Printer Friendly

Regulation of Metamorphosis by Environmental Cues and Retinoic Acid Signaling in the Lecithotrophic Larvae of the Starfish Astropecten latespinosus.

Common ancestors of starfish (echinoderms) are believed to have planktotrophic larvae, although some species show lecithotrophic larvae, which do not feed before metamorphosis. Furthermore, some lecithotrophic paxillosidan larvae, such as those of Astropecten latespinosus, lack brachiolar arms, the sensory apparatus for the reception of environmental cues in planktotrophic larvae. In this study, we found that the metamorphosis of A. latespinosus was stimulated when larvae were cultured with natural sand from their habitat. We also found that retinoic acid signaling mediated the metamorphosis process upon environmental stimulation, as in planktotrophic larvae. We examined reagent treatments and gene expression analysis by in situ hybridization. Exogenous retinoic acid treatment induced metamorphosis, whereas retinoic acid synthesis inhibitor or antagonist for retinoic acid receptors suppressed metamorphosis. Retinoic acid signaling-related genes were expressed in juvenile rudiments. In conclusion, we propose that the reception of particular environmental cues is required for the metamorphosis of lecithotrophic larvae.

Many marine invertebrates have biphasic life cycles, with planktonic larval and sessile adult phases (1). Because sessile adults have restricted motility, the settling of larvae in suitable environments during metamorphosis is of critical importance (2). Therefore, planktonic larvae usually possess sensory apparatuses to respond to specific environmental cues (2).

The ancestors of starfish (echinoderms) are believed to have planktotrophic larvae (3-5). Planktotrophic larvae need to be fed to commence metamorphosis; thus, their development proceeds depending on the larval nutritional state (6). Some species change their strategies and develop through lecithotrophic larvae (3-5). In contrast to that of planktotrophic larvae, the development of lecithotrophic larvae proceeds in a cascade-like manner because they do not feed before metamorphosis (4, 5). However, whether these lecithotrophic larvae sense environmental cues to commence metamorphosis is not clear.

After lecithotrophy, some starfish species retain their sensory apparatus, brachiolar arms (4). Many planktotrophic starfish larvae use their brachiolar arms to sense environmental cues about where to settle (7). This suggests that these species have continued to sense environmental cues, even after their transition to lecithotrophy. Some lecithotrophic paxillosidan species, such as Astropecten latespinosus Meissner, 1892, however, do not possess brachiolar arms (8-10).

Here we investigated whether lecithotrophic larvae could sense environmental cues by testing whether larvae of A. latespinosus commenced metamorphosis in seawater containing sand from the habitat of adult specimens. During this experiment, we also investigated when larvae became competent for metamorphosis. Previously, Komatsu (8) stated that larvae began to develop juvenile rudiments at around 30 hours post-fertilization (hpf), after the gastrula elongated along the archenteron (Fig. A1b) (8). Juvenile rudiment development then proceeded until about 72-96 hpf (Fig. A1c, d) (8). Komatsu (8) reported that larvae metamorphosed to juveniles after 75 hpf (Fig. A1e, f), although she did not experimentally examine the time to acquisition of competency (8).

We collected adult specimens of A. latespinosus from Notojima Island, Ishikawa Prefecture, Japan; and we obtained fertilized eggs as described previously (8). We introduced the habitat sand to the wells of the 24-hpf larvae, corresponding to gastrula (n = 50 from 3 batches; Fig. A1a). Then we cultured larvae and every day for one week counted the number of larvae that completed metamorphosis. We considered the ability to induce metamorphosis to have been achieved when the whole larval body had been absorbed and the juvenile rudiment had developed (Fig. A1). For statistical analysis, we used ANOVA to evaluate differences in the effects of the substrate on metamorphosis, as used in our previous work (11).

In the seawater without substrate, larvae did not metamorphose before 72 hpf (Fig. 1; Table A1). Small numbers of larvae (5 of 50 larvae) metamorphosed into juveniles after 96 hpf (Fig. 1; Table A1), although the metamorphosis ratio was less than 50% (21 of 50 larvae; Fig. 1; Table A1). However, when substrates were added to the seawater, small numbers of larvae (7 of 50 larvae) were induced to metamorphose even at 72 hpf (Fig. 1; Table A1). More than 70% of larvae (36 of 50 larvae) metamorphosed after 96 hpf (Fig. 1; Table A1). At 192 hpf, significant differences in the metamorphosis ratios were observed between treatments (P = 0.009, ANOVA). These results indicated that A. latespinosus can sense environmental cues, such as natural sand, to commence metamorphosis. We also found that most of the larvae metamorphosed at 72-96 hpf (Fig. 1), suggesting that they became competent around 72 hpf.

In planktotrophic larvae of starfish, Murabe et al. (7) found that brachiolar arms perform a critical role in receiving environmental cues for metamorphosis (7). Recently, we suggested that retinoic acid (RA) signaling mediated the commencement of the metamorphosis process after settlement (11), through RA synthesis by retinal dehydrogenase (RALDH) and binding to retinoic acid receptor (RAR) and retinoid X receptor (RXR) (12). As shown, we found that paxillosidan larvae also received environmental cues to commence metamorphosis, though they use different apparatuses from brachiolar arms for reception; thus, it is unclear whether RA signaling involves metamorphosis regulation in this group.

Here we examined whether the commencement of metamorphosis was also mediated by RA signaling in A. latespinosus. First, we investigated the effect of exogenous RA treatment of competent larvae (n = 40 from 3 batches). Because more than half of 72-hpf larvae treated with habitat sand completed metamorphosis in 24 hours (Fig. 1), we tested the effect of exogenous RA on 72-hpf larvae. We found that exogenous RA (1 [micro]mol [L.sup.-1]) treatment induced metamorphosis (32 of 40 larvae; Fig. 2a, c; Table A2). The larvae commenced metamorphosis immediately after treatment and completed their transitions to juveniles in 24 hours. In contrast, only 1 out of 40 dimethyl sulfoxide (DMSO)-treated larvae metamorphosed (Fig. 2b, c; Table A2). We observed that the presence of RA significantly affected the metamorphosis ratio (P < 0.001, ANOVA). These results suggest that RA mediates internal signaling to commence the metamorphosis of A. latespinosus.

Additionally, we investigated the effect of exogenous RA treatment of larvae of various ages on metamorphosis in order to test whether RA also affected the timing of larval competence to respond to cues for metamorphosis. We treated 24-and 48-hpf larvae with RA (1 [micro]mol [L.sup.-1]) and counted the number of metamorphosed larvae every 24 hours until 96 hpf (n = 30 and 40 from 3 batches, respectively). We observed that metamorphosis was induced only after 72 hpf in both cases (3 of 30 and 2 of 40 with 24- and 48-hpf initiations, respectively; Fig. 2d, e; Tables A3, A4). Thus, regardless of when the larvae were treated with RA, they responded and metamorphosed at 72 hpf, which is comparable to the stage at which larvae acquire competence to metamorphose during normal development (Figs. 1, 2d, e). Furthermore, at 96 hpf, almost half of the larvae metamorphosed (15 of 30 and 19 of 40 from 3 batches with 24- and 48-hpf initiations, respectively; Fig. 2d, e; Tables A3, A4). We found significant differences at 96 hpf in the batches with 24- and 48-hpf initiations (P = 0.034 and P = 0.019, respectively, ANOVA). These timelines are similar to those induced by a substrate (Fig. 1). These results suggest that RA does not affect the development of competence for metamorphosis, but rather functions as an internal mediator of the signaling to commence metamorphosis when added to competent larvae.

Next, we investigated whether endogenous RA synthesis is required for metamorphosis. To investigate the effect of treatment with DEAB (N,N-diethylaminobenzaldehyde), an RA synthesis inhibitor, on metamorphosis, we treated 72-hpf larvae with DEAB (300 [micro]mol [L.sup.-1]) and natural sand in the experiments described above; and we counted the larvae that had completed metamorphosis 24 hours after treatment (n = 40 from 3 batches). As a control, we treated 72-hpf larvae with DMSO and natural sand. More than half of the DMSO-treated larvae transitioned to juveniles (26 of 40 larvae; Fig. 3b, c; Table A5). In contrast, DEAB treatment decreased the number of metamorphosed larvae (6 of 40 larvae; Fig. 3a, c; Table A5). The metamorphosis ratio was significantly suppressed by DEAB treatment (P = 0.022, ANOVA). We observed particular larval behavior in the DEAB treatment prior to metamorphosis, such as attachment to the substrate with rudiments. Thus, larvae were likely to sense the environmental cue but did not commence metamorphosis. These findings suggest that endogenous RA synthesis is required for the commencement of metamorphosis.

RA binding to RAR is required for RA signaling activation (12). Thus, we investigated the effect of RAR antagonist treatment on metamorphosis to test the hypothesis that RA signaling pathways mediate the metamorphosis process. We treated 72-hpf larvae (n = 40 from 3 batches) with RO41-5253 (RO, Focus Biomolecules, Plymouth Meeting, PA; 1 [micro]mol [L.sup.-1]), RAR antagonist, and the natural sand used above; and we counted the number of metamorphosed larvae after 24 hours. As a control, we treated 72-hpf larvae with DMSO and natural sand. Under the DMSO treatment, 67.5% of larvae (27 of 40 larvae) transitioned to juveniles (Fig. 3e, f; Table A6). In contrast, no larva metamorphosed under the RO treatment (Fig. 3d, f; Table A6). The metamorphosis ratio was significantly repressed by RO treatment (P = 0.008, ANOVA). As we observed with DEAB treatment, larvae also stopped floating and attached to the substrate with rudiments after RO treatment.

As shown previously, exogenous RA treatment induces metamorphosis in 72-hpf larvae (Fig. 2). To support the idea that RA binding to RAR is required for metamorphosis, we examined whether RO treatment blocked metamorphosis induced by RA treatment. We treated 72-hpf larvae (n = 40 from 3 batches) with RA (1 [micro]mol [L.sup.-1]) or RA (1 [micro]mol [L.sup.-1]) plus RO (1 [micro]mol [L.sup.-1]). In the RA-only treatment, 77.5% of larvae (31 of 40 larvae) metamorphosed (Fig. 3g-i; Table A7). Conversely, the RA (1 [micro]mol [L.sup.-1]) plus RO (1 [micro]mol [L.sup.-1]) treatment induced metamorphosis in only 12.5% of larvae (5 of 40 larvae; Fig. 3h, k; Table A7). RO significantly repressed the metamorphosis ratio (P < 0.001, ANOVA). These data suggest that RA signaling activation through RA binding to RAR is required for the commencement of metamorphosis.

We examined the expression patterns of genes involved in RA signaling. We confirmed their orthologies by constructing phylogenic trees (Figs. A2-A5). In conclusion, from our de novo transcriptome, we identified three raldh genes (raldha, raldhb, and raldhc), a single rar, and a single rxr. We also investigated the spatial expression patterns of the three raldh genes, rar, and rxr by whole-mount in situ hybridization of 72-hpf larvae (Fig. 4). We identified the expression of two types of receptor, rar and rxr, in the juvenile rudiment (Fig. 4j-1 and m--o, respectively), as well as that of raldha, raldhb, and raldhc (Fig. 4a-c, d-f, and g-i, respectively). Especially in the juvenile rudiment, all genes were expressed in the epidermis region in a different expression pattern: patchwise expression of raldh genes and broad expression of rar and rxr (Fig. 4c, f, i, 1, o). We also found that all genes except raldhc were expressed in hydrolobes (primordium of primary podia and tube feet; Fig. 4c, f, 1, o). These expression patterns were consistent with the idea that hydrolobes are used for sensation of environmental cues in Paxillosida (13, 14). These data support the conclusion that RA signaling mediates the metamorphosis process in A. latespinosus.

Here we provided the evidence that metamorphosis is triggered by environmental cues in A. latespinosus larvae. When we introduced natural sand from the A. latespinosus habitat, the larvae stopped floating, became attached to the substrate, and commenced metamorphosis (Fig. 1). Furthermore, our data suggested that RA signaling mediated the commencement of metamorphosis upon environmental cue reception. Exogenous RA treatment of competent larvae induced metamorphosis (Fig. 2), and metamorphosis was suppressed by the inhibition of two distinct RA signaling pathways (Fig. 3): RA synthesis (Fig. 3a-c) and RA binding to RAR (Fig. 3d-i). The spatial expression pattern of RA signaling-related genes is consistent with the results described above (Fig. 4). Particularly, overlapping expression of two kinds of receptor (rar and rxr) was observed in juvenile rudiments of competent larvae (Fig. 4j-l and m-o, respectively). It should be noted that we did not examine the gene function analysis in this study. To strengthen our hypothesis, future study should focus on the function of each regulatory component.

Planktonic starfish larvae sense environmental cues for metamorphosis with brachiolar arms (7); but paxillosidan larvae, even those that are planktonic, lack brachiolar arms (4, 14). This absence is regarded as a secondary loss due to the transition to a sandy habitat (15). In this study, we found that metamorphosis of A. latespinosus is induced by culture with natural sand from its habitat, suggesting that paxillosidan larvae also respond to environmental cues for metamorphosis. Despite our findings, how paxillosidan larvae sense environmental cues remains unclear.

Previously, several researchers suggested that tube feet (primary podia) are used as the sensory apparatus for the reception of environmental cues in this group (13, 14). Yet Komatsu (8) and Oguro et al. (16) stated that tube feet did not appear before metamorphosis was mostly completed in A. latespinosus and Astropecten scoparius (8, 16). Whether larvae sense environmental cues with this structure is difficult to judge based on hydrolobe morphology. We suggest that researchers' attention be broadened to juvenile structures in efforts to identify the sensory apparatus for environmental cue detection in paxillosidan species.

Acknowledgments

Our work was supported by Japan Society for the Promotion of Science KAKENHI (Grant-in-Aid for Scientific Research) grants 15KT0074 and 18H04004. We thank the Ibaraki Prefectural Oarai Aquarium for providing the seawater for culturing of adult starfish.

Data Accessibility

We deposited the gene sequences (raldha, raldhb, raldhc, rar, and rxr) in the DNA Data Bank of Japan (DDBJ; LC485972, LC485973, LC485974, LC485975, LC485976). We also supply the dataset for phylogenetic analysis in supplementary datasets 1 and 2 (available online). The raw reads of transcriptomes are available from the DDBJ Sequence Reads Archives (DRA008444).

Literature Cited

(1.) Jagersten, G. 1972. Evolution of the Metazoan Life Cycle. Academic Press, London.

(2.) Morse, D. E. 1990. Recent progress in larval settlement and metamorphosis: closing the gaps between molecular biology and ecology. Bull. Mar. Sci. 46: 465-483.

(3.) Oguro, C. 1989. Evolution of the development and larval types in asteroids. Zoo/. Sci. 6: 199-210.

(4.) McEdward, L. R., and B. G. Miner. 2001. Larval and life-cycle patterns in echinoderms. Can. J. Zool. 79: 1125-1170.

(5.) Byrne, M. 2006. Life history diversity and evolution in the Asterinidae. Integr. Comp. Biol. 46: 243-254.

(6.) McEdward, L. R. 1997. Reproductive strategies of marine benthic invertebrates revisited: facultative feeding by planktotrophic larvae. Am. Nat. ISO: 48-72.

(7.) Murabe, N., H. Hatoyama, M. Komatsu, H. Kaneko, and Y. Na-kajima. 2007. Adhesive papillae on the brachiolar arms of brachiolaria larvae in two starfishes, Asterina pectinifera and Asterias amurensis, are sensors for metamorphic inducing factor(s). Dev. Growth Differ. 49: 647-656.

(8.) Komatsu, M. 1975. On the development of the sea-star, Astropecten latespinosus Meissner. Biol. Bull. 148: 49-59.

(9.) Komatsu, M. 1982. Development of the sea-star Ctenopleura fisheri. Mar. Biol. 66: 199-205.

(10.) Komatsu, M., and S. Nojima. 1985. Development of the seastar, Astropecten gisselhrechti Doderlein. Pat: Sci. 39: 274-282.

11 Yamakawa, S., Y. Morino, M. Honda, and H. Wada. 2018. The role of retinoic acid signaling in starfish metamorphosis. EvoDevo 9: 10.

(12.) Rhinn, M., and P. Dolle. 2012. Retinoic acid signalling during development. Development 139: 843-858.

(13.) Byrne, M. 2013. Asteroid evolutionary developmental biology and ecology. Pp. 51-58 in Starfish Biology and Ecology of the Asteroidea. J. M. Lawrence, ed. John Hopkins University Press, Baltimore.

14 Pernet, B., B. T. Livingston, C. Sojka, and D. Lizarraga. 2017. Embryogenesis and larval development of the seastar Astropecten armatus. lnvertebr. Biol. 136: 121-133.

(15.) Linchangco, G. V., D. W. Foltz, R. Reid, J. Williams, C. Nodzak, A. M. Kerr, A. K. Miller, R. Hunter, N. G. Wilson, W. J. Nielsen et al. 2017. The phylogeny of extant starfish (Asteroidea: Echinodermata) including Xyloplax. based on comparative transcriptomics. Mot Phylogenet. Evol. 115: 161-170.

(16.) Oguro, C, M. Komatsu, and Y. T. Kano. 1976. Development and metamorphosis of the sea-star, Astropecten scoparius Valenciennes. Biol. Bull. 151: 560-573.

(17.) Morino, Y., H. Koga, K. Tachibana, E. Shoguchi, M. Kiyomoto, and H. Wada. 2012. Heterochronic activation of VEGF signaling and the evolution of the skeleton in echinoderm pluteus larvae. Evol. Dev. 14:428-436.

(18.) Tanabe, A. S. 2011. Kakusan4 and Aminosan: two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Mot Ecol. Resour. 11: 914-921.

(19.) Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinfonnalics 19: 1572-1574.

Appendix
Table A1
Number of metamorphosed/treated larvae of each batch under seawater
with and without substrate

                                              Number of metamorphosed
                                              /treated larvae
                              Substrate (+)
                Batch 1        Batch 2         Batch 3        Batch 1
Age (hpf)   Well 1   Well 2   Well 1   Well 2   Well 1   Well 1   Well 2

 48         0/10     0/10     0/10     0/10     0/10     0/10     0/10
 72         2/10     3/10     0/10     1/10     1/10     0/10     0/10
 96         8/10     8/10     7/10     8/10     4/10     0/10     1/10
120         8/10     8/10     7/10     8/10     4/10     2/10     2/10
144         8/10     8/10     8/10     8/10     4/10     3/10     2/10
168         8/10     8/10     8/10     8/10     4/10     3/10     4/10
192         8/10     8/10     8/10     8/10     4/10     3/10     4/10

                   Substrate (--)
Age (hpf)        Batch 2      Batch 3
            Well 1   Well 2   Well 1

 48         0/10     0/10     0/10
 72         0/10     0/10     0/10
 96         2/10     1/10     1/10
120         2/10     3/10     2/10
144         6/10     4/10     4/10
168         6/10     4/10     4/10
192         6/10     4/10     4/10

hpf, hours post-fertilization.

Table A2
Number of metamorphosed larvae/treated larvae of each batch in retinoic
acid (RA) or dimethyl sulfoxide (DMSO) treatment

            Number of metamo rphosed/treated larvae
            Batch 1          Batch 2   Batch 3
Treatment   Well 1   Well 2  Well 1    Well 1

RA          8/10     8/10    7/10      9/10
DMSO        1/10     0/10    0/10      0/10

Table A3
Number of metamorphosed larvae/treated larvae of each batch in retinoic
acid (RA) or dimethyl sulfoxide (DMSO) treatment in the case that
treatment was commenced at 24 hours postfertilization (hpf)

                      Number of metamorphosed/treated larvae
                      RA                             DMSO
            Batch 1   Batch 2   Batch 3   Batch 1   Batch 2   Batch 3
Age (hpf)   Well 1    Well 1    Well 1    Well 1    Well 1    Well 1

48          0/10      0/10      0/10      0/10      0/10      0/10
72          0/10      1/10      2/10      0/10      0/10      0/10
96          3/10      6/10      6/10      0/10      0/10      1/10

Number of metamorphosed/treated larvae of each batch under seawater
with and without substrate

Table A4
Number of metamorphosed larvae/treated larvae of each batch in retinoic
acid (RA) or dimethyl sulfoxide (DMSO) treatment in the case that
treatment was commenced at 48 hours post-fertilization (hpf)

                            Number of metamorphosed/treated larvae
                            RA                               DMSO
               Batch 1        Batch 2  Batch 3       Batch 1
Age (hpf)   Well 1   Well 2   Well 1   Well 1    Well 1   Well 2

72          1/10     0/10     0/10     1/10      0/10     0/10
96          7/10     2/10     5/10     5/10      0/10     0/10

            Batch 2   Batch 3
Age (hpf)   Well 1    Well 1

72          0/10      0/10
96          0/10      0/10

Table A5
Number of metamorphosed larvae/treated larvae of each batch in DEAB or
dimethyl sulfoxide (DMSO) treatment

                Number of metamorphosed/treated larvae
                Batch 1       Batch 2   Batch 3
Treatment   Well 1   Well 2   Well 1    Well 1

DEAB        0/10     4/10     2/10      0/10
DMSO        6/10     9/10     8/10      3/10

Table A6
Number of metamorphosed larvae/treated lan'ae of each batch in
R041-5253 (RO) or dimethyl sulfoxide (DMSO) treatment

                   Number of metamorphosed/treated larvae
                  Batch 1     Batch 2   Batch 3
Treatment   Well 1   Well 2   Well 1    Well 1

RO          0/10     0/10     0/10      0/10
DMSO        8/10     8/10     9/10      2/10

Table A7
Number of metamorphosed larvae/treated larvae of each batch in retinoic
acid (RA) or retinoic acid plus R041-5253 (RA+RO) treatment

                     Number of metamorphosed/treated larvae
                     Batch 1   Batch 2   Batch 3

Treatment   Well 1   Well 2    Well 1    Well 1
RA          8/10     8/10      9/10      6/10
RA+RO       1/10     2/10      1/10      1/10

Table A8
Sequences of primer for amplification of raldha, raldhb, raldhc, rar,
and rxr

         Forward primer (5'[right arrow]3')

raldha   gcaaccgatcgtcttcagaaggcacacatt
raldhb   accatcaatccggcaactggggagaagata
raldhc   gacggtgatttcttctgctactcccgctac
rar      gcgttacaccaaggtcccaacaacatgtcc
rxr      gtaaaggtcggcattctcctgaccagtgct

         Reverse primer including T3 promoter region (5'[right arrow]3')

raldha   ATTAACCCTCACTAAAGGGAgcagaaaccacgtcttgtat
raldhb   ATTAACCCTCACTAAAGGGAatattcataaaacgcacaca
raldhc   ATTAACCCTCACTAAAGGGAtagttgttgacccagatcac
rar      ATTAACCCTCACTAAAGGGAtacatggcatgaagtgttga
rxr      ATTAACCCTCACTAAAGGGAatcagcttgaagaagaagag

We used 40-bp reverse primers, including a 20-bp T3 promoter sequence,
to synthesize Digoxigenin (Dig)-labeled RNA probes for in situ
hybridization. Capital letters indicate the consensus sequence for the
T3 promoter.

Table A9
Accession numbers for the genes used for phvlogenic analysis

Species                             Gene            Accession number

Hs, Homo sapiens                    aldhlal         P00352.2
                                    aldhlal         094788
                                    aldhla3         P47895
                                    aldhlbl         P30837
                                    aldhl           P05091
                                    aldhial         P30838
                                    aldh3a2         P51648
                                    aldhibl         P43353
                                    aldh3b2         P48448
                                    aldh4al         P30038
                                    aldh5al         P51649
                                    aldh6al         002252
                                    aldh7al         P49419
                                    aldh8al         Q9H2A2
                                    aldh9al         P49189
Mm. Mus musculus
Xt, Xenopus tropicalis              aldhlal         Q4VBE1
                                    aldhla2         Q9DEX5
                                    aldhlai         F7BV06
                                    aldhlbl         F7DQF8
                                    aldh2           Q6DJ49
                                    aldh3a2         B1WBI3
                                    aldh3b2         F6X8Y6
                                    aldh4al         A4QNJ0
                                    aldh[delta]al   F6QFQ2
                                    aldh[beta]al    F6SRL8
                                    aldh7al         F7BQF6
                                    aldhSal         F6UH88
                                    aldh9al         F6VC33
Dr, Danio rerio                     aldhla2         Q90XS8
                                    aldhla3         Q0H2G3
                                    aldh2a          Q8QGQ2
                                    aldh2b          Q6TH48
                                    aldh3al         X1WBM4
                                    aldh3a2a        A0A2R8PW97
                                    aldh3a2b        E9QH31
                                    aldhSbl         Q90ZZ7
                                    aldh4al         Q7SY23
                                    aldhSal         A0A0R4IIB7
                                    aldh[beta]al    Q6DHT4
                                    aldhJal         Q803R9
                                    aldhSal         Q66I21
                                    aldh9alal       Q7ZVB2
                                    aldh9ala2       BOS7W5
                                    aldh9alb        Q802W2
Bf, Branchiostoma floridae          aldhla_1        C3ZGK4
                                    aldhla_2        C3ZG63
B1. Branchiostoma lanceolatum
Ci, Ciona intestinalis              aldhlaj         AOA1W2WB51
                                    aldhlaj         A0A1W5BCT1
                                    aldhlaj         A0A1W2WDC1
                                    aldh.2          AOA1W5B7N8
Pm, Polyandrocarpa misakiensis
Sk, Saccoglossus kowalevskii        aldhla_1        XP_006823779.1
                                    aldhla_2        XP_006822197.1
                                    aldhla_3        XP_002736989.1
                                    aldhla_4        XP_002731204.1
                                    aldhla_5        XP_006824634.1
                                    aldh2           XP_006816163.1
Sp, Strongylocentrotus purpuratus   aldh2_1         SPU_007284
                                    aldh2_2         SPU_023801
                                    aldh5al_1       SPU_007492.1
                                    aldh5al_2       SPU_016767.1
                                    aldh6al         SPU_026493.1
                                    aldh7           SPU_024895.3a
                                    aldh8al1_1      SPU_017403.1
                                    aldh8a_2        SPU_000522.1
                                    aldh9           SPU_002901.3a
Pp. Patiria pectinifera             raldha          LC379260
                                    raldhb          LC379261
                                    raldhc          LC379262
                                    aldh2            (*)
Al, Astropecten latespinosus        raldha          LC485972
                                    raldhb          LC485973
                                    raldhc          LC485974
Dm, Drosophila melanogaster
Rc, Reishia clavigera
Ls, Lymnaea stagnalis
Tc, Tripedalia cystophora

Species                             Gene   Accession number

Hs, Homo sapiens                    thra   P10827
                                    thrb   P10828
                                    rara   P10276
                                    rarb   P10826
                                    rarg   P13631
                                    rxra   P19793
                                    rxrb   P28702
                                    rxrg   P48443
Mm. Mus musculus                    thra   P63058
                                    thrb   P37242
                                    rara   P11416
                                    rarb   P22605
                                    rarg   P18911
                                    rxra   P28700
                                    rxrb   P28704
                                    rxrg   P37238
Xt, Xenopus tropicalis
Dr, Danio rerio                     thraa  Q98867
                                    thrab  U3JAT9
                                    thrb   Q9PVE4
                                    raraa  Q90271
                                    rarab  Q7ZTI3
                                    rarga  Q91392
                                    rargb  A2T928
Bf, Branchiostoma floridae          rxr    Q8MX78
B1. Branchiostoma lanceolatum       rar    O18608
Ci, Ciona intestinalis              rar    Q4H2W1
                                    rxr    Q4H2U9
Pm, Polyandrocarpa misakiensis      rxr    K7ZLP3
Sk, Saccoglossus kowalevskii        rar    XP_002742241.1
                                    rxr    D2XNK4
Sp, Strongylocentrotus purpuratus   thr    SPIL025239
                                    rar    SPU_016523
                                    rxr    SPU_028422
Pp. Patiria pectinifera             rar    LC379258
                                    rxr    LC379259
                                    thr     (*)
Al, Astropecten latespinosus        rar    LC485975
                                    rxr    LC485976
Dm, Drosophila melanogaster         usp    P20153
Rc, Reishia clavigera               rar    T2HRZ4
                                    rxr    E9RHD8
Ls, Lymnaea stagnalis               rar    D5LIR6
                                    rxr    Q5I7G2
Tc, Tripedalia cystophora           rxr    096562

(*) Sequences were not deposited to Databank but are available from
supplementary datasets 1 or 2 (available online).


SHUMPEI YAMAKAWA (*), YOSHIAKI MORINO, MASANAO HONDA, AND HIROSHI WADA

Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba 305-8572, Japan

Received 17 April 2019; Accepted 23 August 2019; Published online 10 December 2019.

(*) To whom correspondence should be addressed. Email: shumpei .yamakawa@gmail.com.

Abbreviations: ALDH, aldehyde dehydrogenase; DDBJ, DNA Data Bank of Japan; DEAB, N,N-diethylaminobenzaldehyde; DMSO, dimethyl sulfoxide; hpf, hours post-fertilization; RA, retinoic acid; RALDH, retinoic acid synthesis by retinal dehydrogenase; RAR, retinoic acid receptor; RXR, retinoid X receptor; RO, R041-5253.

Online enhancements: data files.

DOI: 10.1086/706039
COPYRIGHT 2019 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Yamakawa, Shumpei; Morino, Yoshiaki; Honda, Masanao; Wada, Hiroshi
Publication:The Biological Bulletin
Date:Dec 1, 2019
Words:4041
Previous Article:Shinya Inoue: A Long Career Advancing Microscopy and Cell Biology (1921-2019).
Next Article:Developmental Consequences of Temperature and Salinity Stress in the Sand Dollar Dendraster excentricus.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters