Printer Friendly

Regulation studies of telomerase gene in cancer cells by lentinan.


Lentinan a polysaccharide from medicinal mushroom i.e Lentinus, has been known to have anticancer properties. Telomerase activity is not observed in normal healthy cells, whereas in cancerous cells telomercise expression is high. Telomerose represents a promising cancer therapeutic target. We investigated the inhibitory effect of lentinan on telomerase reverse transcriptase gene (hTERT) which is essential for telomerase activity. To assess the transcriptional effect, DLD -1 cancer cells were cultured in the presence of various concentrations of lentinan. TRAP assay, RT-PCR analysis were performed to find telomercise activity and hTERT gene expression respectively. Since C-myc is known to regulate hTERT, expression of C-myc was also determined. Culturing cells with lentinan resulted in down regulation of hTERT and C-myc expression. These results indicate that lentinan inhibits telomercise activity by down regulating hTERT expression via suppression of C-myc in cancer cells.

Avicenrial Med Biotech 2010; 2(4): 181-185

Keywords: C-myc gene, Gene expression, hTERT, Lentinan, Telomerase


Human telomerase is a ribonucleoprotcin that adds TTAGGG repeats to telornere ends (1). Telomerase activity is not detectable in normal cells, with exception of germ cells and renewal tissues. However, it is present in 80-90% of human cancer specimens (2)

Telornerase comprises three major components i.e. htr (human telomerase RNA component), tpl (telornerase associate protein) and hTERT (human telomcrasc reverse transcriptase) (3), Amongst these three components, hTERT plays a key role in telorncrasc activation. Of the possible regulators C-myc is known to down regulate the expression of hTERT.

Telomerase inhibitors can be divided into two groups (4). One group binds to telomerase and blocks its activity, whereas others are suppressors of mRNA expression of hTERT resulting in altered telomerase activity (5).

Lentinan is a [beta]-glucan with a glycosidic [beta]-1,3:[beta]-1,6 linkage (Figure 1). It is an antitumor polysaccharide from the shiitake (Lentinulaedodes) mushroom. Lentinan is a polysaccharide which is free of nitrogen, and has a molecular weight of approximately 500,000 Da. The Japanese pharmaceutical company Ajinornoto developed Lentinan, which is an intravenously administered anticancer agent. Lentinan is one of the host- mediated anticancer drugs which has been shown to affect host defense immune systems (6). Limited clinical studies of cancer patients have associated lentinan with a higher survival rate, higher quality of life, and lower re-occurrence of cancer (7).


The aim of present study is to determine the effect of lentinan on gene expression regulation of hTERT and C-myc.

Materials and Methods

Lentinan was isolated from lentinusedodes (Yap and Ng, 200 1). DLD-1 gastric cancer cell lines were cultured in RPMI- 1640 medium containing freshly prepared DMSO solution of lentinan at various concentrations (0. 2, 4, 6, 8, 10 [micro]g/ml). The final concentration of DMSO in the medium is 0.1% (v/v). Control cells were grown in medium supplemented with 0.1% DMSO.

Cytotoxicity of cell was evaluated by MTT assay which is based on the conversion of MTT to MTT-formazan by mitochondria I enzymes as previously described (8).

Telomerase activity

Telomerase activity was measured by PCR based TRAP as previously described (9) using TRAPEZE ELLSA telomerase detection kit based protocol (Chemicon, CA, USA).

The brief procedure is as follows: 5 x [10.sup.5] cells per well were seeded in 6-well plate and incubated with lentinan mixture at the above specified concentrations for 48 hrs at 37 [degrees]C. The cell pellet was then cooled on icc lysed with CHAPS lysis (10 mMTris-HCI (pH=7.5). 1 mM MgC12, 1 mM EDTA, 0.1 mM phenylmethyl sulfonylfluoride 5 mM-mercaptoethanol. 0.5% (3-(3-cholamidopropyl) dimethylamino-1-propanesulfonate. and 10% glycerol) buffer for 30 min and centrifuged at 12,000 x g at 4 [degrees]C for 20 min.

The TRAP PCR reaction mixture contains 1 [micro]g of protein from each cell extraction, a mixture of biotinylated TS primer RP primeL internal control (Kiprimer and TSK 1 template). 2.5 mMdNTPs and 2 units Taq DNA polymerase. The PCR was performed for 33 cycles at 94 [degrees]C for 30 see, 55 [degrees]C for 30 see, 72 [degrees]C for 30 sec and followed by final extension at 72 [degrees]C for 10 mm. The PCR product was separated fbr determining the degree ot telomeric repeats (by 10% nondenaturing polyacrylamide gel clectrophoresis) and the telomerase level (by ELISA detection) as described below.

Gene expression of hTER T, C-inyc and [beta]-aclin

After cultivation, total RNA was isolated from cells with total RNA extraction kit (qiagen). RT-PCR was performed as per kit (bio-rad) as per manufactures instructions using following primer (Table 1).
Table 1. List primers

Primers         Sequences(5'-3')           Product length (bp)

hTERT-F         CGGAAGAGTGTCTGGAGCAA                       145


MYC-F           AAGTCCTGCGCCTCGCAA                         249



[beta]-ACTIN-R  CAAACATGATCTGGGTCATCTTCTC                  353

The PCR conditions were as follows: for hTERT and [beta]-actin 35 cycles of denaturation at 95 [degrees]C for 30 see, annealing at 59.2 [degrees]C for 30 sec and extension at 72 [degrees]C for 30 see, respectively.

For C-myc 3 [beta] -actin 30 cycles of denaturation at 95 [degrees]C for 30 sec and extension at 72 'C for 30 see, respectively. PCR products were loaded on 0.8% agarose gel containing ethidium bromide. The product bands were analysed using gene snap software (Syngene. NJ, USA). The relative intensity was calcu-lated by normalizing with [beta] actin.


By MTT assay the percentage of viability was calculated by defining the absorption of cells without lentinan treatment as 100 percent (Figure 2) at 10 [micro]l concentration; also cell viability was observed above 75%.


DLD-1 cells were treated with lentinan at concentration 0,2,4,6,8, 10 [micro]g/ml. Telomerase activity was examined by TRAP assay. Decreased telornerase level WaS interpreted by reduction or disappearance of bands (Figure 3). Telomerase activity was determined by TRAPEZE-ELISA and levels were expressed as % relative activity (Figure 4).



DL.D-lcclls were incubated for 48 lirs at lentinan concentrations of 0,2,4,6,8,10 [micro]g/ml. Effect on gene expression was examined by RT-PCR (Figures 5 and 6). Percentage of band intensities was calculated with the aid of genesnap software (Tables 2 and 3). [beta] actin is internal control of gene expression.



To evaluate the mechanism for telornerase inhibition by lentinan we investigated the effect of hTERT expression in DLD 1 cells using RT-PCR technique. For this, we treated DLD 1 cells with lentinan at concentration 02,4,6,8,10 [micro]g/ml and then examined the telomerase activity by TRAP assay. We observed a decrease in telomerase level by reduction or disappearance of bands (Figure 4) Percentage of band intensities was calculated with the aid of genesnap software (Tables 2 and 3) [deta]-actin is internal control of gene expression. Lcntinan clearly inhibited the expression of hTERT mRNA in dose dependent manner, indicating that telornerase activity is modulated at the transcriptional level. Since C-myc is a known regulator of hTERT we investigated and confirmed that lentinan reduced the expression levels of Cmyc mRNA and hTERT expression (Figure 7). These observations suggest that lentinan decreases the telornerase activity by down regulating the hTERT expression via C-myc.
Table 2. Relative band intensity of hERT gene expression in DLD-1
cells. Results are the average of three independent experiments
(genesnap software)

Concentration  % Relative intensity       Mean [+ or -]   p-value
[mu]g/ml                                  SEM

                   1         2      3

0                     100    100    100    100 [+ or -]

2                   64.64  70.37   96.4   67.7 [+ or -]    0.053

4                   55.39  54.13  72.44  58.80 [+ or -]    0.005

6                   54.85  54.73  71.65  51.32 [+ or -]    0.029

8                   40.53  46.01  50.15  43.20 [+ or -]    0.018

10                  31.49  37.57  35.46  33.27 [+ or -]    0.020

Table 3. Relative band intensity of C-mye gene expression in
DLD-1 cells. Results are the average of three independent

Concentration    % Relative intensity     Mean [+ or -]   p-value
[mu]g/ml                                         SEM

                   1         2      3

0                     100    100    100    100 [+ or -]

2                   96.24  90.43  73.46  86.71 [+ or -]     0.54

4                   90.15  77.11  70.09  63.09 [+ or -]     0.23

6                   71.17  62.42  55.68  63.09 [+ or -]    0.051

8                   54.66  56.44  24.26  45.12 [+ or -]     0.03

10                  37.14  34.81  23.03  31.66 [+ or -]    0.010



Since most cancer cells possess telomerase activity, one probable advantage of telomerase targeted therapy would be its specifcity on telomerase positive tumour cells, because most human somatic tissues are telomerase negative. On the basis of these observations various types of telomerase inhibitors have been discovered and developed. Such inhibitors inctude hTR antigens oligonucleotides (2'-O-methyl RNA and pcptide nucleic acids). (9) Reverse transcriptase inhibitors (ex: 3' azido 3' deoxythymidine) (10) and natural products (ex.tclomestatin and sulfoquinovosyldiacyl glycerol) (11). These inhibitors directly inhibit telomerase activity. Modulators of mRNA expression of telomeral components (i.ehtert) have been regarded as another type of anti telomeral agents. These include all transretonoic acid (12), 5, 6-trans-16 -ene- vitamin D3 (13) ceramide (14) and curcumin (15). These compounds act as supressors of hTERT mRNA expression which results in altered telomerase activity.

According to the previous studies there is a strong correlation between the expression of hTERT mRNA and telornerase activity in extract from culture cells and tissues (16) Modulators of hTERT expression are regarded as anti-telomeral agents. Our results are especially interesting in demonstrating that lentinan down regulates hTERT expression via C-myc (Figure 8). In this study, for the first time, we studied the effect of lentinan on hTERT gene expression.



These studies Provide support for role of lentinan as cliemopreventative agent against cancer cells. Chemoprevention as a scientific field. may be considered still at its infimcy, and includes the use of natural or pharmacological agents to suppress, arrest or reverse carcinogcncsis at its early stages. Natural products like genistein, resveratrol, curcurnin. retinoic acid and epigallocatcchin-3-gallatc are pioved as chemopreventive agents.


Authors are very much thankful to management of KL University, Vijayawada for their encouragement and constant support throughout this research work.


(1.) Morin GB. The human tclomere terminal transferase enzyme is a ribo nucleoprotein that synthesizes TTACiGG repeats. Cell I989;59(3):521-529.

(2.) Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD. HO PLC, et al.Specific association of human telomerase activity with immortal cells and cancers. Science 1994;266:20111-2015.

(3.) Nakanure TM, Morin GB, Chapman KB, Weinrich SL, Andrews WH, Lingner .J, et al. Telomerase catalytic subunit homolgs from fission yeast and human. Science 1977;277(5328):955-959.

(4.) Wu KJ, Grandori C, Amacker M, Simon-Vermot N, Polack A, Lingner J, et al. Direct activation of TERT transcription by C-myc. Nat Genet 1999;21;220-224.

(5.) Eitsuka T, Nakagawa K, Suzuki T, Miyazawa T. Polyunsaturated fatty acids inhibit telomerase activity in DLD-l human colorectal adenocarcinoma cells: a dual mechanism approach. Biochim Biophys Acta 2005;1737(1):1-10.

(6.) Biray Avci C, Dogan ZO, Yilmaz S, Numanoglu S, Topcuoglu N, Gunduz C. Effect of resveratrol and caffeic acid phenethyl ester on the expressions of p53, MDM2, PIK3CA and hTERT in human breast cancer cell line. Adv Mol Med 2007;3(1):45-48.

(7.) Elliott PJ, Jirousek M. Sirluins: novel targets for metabolic disease. Curr Opin Investig Drugs 2008;9(4):371-378.

(8.) Hideshima T, Chauhan D, Shima Y. Raje N. Davies FE, Tai YT, et al. Thalidomide and its analogs overcome drug resistance of human multipe myeloma cells to conventional therapy. Blood 2000:96(9):2943-2950.

(9.) Pitts AF, Corey DR. Inhibition of human telonierase by 2'-0'-mehyl RAN. Proc Natl Acad Sci USA 1998;95(20):11549-11554.

(10.) Strahl C. Blackburn EH.Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized1 cell lines. Mol Cell Biol 1996;16(1):53-65.

(11.) K Darnm. Hemmann U, Gariri-Chesa P. Hauel N, Kauffmann I, priepke H, et al. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J 2001;20(24):6958-6968.

(12.) Meyerson M, Counter CM, Eaton EN, Ellisen LW, Steiner P. CaddLe SD, et al. hEST2, the putative human telomerase catalytic subunit gene, is upregulated in tumor cells and during immortalization.Cell 1997;90(4):785-795.

(13.) Hisatake J, Kuhota T. Hisatake Y, Uskokovic M, Tomoyasu S, Koeffler HP. 5,6-trans-16-ene-Vitamin [D.sub.3]: a new class of potent inhibitors of proliferation of prostate, breast, and myeloid leukemic cells. Cancer Res 1999:59(16):4023-4029.

(14.) Ogretmen B, Kraveka JM, Schandy D, Usta J, Hannum YA, Oheid LM. Molecular mechanisms of ceramide-mcdiatcd telomerase inhibition in the A249 human lung adenocarcinoma cell line. J Biol Chem 2001;276(35):32506-32514.

(15.) Ramachandran C, Fonseca FIB, Jhahvala P. Escalon EA, Melnick Si. Curcumin inhibits telomerase activity through human telomerase reverse transcriptase in MCF-7 breast cancer cell line. Cancer Lett 2002;184(1):1-6.

(16.) Takakura M, Kyo S. Kanaya T, Tanaka M, Inouc M. Expression of human telomerase subunits and correlation with telomerasc activity in cervical cancer. Cancer Res I 998:58(7):1558-1561.

* Corresponding author: Kamma Sreenivasulu, Ph.D., Department of Biotechnology, KL University, Vaddeswciram, India


Received: 18 Sep 2010

Accepted: 9 Dec 2010

Kamma Sreenivasulu (1*), Muvva Vijayalakshmi (2), and Krothapalli RS Samnasivarao (3)

(1.) Department of Biotechnology, KL University, India

(2.) Department of Botany and Microbiology, Acharya Nagarjuna University, India

(3.) Department of Biotechnology, Acharya Nagarjuna University, India
COPYRIGHT 2010 Avicenna Research Institute
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Sreenivasulu, Kamma; Vijayalakshmi, Muvva; Sambasivarao, Krothapalli R.S.
Publication:Avicenna Journal of Medical Biotechnology (AJMB)
Date:Oct 1, 2010
Previous Article:The role of MicroRNAs in human diseases.
Next Article:Cytotoxic activities of silver nanoparticles and silver ions in parent and tamoxifen-resistant T47D human breast cancer cells and their combination...

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters