed by 39 cycles at 94C for 20 s 4060C for 10 s 72C for 20 s and a final extension cycle at 72C for 5 min. The negative control was prepared with the reaction mixtures in the absence of DNA extract (Luangsa-Ard et al. 2005).

DNA Visualization Quantification and Purification

PCR products were loaded onto 1.5% agarose gel and run for1 h at 100 V. Electrophoretic gel (OSP-105 electrophoresis Owl Scientific Germany) was stained in ethidium bromide and visualized under UV light (versa doc imaging system Bio-Rad). A standard 100 bp molecular weight DNA marker (Gene Ruler TM Low range DNA 1 Ladder Fermentas U.S.) was used to identify and quantify the PCR product results. Megaquick-SpinTM PCR Agarose Gel DNA Extraction System (manufacturer protocol iNtRON Biotechnology Korea) was used to purify the PCR products to obtain clear and sharp bands (Zhang and Yang 2007).

DNA Sequencing and Analysis

The sequence results from both strands for each PCR product of fungus were assembled using thermo Sequencing-kit by Applied Biosystems 3730 DNA Analyzer. Sequence identities were determined by using BLAST Genbank general databases from Centraalbureau voor Schimmelcultures (CBS) and National center for biotechnology information (NCBI) database (Thompson et al. 1997). DNA sequences were aligned first with Clustal X1.81 TREECON for Windows (version 1.3b 1998) was used to construct neighbor-joining tree using Jukes-Cantor model (Gherbawy et al. 2010).

Cytotoxicity Assay of Fungal Isolates

Two plugs (5-mm) of each isolate grown in PDA were used to inoculate 30 mL PDB and incubated for 7 d (28C 150 rpm). After incubation the fungal cultures were freeze dried under antiseptic condition (-40C and vapor pressure of0.129 mBar). Dimethyl sulfoxide (DMSO) in the ratio 1:100 (v/w) was added to the dried residues to prepare the fungalextract. A syringe filter (pore size: 22 m biofilm UK) was used to filter the extract. The cytotoxicity activity of fungal extract was evaluated by using Chang liver (human hepatocytes CCL-13) and NIH 3T3 (Swiss mouse fibroblasts CRL-1658) cell lines obtained from the American Type Culture Collection (ATCC). The cytotoxicity effect of each extract was compared to the positive control (cells without fungal extract). A 96-well micro-culture plate was used for cell seeding (5 A- 103cells100 L-1) in Dulbecco's Modified Eagle Media(DMEM) after treatment with 0.25% trypsin. The cells wereexposed to the fungal extracts in the range of 7.81 g mL-1 to 250 g mL-1 and incubated in a humidified atmosphere with 5% CO2 for 24 h at 37C. The cell viability was determined by thiazolyl blue tetrazolium bromide dye andmeasured with a microplate reader (spectra max plus plus384 U.S.) at wave length 570 nm (Shi et al. 2010).

Removal of Phorbol Esters in Jatropha Kernel byFungal Isolates

Jatropha kernel was treated by the fungal isolates in submerged fermentation. Thirty mL of potato dextrose broth (PDB) were placed in 250 mL Schott bottle with 14 g of ground Jatropha kernel (5.6 g dry matter) containing 15.57 g of phorbol esters. The initial pH of the culture medium was adjusted to 5.5 by using 10 M NaOH and autoclaved. Treatment flasks were inoculated with 2 plugs (5-mm) of each fungal strain grown on PDA for 7 d at 28C. Uninoculated medium was used as the control. All flasks were placed in an orbital shaker incubator (28C 150 rpm) for 30 d. After incubation the content of each flask was freeze dried followed by oil extraction with methanol at a ratio of 1:3 (w/v) (Makkar and Becker 2010). The samples were stirred at room temperature for 15 min and then centrifuged for 8 min at 3200A-g to collect the supernatant. The solvent was removed by using a rotary evaporator at65C to recover the oil containing the phorbol esters. The oil was weighed and dissolved in 5 mL methanol followed by filtration with a syringe filter (0.22 m). The amount of phorbol esters present in the methanolic extract was determined by high-performance liquid chromatography (HPLC) using phorbol-12-myristate 13-acetate (PMA) as the standard. Twenty L of the samples were loaded on HPLC (Agilent Technologies Germany) fitted with areverse-phase C18 column (250 A- 4 mm I.D and 5 m poresize Agilent Technologies Germany) and a UV detector.The running conditions were as previously described byOskoueian et al. (2011).

Lipolytic and Esterolytic Activities

Olive oil (C18) and tributyrin (C4) were used as triacylglycerol substrates to detect lipase and esterase activities respectively (Hasan et al. 2009). The seven fungal strains were screened for extracellular hydrolytic enzymes production on PDA plates that contained eithercommercial olive oil (1% w/v) (Bertolli Dal) with rhodhamine B (0.001% w/v) to detect lipase or tributyrin (1% w/v) to detect esterase. Phorbol esters-rich fraction was prepared (Makkar and Becker 2010) and added (1% w/v) to the PDA medium (treatment). Each fungal strain was first grown in PDA at 28C for 7 d and one plug (5 mm) was placed at the centre of PDA medium containing the substrates with or without phorbol esters-rich fraction. The lipase and esterase activity of fungal strain was determined by measuring the size of the halo zone after 7 d at 28C. This study was conducted in triplicates. The halos on tributyrin plates were visualized in normal day light whereas the halos on olive oil plates were observed under UV light which showed a bright pink fluorescence. An index of relative enzyme activity (REA) was calculated by using the formula (Peterson et al. 2009):REA =Diameter of halo zone /Diameter of colony.

Statistical Analysis

Statistical analysis was conducted by using GraphPad Prism software (GraphPad prism 5 Software San Diego USA). SPSS software (2003 version 19.0 USA) was also used toanalyze lipolytic and esterolytic activities data. The mean values for three replicateswere analyzed by General LinerModels in a Complete Randomized Design. Dunnett'sMultiple Range test was used for comparingthe mean valuesof control and treatments at Pless than 0.05.

Results

Fungal Identification

Morphological and molecular techniques were used to identify the isolates.All the seven isolates were identified using the morphological reference keys to the genus level. The colony color and diameter were recorded for all fungal isolates. Pigmentations were produced by Cladosporium spp. and Fusarium spp. isolates No. TUC9 TUF1 TUF10 and TUF11. The microscopic features in terms of the size and length of conidia and phailides are described in Table 1. These isolates were identified to four genera i.e. Trichoderma (two isolates) Cladosporium (one isolate) Paecilomyces (one isolate) and Fusarium (three isolates) according to published morphological keys (Pitt and Hocking 2009).

Amplification of Fungal Genomic DNA

PCR amplification of rDNA extracted from all seven isolates was conducted with two universal fungal primer pairs: the first pair was ITS1/2 and the second pair was ITS1/4. In each case intense bands on agarose gel appeared as PCR products in expected size in the range400-550 bp from all seven isolates. Fig. 1 illustrates the PCR profiles of pair 1 ITS1/4 regions amplified from different isolates. The

Table 1: Macro- and micro-morphological characteristics of strains grown on PDA at 28C for 7 day incubation

###a

Strain###Sources###Colony color and###Conidia length Conidia feature###Phialide###Phialide feature###Genus

codes###diameter (mm)###m###length m

TUT1###Soil###Green 86.3###3.5-4.1###Clusters###8.1-10###Flask - shaped###Trichoderma

TUT2###Soil###Whitish-green88.3###4.2-4.8###Clusters###8.5-10.2###Flask - shaped###Trichoderma

TUP8###Plant###Yellow-brown 80.6###2.0-4.0###Ellipsoidal###12-20###Cylindrical with wide neck###Paecilomyces

###b

TUC9###Plant###Grayish-green 24.0###4.6-5.5###Lemon- shaped###4.0-5.5###Slender###Cladosporium

###b

TUF1###Plant###White-pink 44.6###4-10###Macro and micro###2.0-3.5###Slender###Fusarium

###b

TUF10###Plant###Reddish 45.6###3.5-12###conidia banana-###1.5-3.0###Fusarium

###b

TUF11###Plant###Brownish 48.3###2.5-12.5###shaped septate###2.0-4.5###Fusarium

Table 2: Identified fungal species used in this study with relationship to the genus or species and the identity percentage found in the CBS (The Central bureau voor Schimmel cultures) website

No.###Isolate###Accession###Closely###related###fungal###Identities

###Codes###Numbers###sequence###(%)

1###TUT1###JQ350879.1###Trichoderma###harzianum###100

###JX082390.1

2###TUT2###JQ517493.1###Trichoderma###harzianum###99.8

###FJ459968.1

3###TUP8###JQ350881.1###Paecilomyces###sinensis###100

###AY857543.1

4###TUC9###JQ517491.1###Cladosporium###99

###cladosporioides JQ910161.1

5###TUF1###JQ350882.1###Fusarium chlamydosporum###100

###GQ505443.1

6###TUF10###JQ517492.1###Fusarium chlamydosporum###99.6

###GQ505443.1

7###TUF11###JQ350880.1###Fusarium chlamydosporum###100

###GQ505443.1

PCR genetic sequences alignment of isolates were identified as known species based on the 99 100 % similarity of their sequences with that of the known species already published NCBI and CBS databases. All seven isolates were identified to species level where TUT1 and TUT2 were T. harzianum TUP8 was P. sinensis TUC9 was C. cladosporioides and TUF1 TUF10 and TUF11 were F. chlamydosporum. These isolates were published in GenBank database with the new accession numbers as shown in Table 2.

Phylogenetic AnalysisThe variable ITS region sequences of seven isolates wasused for the phylogenetic analysis at taxonomic levelsaccording to CBS and NCBI databases. Neighbor-joining tree based on the used primer pair classified all seven isolates into four clusters according to the group species (Fig. 2). Since Trichoderma and Fusarium belong taxonomically to the same order (Hypocreales) the strains belonged to the previously mentioned genera constituted one major cluster with 100% bootstrap percentage. IsolateTUP8 clustered with Paecilomyces had 100% bootstrap belonged to the order Eurotiales. Also TUC9 branched to a new cluster of Cladosporium with 100% bootstrap and classified to order Capnodiales.

Cytotoxic Activity of Fungal Isolates

In the present study the fungal species utilized for treatment of Jatropha kernel were evaluated for their cytotoxicity activity. The DMSO extract for all the seven fungal cultures did not show any toxic effect on both human (Chang liver) and mouse (NIH 3T3 fibroblast) cell lines even at high concentrations (250 g mL-1 )as the percentage viabilities of cells were in the range of 99.5- 99.9 % (Fig. 3). There was no significant difference (pgreater than 0.05) of cell viabilities among fungal isolates.

Fungal Detoxification of Phorbol Esters

The HPLC analysis showed the amount of phorbol esters in the Jatropha kernel before fungal treatments (control) was2.78 mg PMA equivalent per g dry weight of Jatropha kernel. Fungal isolates used in the present study could reduce the levels of phorbol esters significantly (Pless than 0.05) as shown in Fig. 4. The phorbol esters level was reduced to less than0.2 mg g-1 in the treatments with T. harzianum TUT1 T. harzianum TUT2 P. sinensis TUP8 and C. cladosporioides TUC9 while the reduction of phorbol esters by F. chlamydosporum isolates was lower. The percentage value

Table 3: Relative enzyme activity (REA) of seven fungal strains grown on olive oil or tributyrin substrates in the presence of phorbol esters (PEs) extract at 28C for 7 days of incubation

###Lipase enzyme###Esterase enzyme

Strains###Olive oil###Tributyrin

###Olive oil###Tributyrin

###with PEs###with PEs

T. harzianumTUT1###1.19ax0.02 1.26bx0.03###ND###ND

T. harzianum TUT2###1.15axy0.05 1.21bxy0.01###ND###ND

P. sinensisTUP8###1.10axy0.02###1.18bxy0.01###1.11cx0.05###1.32dxy0.01

C. cladosporioides TUC9 1.14axy0.02###1.20bxy0.02###1.24cx0.03###1.40dx0.02

F.chlamydosporumTUF1 1.11axy0.03###1.17bxy0.02###ND###ND

F.chlamydosporumTUF10 1.13axy0.03###1.19bxy0.06###1.11cx0.01###1.25dy0.03

F.chlamydosporumTUF11 1.06ay0.01###1.13by0.04 ND###ND

of phorbol esters reduction was highest (97.8%) with T. harzianum TUT1 treatment and lowest (86%) with F. chlamydosporum TUF11 treatment.

Lipolytic and Esterolytic Activities of Fungal Extracts

Table 3 shows the relative enzyme activity (REA) of fungal isolates for lipase and esterase activities. Areas of fluorescence were observed around the seven fungal colonies in the absence and presence of phorbol esters-rich fraction onolive oil agar plates. However significantly (pless than 0.05) higher lipase activity was observed for all isolates grown on olive oil with phorbol esters. On the other hand only three isolates i.e. P. sinensis TUP8 C. cladosporioides TUC9 and F. chlamydosporum TUF10 produced esterase activity. Similar to the lipase activity the presence of phorbol esterssignificantly (pless than 0.05) induced esterase activity.

Discussion

The overlapping resemblance of macro and micromorphological characteristics may cause misidentification of fungi to species level (Gherbawy et al. 2010). Hence molecular techniques based on ribosomal DNA fragment amplification and sequencing by ITS universal primes were conducted to complete the identifications to species level. It has been stated that using PCR technique to amplify rDNA- ITS region was a common approach to identify fungi up to species or strain level. The molecular size of the ITS region amplifications of T. harzianum P. sinensis C. cladosporioides and Fusarium spp. were 650 bp 537 bp350 bp and 389 bp respectively in agreement with previous reports (Chen et al. 2001; Moore et al. 2002; Abd-Elsalam et al. 2004; Meincke et al. 2010). Phylogenetic analysis indicated the genus of Paecilomyces was generally thought to be the anamorphic (asexual) state of the insect parasite Cordyceps sinensis (family Clavicipitaceae order Hypocreales) until the molecular evidence demonstrated that P. sinensis was in fact completely unrelated to C. sinensis and was instead in close phylogenetic proximity to P. variotii in the family Trichocomaceae (Chen et al. 2001). Owing to the phylogenetic species concept which defines species as the diagnosable taxonomic unit with a clear pattern of parental ancestry we interpret this conspicuity as species identity. All data shown were obtained with rDNA- ITS sequences of the seven isolates and could be grouped into the phylum Ascomycota.Fungal cytotoxicity is a major concern regarding fungal treatment of feed materials. Many fungal isolates have been reported to be harmless to human and animal cell lines. It has been reported that Trichoderma sp. extract did not impair cell viabilities of hepatocellular Chang human cell line at 40 g mL-1 concentration (Shi et al. 2010). Similarly C. cladosporioides fungus was non- toxic to mice exposed to high loads of spore indicated by the absence of histological changes of the lung structure (Flemming et al. 2004). Furthermore human epithelia cell line was resistant to Fusarium sp. toxin (Calvert et al.2005). Another study conducted (Toledo et al. 2012)suggested the safe used of Paecilomyces sp. against NIH3T3 mice fibroblast cell as the fungal species did not produce any toxin in the culture medium. It has also been reported that P. sinensis showed positive effects on several pharmacological studies including antitumour estrogenicity and anti-oxidation activities (Chen et al. 2001). It is worth noting that Chang liver cell from human show similar sensitivity to NIH 3T3 fibroblast cell from mouse to fungal extracts indicating the biological similarity between the two cell lines. The subtropical soil and plant revealed promising source of fungi that are rarely considered and poorly understood as biological agents (Klich 2002).The amount of phorbol esters in the Jatropha kernel was close to the value of 3 mg PMA equivalent per g of Malaysian Jatropha meal (Oskoueian et al. 2011). A slight difference could be due to the samples determined. Oskoueian et al. (2011) analysed the defatted sample whereas in the present study the seed kernel was used. Different levels of phorbol esters have been observed in Jatropha seed cake (defatted kernel). Brazilian Jatrophaseed cake showed low level of phorbol esters (0.82 mg g-1) (Barros et al. 2011) while Indian Jatropha seed cake contained high level (5.45 mg g-1) (Roach et al. 2012). This variation could be attributed to a number of factors including different geographical regions extraction methods types of solvents and extraction conditions(Devappa et al. 2012). In the present study the amount ofphorbol esters in seed kernel after treatment with T. harzianum TUT1 was 0.06 mg g-1 of dried spent substrate nearly half the amount of phorbol esters at 0.11 mg g-1 of the nontoxic Mexican J. curcus (Rodrigues da Luz et al.2013). According to these researchers humans and chickensin Mexico consume the non-toxic Jatropha kernel without any hazardous effects.The fungal isolates in this study were able to remove the phorbol esters from Jatropha kernel to varying degrees. Similarly other fungal species including A. niger Penicillium chrysogenum Rhizopus oligosporus R.nigricans and T. longibrachitum could detoxify phorbol esters and other anti-nutritional components present in J. curcas kernel cake (Belewu and Sam 2010). On the other hand fungal species such as A. flavus Botrytis cinerea F. oxysporum F. moniliforme Curvularia lunata and Penicillium notatum were susceptible to phorbol esters rich fraction indicating the fungicide effect of these compounds. This latter finding demonstrates the possibility of using phorbol esters rich fraction as natural antifungal product in agricultural practices (Devappa et al. 2012).It is known that Trichoderma spp. and endophytes in particular exist in mutualistic association with the host plant producing various enzymes as their defense mechanisms (Nalini et al. 2005). It was therefore speculated that these endophytes as well as the Trichoderma spp. could produce enzymes for neutralizing toxic compounds like phorbol esters or for exploiting these compounds as nutrients for growth. The use of solid media supplemented with emulsified olive oil (C18 long chain triglycerides) or tributyrin (C4 short chain triglycerides) is specific for the detection of lipase and esterase activities. Lipase catalyzes the hydrolysis of relatively long and short chain triacylglycerols but esterase only catalyze the reactions involving short chain triacylglycerols (Chul-Hyung et al.2011). These enzyme activities are theoretically regarded as important natural agents to remove phorbol ester compounds from Jatropha kernel (Barros et al. 2011). In the present study T. harzianum only produce lipase but showed the highest percentage of phorbol esters removal. The presence of phorbol esters stimulated the production of lipase enzyme indicating the potential of T. harzianum TUT1 and TUT2 in removing phorbol esters from Jatropha kernel. This result also indicates that Jatropha kernel contains phorbol esters with long chain fatty acids. On the other hand the other fungal species produce both lipase and esterase but showed lower percentage of phorbol esters removal probably due to lower lipase activity. The results also indicate that esterase is not a major detoxifying enzyme for the phorbol esters present in the local Jatropha kernel. The high lipase activity in T. harzianum TUT1 resulted in the highest percentage of phorbol esters removal when compared to other fungal isolates.In conclusion Saudi Arabian fungal isolates: T. harzianum TUT1 TUT2 P. sinensis TUP8 C. cladosporioides TUC9 F. chlamydosporum TUF1 TUF10 and TUF11 were identified by morphological characteristics and molecular technique. These isolates showed high ability to remove phorbol esters from J. curcas kernel in the range of 86% to 97%. The fungal isolates did not have toxic effects on human and animal cell lines and produced enzymes to break down the phorbol esters that made them potential candidates for biological treatments of phorbol esters in Jatropha kernel. Jatropha kernel or Jatropha meal after fungal treatment would nevertheless be a good source of protein and with its low fiber content may become an alternative feed ingredient for poultry.Acknowledgements

The authors would like to acknowledge the Ministry of Science Technology and Innovation of Malaysia for the Science Fund Project Number 02-01-04 SF1132 the Faculty of Biotechnology and Biomolecular Sciences Universiti Putra Malaysia for the facilities provided and the Faculty of Science Taif University Kingdom of Saudi Arabia for supplying the fungal isolates.

References

Abdel-Hafez A.A.M. N. Nakamura and M. Hattori 2002.Biotransformation of phorbol by human intestinal bacteria. Chem. Pharm. Bull. 50: 1604Abd-Elsalam K.A. I.N. Aly M.A. AbdelSatar M.S. Khalil and J.A.Verreet 2004. PCR identification of Fusarium genus based onnuclear ribosomalDNA sequence data. Afr. J. Biotechnol. 2: 8285Belewu M.A. and R. Sam 2010. Solid state fermentation of Jatrophacurcas kernel cake: proximate composition and antinutritional components. J. Yeast Fungal Res. 1: 4446Barros C.R.M. L.M.M. Ferreira F.M. Nunes R.M.F. Bezerra A.A. DiasC.V. Guedes J.W. Cone G.S.M. Marques and M.A.M. Rodrigues2011. The potential of whiterot fungi to degrade phorbol esters ofJatropha curcas L. seed cake. Eng. Life Sci. 11: 107110Bokhari F. Y. Gherbawy and A. Najjar 2009. Detection of the patulinproducing potential of some Paecilomyces variotii strains isolatedfrom the air samples of Jeddah city Saudi Arabia using the RAPDPCR technique. Aerobiologia 25: 4954Calvert T.W. K.E. Aidoo A.G.G. Candlish and A.R.M. Fuat 2005.Comparison of in vitro cytotoxicity of Fusarium mycotoxins deoxynivalenol T2 toxin and zearalenone on selected human epithelial cell lines. Mycopathologia 159: 413419Chen Y.Q. N. Wang L.H. Qu T.H. Li and W.M. Zhang 2001.Determination of the anamorph of Cordyceps sinensis inferred fromthe analysis of the ribosomal DNA internal transcribed spacers and5.8S rDNA. Biochem. Syst. Ecol. 29: 597607Chul-Hyung K. O. KiHoon L. MiHwa O. TaeKwang and K. Bong2011. A novel family VII esterase with industrial potential fromcompost metagenomic library. Microb. Cell Fact. 10: 2230Devappa R.K. M.A. AnguloEscalante H.P.S. Makkar and K. Becker2012. Potential of using phorbol esters as an insecticide againstSpodoptera frugiperda. Ind. Crops Prod. 38: 5053Flemming J. B. Hudson and T.G. Rand 2004. Comparison ofinflammatory and cytotoxic lung responses in mice after intratracheal exposure to spores of two different Stachybotrys chartarum strains. Toxicol. Sci. 78: 267275Gherbawy Y. C. Kesselboth H. Elhariry and K. Hoffmann 2010. Molecularbarcoding of microscopic fungi with emphasis on the mucoralean genera Mucor and Rhizopus. Mol. Iden. Fung. 33: 213250Harman G.E. C.R. Howell A. Viterbo I. Chet and M. Lorito 2004.Trichoderma species opportunistic a virulent plant symbionts. Nat. Rev. Microbiol. 2: 4356Hasan F. A.A. Shah and A. Hameed 2009. Methods for detection andcharacterization of lipase: a comprehensive review. Biotechnol. Adv.27: 782798Joshi C. P. Mathur and S.K. Khare 2011. Degradation of phorbol esters byPseudomonas aeruginosa PseA during solidstate fermentation of deoiled Jatropha curcas seed cake. Biores. Technol. 102: 481548159Klich M.A 2002. Biogeography of Aspergillus species in soil and litter.Mycologia 94: 2127Kurniati T 2012. Detoxification through fermentation by consortium ofAspergillus niger and Neurospora sitophila towards the degree of forbol esther and nutrition value of Jatropha curcas L. for broilers feed. J. Asian Sci. Res. 2: 317324Luangsa-Ard J.J. N.L. HywelJones L. Manoch and R.A. Samson 2005.On the relationships of Paecilomyces sect. Isarioidea species. Mycol.Res. 109: 581589Makkar H.P.S. and K. Becker 2010. Are Jatropha curcas phorbol estersdegraded by rumen microbes J. Sci. Food Agric. 90: 15625Meincke R. N. Weinert V. Radl M. Schloter K. Smalla and G. Berg2010. Development of a molecular approach to describe the composition of Trichoderma communities. J. Microbiol. Meth. 80:6369Moore J.E. J. Xu B. Millar and S. Elshibly 2002. Edible dates (Phoenixdactylifera) a potential source of Cladosporium cladosporioides and Sporobolomyces roseus: implications for public health. Mycopathologia 154: 2528Najjar A.A. 2007. Determination mycobiota and mycotoxins of airbornedust in some animal houses and computer laboratories in Jeddahprovince. Master thesis King Abdul-Aziz University Jeddah SaudiArabiaNalini M.S. B. Mahesh M.V. Tejesvi H.S. Prakash V. Subbaiah K.R.Kini and H.S. Shetty 2005. Fungal endophytes from the threeleaved caper Crataeva magna (Lour.) DC. (Capparidaceae).Mycopathologia 159: 245249Oskoueian E. N. Abdullah W.Z. Saad A.R. Omar M.B. Puteh and Y.W.Ho 2011. Antinutritional metabolites and effect of treated Jatropha curcas kernel meal on rumen fermentation in vitro. J. Anim. Vet. Adv. 10: 214220Persoh D. M. Melcher F. Flessa and G. Rambold 2010. First fungalcommunity analyses of endophytic ascomycetes associated with Viscum album ssp. austriacum and its host Pinus sylvestris. Fung. Biol. 114: 585596Peterson R.A. J.R. Bradner TH Roberts and KMH Nevalainen 2009.Fungi from koala (Phascolarctos cinereus) faeces exhibit a broad range of enzyme activities against recalcitrant substrates. Lett. Appl. Microbiol. 48: 21825.Phengnuam T. and W. Suntornsuk 2013. Detoxification and antinutrientsreduction of Jatropha curcas seed cake by bacillus fermentation. J.Biosci. Bioeng. 115: 168172Pitt J.I. and D.A. Hocking 2009. Fungi and food spoilage. London:Blackie Academic and Professional. ISBN 9780387922065Roach J.S. R.K. Devappa H.P.S. Makkar and K. Becker 2012. Isolationstability and bioactivity of Jatropha curcas phorbol esters.Fitoterapia 83: 586592Rodrigues da Luz J.M. S.A. Paes D.P Torres M.D. Nunes J. Soares daSilva H.C. Montavani and M.C.M. Kasuya 2013. Production of edible mushroom and degradation of antinutritional factors in Jatropha biodiesel residues. Food Sci. Technol. 50: 575580Shi M. H.N. Wang S.T. Xie Y. Luo C.Y. Sun X.L. Chen and Y.Z.Zhang 2010. Antimicrobial peptaibols novel suppressors of tumor cells targeted calciummediated apoptosis and autophagy in human hepatocellular carcinoma cells. Mol. Cancer 9: 2640Sunitha V.H D.N. Devi and C. Srinivas 2013. Extracellular enzymaticactivity of endophytic fungal strains isolated from medicinal plants.World. J. Agric. Sci. 9: 019Thompson J.D. T.J. Gibson F. Plewniak F. Jeanmougin and D.G.Higgins 1997. The Clustal X windows interface: flexible strategies formultiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 48764882Toledo Marante F.J. R. Mioso J.B. Barrera J.E. Gonzalez Gonzalez J.J.Santana Rodriguez and I.H. Bravo de Laguna 2012. Structural characterization and metabolite profiling of the facultative marine fungus Paecilomyces variotii. Ann. Microbiol. 62: 17Zhang H. and Q. Yang 2007. Expressed sequence tagsbased identificationof genes in the biocontrol agent Chaetomium cupreum. Appl.Microbiol. Biotechnol. 74: 650658
COPYRIGHT 2014 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Najjar, Azhar; Abdullah, Norhani; Saad, Wan Zuhainis; Ahmad, Syahida; Oskoueian, Ehsan; Gherbawy, Yo
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Oct 31, 2014
Words:5371
Previous Article:Identification of single nucleotide polymorphism in rpoB gene among Mycobacterium tuberculosis isolates from Pakistan.
Next Article:A review on bio-butyric acid production and its optimization.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters