Printer Friendly

Relacion entre superantigenicidad, resistencia antimicrobiana y origen de aislamientos de staphylococcus aureus.

Relationship between super antigenicity, antimicrobial resistance and origin of Staphylococcus aureus isolated

Introduction

Staphylococcus aureus is a major human pathogen capable of causing a wide range of infections, including skin and soft tissue infections, Healthcare-associated infections (nosocomial infections), food poisoning and life-threatening infections such as toxic shock syndrome, endocarditis, osteomyelitis, meningitis and pneumonia (1,2).

The pathogenicity of S. aureus is very complex, involving numerous bacterial products and sophisticated regulatory pathways (3). Many virulence factors have been described, such as antibiotic resistance, production of exotoxins and enzymes that contribute to its ability to colonize and cause disease (1,4).

Some strains produce one or more exoproteins, including staphylococcal enterotoxins (SE), toxic shock syndrome toxin (TSST-1), exfoliative toxins (ET) and leukocidins (4).

Superantigenicity is one of the most studied properties of this exoproteins, which refers to its ability to activate 20 to 30% of T lymphocytes with a massive production of pro-inflammatory cytokines and chemokines that can cause fever, hypotension and other disorders including potentially lethal shock (1,5,6).

There are five known types of classical enterotoxins (SEA to SEE), many new types of enterotoxins have been described, called nonclassical enterotoxins (SEG to SEU) (1,4,7-10) and more recently described, superantigen SElX (selx gene), that contributes to the lethality of a strain CA-MRSA in necrotizing pneumonia (community acquired-Methicillin Resistant S. aureus) (11).

Most types of enterotoxins are encoded in mobile genetic elements located on pathogenicity islands, transposons, plasmids, phages or highly variable genetic regions (vSa[beta]) (6,11). There is an enterotoxin gene cluster (egc) that groups the genes seg-sei-sem-seo-sen and sometimes seu, which has been linked to increased virulence of S. aureus strains and is the most commonly detected. It is located in the pathogenicity island vSA (9,12,13). Other genes of enterotoxins are detected in the methicillin resistance chromosomal cassette (SCCmec) (14).

Exfoliative toxins produced by S. aureus are responsible for the scalded skin syndrome (SSS), which causes the most sever bullous skin manifestations. It primarily affects infants and young children (15,16). ETs are classified as ETA, ETB, and ETD, ETA and ETB. ETB being the most frequent (17,18) and ETD the less frequent (19). Recent studies show the prevalence of superantigen genes in S. aureus isolates from different sources and geographical regions. Some clinical studies have attempted to correlate the results of detection of superantigen genes in patients with S. aureus infections, but their relationship has not been elucidated (5,20,21).

The objective of the study was to establish the relationship between the profile of superantigen genes (SEs, ETs and TSST-1) to antiobiotic resistance, to clinical specimen type (blood, secretions, others specimens), and to hospital (HA: Hospital-Acquired) or community (CA: Community-Acquired) in isolates of S. aureus in order to try to establish the potential virulence of hospital isolates.

Materials and Methods

A prospective study was carried out with 81 isolates obtained between February 2009 and March 2011. Only S. aureus isolates from patients with diagnosis of Healthcare-associated infections of both sex and adult were included and excluded patients with polymicrobial infections and children. We analyzed only the first isolation cultured by the clinical laboratory. The study was approved and supervised by the Bioethics Committee of the Faculty of Health Sciences--Technological University of Pereira.

The identification of clinical isolates and antibiotic susceptibility were performed by Automated Systems for Susceptibility Testing (WalkAway/Microscan[R], Dade Behring) at clinical laboratory of the Hospital Universitario San Jorge (Pereira-Colombia), this hospital is an institution providing health services II, III and IV levels of care, with 402 hospital beds and an average monthly hospital admissions and discharge of 2,100 and 1,700 patients, respectively. The levels of care correspond to the therapies and services provided.

The isolates were confirmed as S. aureus by PCR using primers: Sa442-1 5'-AAT CTT TGT CGG TAC ACG ATA TTC TTC ACG -3' and Sa442-2 5'-CGT AAT GAG ATT TCA GTA GAT AAT ACA ACA -3', to amplify a portion of the species-specific gene Sa442 of S. aureus22.

Classification of S. aureus isolates

The isolates were classified according to the type of clinical specimen (blood, secretions, and others). Secretions which come from ears, eyes, muscle, burns, scalp, joint regions, osteosynthesis material, abscesses and wounds. Samples of devices such as catheters and tracheobronchial aspirates, pleural, peritoneal and cerebrospinal fluid and urine were classified as others. The isolates were also classified as resistance to one or more antibiotics and finally isolates were classified by the Hospital Universitario San Jorge as home hospital (HA) or community (CA).

DNA extraction

The CTAB (cetyltrimethylammonium bromide) genomic DNA extraction method was modified to use lysostaphin and the methodology described by Johnson et al (23). The extracted DNA was stored at -20[degrees]C in aliquots of 20 ng/[micro]L for subsequent analysis by PCR

Identification of superantigen genes

All isolates were examined for 22 genes (sea to see, tsst-1, seg to ser, seu, eta, etb and etd) by PCR. Five reference strains were used as positive controls, containing one or more superantigens genes: ATCC 700699, ATCC BAA-1707, ATCC 13565, ATCC 13566 and ATCC 19095 (FRI137).

The nucleotide sequences for all the primers used in this study and their respective amplification products are described for other authors (10,18,24) (Table 1).

Multiplex PCR

Two sets of multiplex PCR were used to detect classical enterotoxins genes (sea to see), toxic shock syndrome toxin (tsst-1) and exfoliative toxins (eta y etb). The internal control of the reactions was a couple of primers femA, that amplified a 132 bp fragment of the femA gene (structural component of peptidoglycan, associated to methicillin resistance) (10,18,24). Reference ATCC strains were used as positive controls and sterile distilled water as negative control.

Multiplex PCR series A included primers for genes sea, seb, sec, sed, see and femA. The amplification reaction was performed in a final volume of 25 [micro]L, containing 1X buffer (50 mM KCl, 10 mM Tris-HCl, pH 9.0), 3 mM Mg[Cl.sub.2], 200 pM dNTPs, 20 pmol each of the primers sea, seb, sec and see, 40 pmoles of primer sed, 1 U of Taq polymerase (Invitrogen) and 1 [micro]L of DNA at a concentration of 20 ng/[micro]L. Amplification was performed in a thermocycler (Perkin Elmer GeneAmp 9700), under the following conditions: denaturation at 94[degrees]C for 1 min, annealing at 61[degrees]C for 30 s and extension at 74[degrees]C for 1 min, for 35 cycles (24).

Multiplex PCR series B included the primers for exfoliative toxins A and B genes and the toxic shock syndrome toxin (TSST-1). The amplification reaction had the same constituents and concentrations of the amplification reaction for the series A, except for the primer eta that must be 50 pmoles, as stated in Mehrotra et a (24). For tst-1 and etb is 20 pmoles. Amplification temperatures and cycles are as described for the set A.

Individual PCR (Uniplex)

Was used to detect nonclassical enterotoxin genes: seg to ser, seu, and exfoliative toxin etd. Gene FemBprimers were used as an internal control of the reactions, which is also an essential factor for the expression of methicillin resistance (25). Reference ATCC strains were used as positive control and sterile distilled water negative control.

The reaction mixture (25 [micro]L) consisted of 20 pmol of each primer, 2.5 mM Mg[Cl.sub.2], 200 [micro]M of each oligonucleotide, 1 U of Taq DNA polymerase and 1X buffer. Thermocycler conditions were: denaturation at 94[degrees]C for 30 s, annealing at 55[degrees]C for 30 s, and extension at 72[degrees]C for 60 s for 30 cycles (25).

Detection and analysis of all the amplified products was performed by 2% agarose gel electrophoresis stained with ethidium bromide.

Statistical analysis

Contingency tables were prepared and different correlations were analyzed between the presence or absence of superantigens genes against antimicrobial resistance, clinical specimen type, source of isolation of S. aureus, hospital or community acquired. Fisher's exact test was applied and p< 0.05 with a confidence interval of 95%, were considered statistically significant.

Results

Eighty one isolates of S. aureus identified by Automated Systems for Susceptibility Testing and were confirmed by Sa442 gene amplification (100%). The distributions of isolates between genders were 48.1% (39/81) for male with an average of 6.2 genes detected and 51.9% (42/81) for female with an average of 4.9 genes. No statistically significant difference (p = 0.37).

Classification of S. aureus isolates according to the type clinical specimen

Clinical isolates of S. aureus were classified according to the type of clinical sample: 23 blood isolates (28.4%), 39 from secretions (48.1%) and 19 clinical specimens were classified as others (23.5%).

Antimicrobial susceptibility in S. aureus isolates Antimicrobial susceptibility indicated that 6 isolates (7.4%) were susceptible to all 12 antimicrobial group's (26 antimicrobials) tested and 75 (92.6%) were resistant to one or more antibiotics. The resistance range varied from 92.6% (75/81) for Beta-Lactam to 1.2% (1/81) to rifamycin. Additionally, 31 isolates was resistant for oxacillin (38.7%) phenotypically classified as MRSA isolates (Table 2).

The prevalence of the 22 genes detected by PCR in the 81 isolates of S. aureus was 95.1% (77/81) and in 4.9% (4/81) no genes were detected. The range of genes detected was at least 2 genes in 11 isolates (13.6%) and up to 13 genes in 6 isolates (7.5%), for an average of 5.9 genes.

The distribution of genes showed 39 genotypes and the genotype gimnou (complete egc cluster) was the most prevalent (16.0%) and associated with other genes (13.6%) followed by sek-seq with 18.4% and 42.0% of the genotypes had different combinations of genes.

The prevalence of individual genes was variable and seg was the most prevalent gene (51.9%), followed by seq (45.7%) and the lowest prevalence was eta (2.5%). No sep, ser or etb genes were detected. The difference was marked between classical enterotoxins with a gene average of 0.44 and with 4.0 for nonclassical genes (Table 3).

Correlation between the presence of superantigen genes and antimicrobial susceptibility

In 6 antimicrobial susceptible isolates 6.2% (5/81) superantigen genes were detected and 1.2% had none. In resistant, 92.6% had them, in the latter case there were no resistant isolates without superantigens. No significant difference (p= 0.074) (Table 4).

Beta-Lactam were the only group that showed statistically significant difference (p <0.05) in the correlation between the superantigens genes and antimicrobial group's susceptibility in S. aureus isolates.

Correlation between the presence of superantigen genes and type of hospital and community isolate

Table 4 shows the detection of superantigen genes according to the origin HA or CA, where 43.2% (35/81) isolates for HA had one or more SAg genes and 59.9% (42/81) of CA isolates had one or more superantigens genes of with statistically significant difference (p= 0.049).

Correlation between the presence of superantigen genes and the type of clinical sample

Of the 23 isolates from blood specimens, 21 (25.9%) had one or more genes with an average of 5.2 superantigen genes. For secretion, of the 39 isolates, 37 (45.7%) genes were detected with an average of 5.8 genes, and for the 19 isolates classified as other specimens, all genes were detected (23.5%) with an average of 6.9 genes. Statistical analysis by Fisher's exact test showed no significant difference (p= 0.566) (Table 4).

Discussion

Staphylococcus aureus is the second most isolated pathogen from infections at the Hospital Universitario San Jorge de Pereira as well as in all the hospitals around Colombia (26). 95.1% of all isolates contained at least one superantigen gene. High prevalence has also been reported by Varshney, et al. 99% 5, Chiang, et al. 91.8% (10), Xie et al. 90.7% (27) and Omoe et al. 77.4% (25).

The prevalence of individual genes varied as reported by other researchers (5,6,10). The most common single gene in the study was seg (51.9%) which also has been reported by other studies (6,10, 25). In Colombia, Portillo et al. (28), found the seg gene at 94% in isolated MRSA.

For other genes, in contrast to Portillo, we detected tsst, sea, seb, sec, seh and sel but not sep, ser andetb genes, this indicates heterogeneity genetic of S. aureus intro the same country. This indicates that the presence of individual genes or associations between them is very diverse in all isolates of S. aureus regardless of origin.

The number of genotypes detected was 39, similar to that reported by Omoe et al. (25), and greater than that reported by Kuroda et al. (9), which allows us to infer that the number of genotypes is variable and dependent to the type of strain and the geographic area from which the isolate proceeded.

The presence of the full egc cluster or in coexistence with other SAgs in this study is consistent with other reports of its prevalence (5,6,12,29) and lower than that reported by Portillo et al. (28), An interesting fact was the detection of the gene couple sekseq (18.5%) associated with phage [phi]-3 followed in frequency the egc cluster; the couple sed-sej encoded on plasmid pIB485 reported by Varshney et al., was not found (5).

Article history:

Received: 26 November 2014

Revised: 15 September 2015

Accepted: 27 January 2016

References

(1.) Larkin EA, Carman RJ, Krakauer T, Stiles BG. Staphylococcus aureus: The toxic presence of a pathogen extraordinaire. Current Medicinal Chemistry. 2009; 16: 4003-19.

(2.) Bronner S, Monteil H, Prevost G. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. FEMS Microbiology Reviews. 2004; 28: 183-200.

(3.) Francois P, Scherl A, Hochstrasser D. Schrenzel J. Proteomic approaches to study Staphylococcus aureus pathogenesis. J Proteomics. 2010; 73: 701-8.

(4.) Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev. 2000; 13: 16-34.

(5.) Varshney AK, Mediavilla JR, Robiou N, Guh A, Wang X, Gialanella P, et al . Diverse enterotoxin gene profiles among clonal complexes of Staphylococcus aureus isolates from the Bronx, New York. Appl Environ Microbiol. 2009; 75(21): 6839-49.

(6.) Holtfreter S, Grumann D, Schmudde M, Nguyen H, Eichler P, Strommenger B, et al. Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J Clin Microbiol. 2007; 45: 2669-80.

(7.) McCormick JK, Yarwood JM, Schlievert PM. Toxic shock syndrome and bacterial superantigens: an update. Ann Rev Microbiol. 2001; 55: 77-104.

(8.) Jarraud S, Peyrat MA, Lim A, Tristan A, Bes M, Mougel C, et al. egc, a highly prevalent operon of enterotoxin gene.forms a putative nursery of superantigens in Staphylococcus aureus. J Immunol. 2001; 166: 669-77.

(9.) Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, Kobayashi I, et al. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet. 2001; 357: 1225-39.

(10.) Chiang YC, Liao WW, Fan CM, Pai WY, Chiou CS, Tsen HY. PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. Int J Food Microbiol. 2008; 121(1): 66-73. 11 * * * *

(11.) Wilson G, Seo KS, Cartwright RA, Connelley T, Chuang Smith ON, Merriman J, et al. A novel core genome-encoded superantigen contributes to lethality of community-associated MRSA necrotizing pneumonia. PLoS Pathog. 2011; 7(10): e1002271.

(12.) Blaiotta G, Fusco V, von Eiff Ch, Villani F, Becker K. Biotyping of enterotoxigenic Staphylococcus aureus by enterotoxin gene cluster (egc) polymorphism and spa typing analyses. Appl Environ Microbiol. 2006; 72(9): 6117-23.

(13.) Lindsay JA, Holden MT Understanding the rise of the superbug: investigation of the evolution and genomic variation of Staphylococcus aureus. Funct Integr Genomics. 2006; 6: 186-201.

(14.) Baba TF, Takeuchi M, Kuroda H, Yuzawa K, Aoki A, Oguchi Y, et al. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet. 2002; 359: 1819-27.

(15.) Ladhani S, Joannou CL, Lochrie DP, Evans RW, Poston SM. Clinical, microbial, and biochemical aspects of the exfoliative toxins causing staphylococcal scalded-skin syndrome. Clin Microbiol Rev.1999; 12: 224-42.

(16.) Plano LR. Staphylococcus aureus exfoliative toxins: how they cause disease. J Invest Dermatol.2004; 122: 1070-77.

(17.) Kondo I, Sakurai S, Sarai Y, Futaki S. Two serotypes of exfoliation and their distribution in staphylococcal strains isolated from patients with scalded-skin syndrome. J Clin Microbiol. 1975; 1: 397-400.

(18.) Ruzickova V, Voller J, Pantucek R, Petras P, Doskar J. Multiplex PCR for detection of three exfoliative toxin serotype genes in Staphylococcus aureus. Folia Microbiol. 2005; 50: 499-502.

(19.) Yamaguchi T, Hayashi T, Takami H, Ohnishi M. Murata T, Nakayama K. et al. Complete nucleotide sequence of Staphylococcus aureus exfoliative toxin B plasmid and identification of a novel ADP-ribosyltransferase, EDIN-C. Infect Immun. 2001; 69: 776071.

(20.) Ferry T, Thomas D, Perpoint T, Lina G, Monneret G, Mohammedi I, et al. Analysis of superantigenic toxin Vbeta T-cell signatures produced during cases of staphylococcal toxic shock syndrome and septic shock. Clin Microbiol Infect. 2008; 14: 546-54.

(21.) Fleischer B, Schrezenmeier H. T cell stimulation by staphylococcal enterotoxins. Clonally variable response and requirement for major histocompatibility complex class II molecules on accessory or target cells. J Exp Med. 1988; 167: 1697-707.

(22.) Martineau F, Picard JR, Roy PR, Ouellette M, Bergeron MG. Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J Clin Microbiol. 1998; 36: 618-23.

(23.) Johnson WM, Tyler SD, Ewan EP, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol. 1991; 29(3): 426-30.

(24.) Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol. 2000; 38: 1032-5.

(25.) Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol Lett. 2005; 246: 191-8. 26

(26.) Briceno DF, Correa A, Torres JA, Pacheco R, Grupo de Resistencia Bacteriana Nosocomial de Colombia Actualizacion de la resistencia a antimicrobianos de bacilos Gram negativos aislados en hospitales de nivel III de Colombia: anos 2006, 2007 y 2008. Biomedica; 2010; 30: 371-81.

(27.) Xie Y, He Y, Gehring A, Hu Y, Li Q, Tu S, Shi X. Genotypes and toxin gene profiles of Staphylococcus aureus clinical isolates from China. PLos One. 2011; 6(12): e744-9.

(28.) Portillo B, Moreno J, Yomayusa N, Alvarez C, Castro B, Escobar J, et al. Molecular epidemiology and characterization of virulence genes of community-acquired and hospital-acquired methicillin-resistan Staphylococcus aureus isolates in Colombia. Int J Inf Dis. 2013; 17: e744-9.

(29.) van Belkum A, Melles DC, Snijders SV, van Leeuwen WB, Wertheim HF, Nouwen JL, et al. Clonal distribution and differential occurrence of the enterotoxin gene cluster, egc, in carriage- versus bacteremia-associated isolates of Staphylococcus aureus. J Clin Microbiol. 2006; 44: 1555-7.

Luisa Fernanda Corredor Arias [1], Jenna Samara Luligo Espinal [2], Jose Ignacio Moncayo Ortiz [2], Jorge Javier Santacruz Ibarra [3], Adalucy Alvarez Aldana [3]

[1] Montana State University. Montana USA.

[2] Centro de Biologia Molecular y Biotecnologia. Facultad de Ciencias de la Salud Universidad Tecnologica de Pereira, Pereira, Colombia.

[3] Facultad de Ciencias de la Salud. Universidad Tecnologica de Pereira, Pereira, Colombia.

Corresponding author:

Jose Ignacio Moncayo Ortiz. MSc. Microbiologia. Universidad Tecnologica de Pereira, Facultad de Ciencias de la Salud. La julita, Apartado Aereo 097.

Telefono: 57-6-3215393 extension 15. Fax: 57-6-3215393 extension 12.

Pereira, Risaralda, Colombia. E-mail: jimo@utp.edu.co
Table 1. Primers, nucleotide sequence and the size of PCR amplification
products.

Gene    Primer sequence (5'- 3')          Size   Reference
                                          (bp)

sea     GGT TAT CAA TGT GCG GGT GG        102       24
        CGG CAC TTT TTT CTC TTC GG
seb     GTA TGG TGG TGT AAC TGA GC        164       24
        CCA AAT AGT GAC GAG TTA GG
sec     AGA TGA AGT AGT TGA TGT GTA TGG   451       24
        CAC ACT TTT AGA ATC AAC CG
sed     CCA ATA ATA GGA GAA AAT AAA AG    278       24
        ATT GGT ATT TTT TTT CGT TC
see     AGG TTT TTT CAC AGG TCA TCC       209       24
        CTT TTT TTT CTT CGG TCA ATC
tst     ACC CCT GTT CCC TTA TCA TC        326       24
        TTT TCA GTA TTT GTA ACG CC
eta     GCA GGT GTT GAT TTA GCA TT         93       24
        AGA TGT CCC TAT TTT TGC TG
etb     ACA AGC AAA AGA ATA CAG CG        226       24
        GTT TTT GGC TGC TTC TCT TG
etd     AAC TAT CAT GTA TCA AGG           376       18
        CAG AAT TTC CCG ACT CAG
seg     AAGTAGACATTTTTGGCGTTCC            287       25
        AGAACCATCAAACTCGTATAGC
seh     GTCTATATGGAGGTACAACACT            213       25
        GACCTTTACTTATTTCGCTGTC
sei     GGTGATATTGGTGTAGGTAAC             454       25
        ATCCATATTCTTTGCCTTTACCAG
sej     ATAGCATCAGAACTGTTGTTCCG           152       25
        CTTTCTGAATTTTACCACCAAAGG
sek     TAGGTGTCTCTAATAATGCCA             293       25
        TAGATATTCGTTAGTAGCTG
set     TAACGGCGATGTAGGTCCAGG             383       25
        CATCTATTTCTTGTGCGGTAAC
sem     GGATAATTCGACAGTAACAG              379       25
        TCCTGCATTAAATCCAGAAC
sen     TATGTTAATGCTGAAGTAGAC             282       25
        ATTTCCAAAATACAGTCCATA
seo     TGTGTAAGAAGTCAAGTGTAG             214       25
        TCTTTAGAAATCGCTGATGA
sep     TGATTTATTAGTAGACCTTGG             396       25
        ATAAC CAAC C GAATCAC CAG
seq     AATCTCTGGGTCAATGGTAAGC            122       25
        TTGTATTCGTTTTGTAGGTATTTTCG
ser     GGATAAAGCGGTAATAGCAG              166       25
        GTATTCCAAACACATCTAAC
seu     ATTTGCTTTTATCTTCAT                167       10
        GGACTTTAATGTTTGTTTCTGAT
fem A   AAAAAAGCACATAACAAGCG              132       24
        GATAAAGAAGAAACCAGCAG
fem B   TTACAGAGTTAACTGTTACC              651       25
        ATACAAATCCAGCACGCTCT

Table 2. Antimicrobial group's susceptibility in S. aureus isolates.
n= 81.

Antimicrobial group        S      %      R      %

Beta-Lactam                6     7.4    75.0   92.6
Chloranphenicol            81    100      0    0.0
Quinolones                 54   66.7    27.7   33.3
Clindamycin                54   66.7    27.7   33.3
Macrolide                  43   53.1    38.1   46.9
Fusidic acid               81    100      0    0.0
Aminoglycoside             56   69.1    25.1   30.9
Nitrofurantoin             81    100      0    0.0
Rifamycin                  80   98.8      1    1.2
Tetracycline               59   72.8    22.8   27.2
Trimethoprim/Sulfonamide   81    100      0    0.0
Glycopeptide               81    100      0    0.0

S = sensivity
R = resistance

Table 3. Profile of superantigen genes distributed as classical,
nonclassical, toxic shock syndrome toxin and exfoliative toxins in
clinical isolates of S. aureus

Variables                    Gene     NP   %

Classical superantigens      sea      9    11.1
                             seb      8    9.9
                             sec      13   16.0
                             sed      3    3.7
                             see      3    3.7
Toxic shock syndrome toxin   tsst-1   5    6.2
Nonclassical superantigens   seg      42   51.9
                             seh      29   35.8
                             sei      36   44.4
                             sej      3    3.7
                             sek      25   30.9
                             set      18   22.2
                             sem      27   33.3
                             sen      36   44.4
                             seo      30   37.0
                             seq      37   45.7
                             seu      41   50.6
Exfoliative toxin            eta      2    2.5
                             etd      34   42.0

Table 4. Relationship between superantigens genes with antimicrobial
susceptibility, hospital or community origin and type of clinical
sample.

Superantigens      Antimicrobial          Acquired place
                  susceptibility

                S    %     R     %     HA     %    CA     %

SAg+            5   6.2   75    92.6   35   43.2   42    51.9
SAg-            1   1.2    0     0.0    4    4.9    0     0.0
Total           6   7.4   75    92.6   39   48.1   42    51.9
P                              0.074                    0.049

Superantigens           Type clinical specimen

                Blood    %     Secretion    %     Other     %

SAg+               21   25.9          37   45.7      19    23.5
SAg-                2    2.5           2    2.5       0     0.0
Total              23   28.4          39   48.1      19    23.5
P                                                         0.566

SAg: superantigen. S: susceptible; R: resistant. HA: Hospital-
Acquired; CA: Community-Acquired. Fisher's exact test.
COPYRIGHT 2016 Facultad de Salud-Universidad de Valle
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Corredor Arias, Luisa Fernanda; Luligo Espinal, Jenna Samara; Moncayo Ortiz, Jose Ignacio; Javier Sa
Publication:Colombia Medica
Article Type:Ensayo
Date:Jan 1, 2016
Words:3888
Previous Article:Evaluacion objetiva de competencias quirurgicas en cirugia minimamente invasiva con una coleccion de pruebas simples.
Next Article:Pequena poblacion de celulas B monoclonales en medula osea como posible herramienta diagnostica en el linfoma oculto primario de parotida.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters