Printer Friendly

Regiones del cromosoma 5 asociadas a caracteristicas de crecimiento en ganado criollo romosinuano.

CHROMOSOMAL 5 REGIONS ASSOCIATED WITH GROWTH TRAITS IN THE ROMOSINUANO CREOLE CATTLE

INTRODUCCION

El objetivo de los metodos del analisis genomico modernos para especies de importancia en la ganaderia se fundamenta en la identificacion de regiones cromosomales llamadas loci de rasgos cuantitativos (QTL) responsables por la variacion en el fenotipo tanto de la produccion como de la calidad de las canales en las especies de importancia zootecnica. Esta metodologia se ha convertido en una herramienta de apoyo a los programas de mejoramiento tradicionales ya que puede ser aplicada a edades tempranas en los animales (1).

Las caracteristicas cuantitativas mas importantes en produccion animal estan bajo el control de varios genes y algunos de ellos ejercen un mayor o menor efecto sobre estos rasgos bajo la influencia del medioambiente. Ademas, otros aspectos importantes para tener en cuenta son las tasas de mutacion de los genes tanto dentro y entre poblaciones y sus mecanismos de accion (2).

varios estudios han identificado QTL para el peso al nacimiento en cinco cromosomas bovinos: BTA2 (3), BTA3 (3, 4), BTA5 (3, 4, 5, 6), BTA6 (4, 7, 8) y BTA21 (3, 4, 8). en el cromosoma 5 tambien se han identificado QTL con efectos significativos para otras caracteristicas productivas como son el porcentaje de ovulacion (9, 10), la calidad de la canal (4, 7, 11) y el crecimiento.

En el estudio reportado por Li et al. (5) en dos lineas sinteticas de ganado Beefbooster se identificaron tres regiones cromosomales del BTA5 (0 a 30 cM, 55 a 70 cM, y 70 a 80 cM) asociados con peso al nacimiento, ganancia diaria predestete y ganancia diaria durante la alimentacion (eficiencia alimentaria) utilizando 16 marcadores; en este trabajo alcanzaron un cubrimiento del 93% del cromosoma con una extension de 114 cM. en un trabajo posterior estos mismos investigadores (12), analizando caracteristicas de crecimiento en las regiones previamente identificadas, en dos lineas comerciales de individuos Bostaurus encontraron asociacion entre polimorfismos de nucleotido simple (SNP) de dos genes candidatos, el factor miogenico 5 (MYF5) y el factor de crecimiento insulinico 1 (IGF1).

De la misma manera, Casas et al. (3), en cruces de ganados Bos indicus x Bos taurus, identificaron varios QTL en el BTA5 relacionados con caracteristicas de crecimiento (peso al nacimiento) en la region de 30 a 70 cM y de la composicion de las canales (area del ojo del lomo y peso de la canal en caliente) a los 29-74 cM. Para la caracteristica de peso al nacimiento varios autores han reportado QTL en este mismo cromosoma como Kim et al. (4), en una poblacion de AngusxBrahman en la region de 45,5 cM a 71,6 cM; Machado et al. (6), en la raza Canchim a los 82,6 cM, y Gasparin et al. (13), en un cruce de GyrxHolandes a los 69 cM.

En el BTA5 tambien se han reportado dos QTL para la caracteristica de peso a los doce meses a los 45,5 a 71,6 cM (4) y 76,18 cM (6).

En la literatura solo se encuentra un estudio de asociacion entre marcadores y peso al nacimiento llevado a cabo por Ariza et al. (14), quienes en el cromosoma cinco de la raza romosinuano identificaron dos marcadores tipo microsatelite (BMS772 y BM2830), y encontraron una asociacion significativa con un efecto positivo para el marcador BMS772 con peso al nacimiento en los homocigotos mientras que el marcador BM2830 mostro un mayor peso promedio al nacimiento en los heterocigotos.

El objetivo del presente estudio fue identificar QTL que tengan efecto sobre las caracteristicas de crecimiento a partir de la construccion de un mapa de ligamiento para determinar el orden de los marcadores de los genes factor miogenico 5 (MYF5), fosfodiesterasa calmodulin estimuladora de los nucleotidos ciclicos (PDE1B) y el factor de crecimiento insulinico 1 (IGF1), y los microsatelites BM6026, CssM34, RM500, ETH10 para el cromosoma 5 bovino (BTA5) en una poblacion de la raza romosinuano.

MATERIALES Y METODOS

El estudio se realizo en el Centro de investigacion Turipana de Corpoica (Cerete, Cordoba, Colombia), con una altura de 17 msnm. se evaluaron 72 progenies de la raza romosinuano, dentro de un diseno de medios hermanos paternos distribuidos en 12 familias (12 padres). Los registros fenotipicos de peso se tomaron de las bases de datos de la granja teniendo en cuenta peso y fecha al nacimiento, peso y edad al destete, peso a los 12 meses, y peso y edad al dia de la evaluacion ecografica. Ademas, se tuvo en cuenta la identificacion del padre (numero del padre), la identificacion de la madre (numero de la madre y numero de partos), el ano de nacimiento del ternero (2003 o 2004), y la epoca de nacimiento del ternero (verano o invierno). Las medidas fenotipicas evaluadas por ultrasonido fueron: el area de ojo del lomo (AOL), el espesor de grasa dorsal (EG) y el espesor de grasa en el anca (P8). Las medidas se tomaron previo ayuno de 12 horas con un ecografo marca Aquila equipado con sonda de 18 cm, AsP 3,5 MHz (Pie-medical vet., Holanda) y con una almohadilla de acople anatomico. Las imagenes se interpretaron con el software Open Data Transfer (ODT, University of Tennessee UsA).

Identificacion de los genotipos

A partir de las muestras de sangre se aislo y purifico el ADN genomico segun el protocolo descrito por sambrook et al. (15). Los genotipos de los genes MYF5, PDE1B, IGF1, y los microsatelites BM6026, CSSM34, RM500, ETH10, se amplificaron utilizando los iniciadores que se presentan en la tabla 1.

Los iniciadores para amplificar el segmento del gen MYF5 se seleccionaron a partir de la informacion publica suministrada por Li et al. (12); para el gen PDE1B se escogieron de acuerdo con lo reportado por stone et al. (16), y para el gen IGF1 se seleccionaron a partir de la informacion del Molecular Animals Genetics, CsIRO (Australia, comunicacion personal) (17) (tabla 1). Las condiciones de la reaccion de cadena de la polimerasa (PCR) se ajustaron para un volumen final de 12,5 [micron]l, que contenian 4 [micron]l de ADN genomico (20ng-[micron]l), 1,5 [micron]l de Mg[Cl.sub.2] (1,5 mM), 2,5 [micron]l de dNTP (12,5 mM cada uno, mezclados con Buffer 1x), 0,5 [micron]l de Taq polimerasa preparada en el laboratorio (0,2U), 1 [micron]l de cada iniciador (20 ng-[micron]l), 2 [micron]l de agua grado molecular y una gota de aceite mineral. Las condiciones de amplificacion incluyeron 95[grados]C por 3 minutos durante 1 ciclo, 95[grados]C por 30 segundos. Las temperaturas de anillamiento variaron entre 54-60[grados]C por 1 minuto de acuerdo con el marcador utilizado (tabla 1), 72[grados]C por 1 minuto 30 segundos durante 30 ciclos, seguido de 1 ciclo a 72[grados]C por 10 minutos, y finalmente 1 ciclo a 30[grados]C por 1 minuto.

Para la deteccion de los genotipos se empleo la metodologia indicada para cada marcador, asi: para el marcador MYF5 se uso la tecnica de polimorfismos de longitud de fragmentos digeridos (RFLP), usando la enzima TaqI y los productos de digestion se separaron en geles de agarosa al 1,5%; para el marcador PDE1B se empleo el polimorfismo conformacional de cadena sencilla (SSCP) / Heteroduplex, y para el IGF1 se utilizo SSCP

Los microsatelites se genotipificaron en geles denaturantes de poliacrilamida (29:1 6X con urea 7,5 M); el tamano de los fragmentos en pares de bases (pb) de los microsatelites, y el tiempo de corrida del gel se describen en la tabla 2. Los geles se corrieron a 1500 voltios a 50[grados]C en buffer TBE 1X. Posteriormente, los geles fueron tenidos con nitrato de plata y los genotipos registrados en una base de datos despues de haber sido confrontados por dos personas diferentes al lector inicial.

Construccion del mapa de ligamiento

Para la construccion del mapa de ligamiento se empleo el programa Animap (19) el cual utiliza la funcion de Kosambi para calcular las frecuencias de recombinacion entre los marcadores considerando un grado intermedio del fenomeno de interferencia entre los alelos o de la probabilidad de entrecruzamiento determinando el ligamiento entre los marcadores y el orden de los mismos a lo largo del cromosoma con un valor de LOD mayor a 3,0 (p [menor que o igual a] 0,001) para cada par de marcadores.

Deteccion de QTL para caracteristicas de crecimiento

El analisis para los QTL se realizo mediante el programa QTLExpress (20) utilizando la opcion de "analisis para un solo QTL". se evaluaron los efectos entre familias (n=12), con un total de 84 individuos (72 progenies y 12 padres) para las caracteristicas de crecimiento: peso al nacimiento (peso 0m), peso al destete (peso9m), peso al ano (peso12m) , peso a los 16 meses (peso16m), area de ojo del lomo a los 12 y 16 meses (AOLpeso12m y AOL peso16m), espesor de grasa dorsal a los 12 y 16 meses (EG peso12 m y EG peso16m), espesor de grasa del anca a los 12 y 16 meses (P8 peso12m y P8 peso16m), ganancia diaria predestete y posdestete (GDD y GDPG) y los genotipos de los genes MYF5, PDE1B, IGF1, y de los microsatelites BM6026, CssM34, RM500, ETH10. Para estimar el efecto del QTL se realizaron analisis que cubrieron la extension del BTA5 a intervalos de 5 cM de acuerdo con el mapa de ligamiento para estos marcadores en la raza romosinuano, estableciendo como estrategia de analisis el agrupamiento de los marcadores en diferentes grupos de ligamientos como pares, trios, tetradas y asi sucesivamente, hasta analizar todos los marcadores como un solo grupo. El F estadistico se determino por comparacion de minimos cuadrados obtenidos de la regresion dentro de la familia para el minimo cuadrado residual. Los grados de libertad del numerador (s) corresponden al numero de padres y el denominador corresponde a N-2s donde N es el numero de la progenie. Los umbrales de significancia se calcularon utilizando el metodo de permutacion de Churchill et al. (21). Los test de significancia para la presencia de un QTL se disenaron a un intervalo de 10 cM y se repitieron 1000 veces para la construccion de la distribucion del test estadistico bajo la hipotesis nula.

Metodo estadistico

Las medidas de peso y ultrasonido fueron ajustadas antes de los analisis. se utilizo el siguiente modelo estadistico de regresion para la identificacion de los QTL: [Y.sub.ij] = [a.sub.i]+ [b.sub.i] [X.sub.ij] + [e.sub.ij], donde [Y.sub.ij]: es el valor de la caracteristica del individuo j, descendiente del padre i; [a.sub.i]: es el efecto poligenico para la familia de medios hermanos paternos i; [b.sub.i]: es el coeficiente de regresion en la familia i, como es el efecto de la sustitucion alelica para un QTL dado; [X.sub.ij]: es la probabilidad condicional para el individuo j de heredar el primer haplotipo del padre i; [e.sub.ij]: es el efecto residual. El analisis de regresion se realizo entre familias y los valores de la raza son valores ponderados por su fiabilidad (esto es el numero de hijos). El analisis provee relaciones de F entre los grupos de ligamiento con el maximo valor que es la posicion mas probable del QTL.

RESULTADOS

Mapa de ligamiento

Todos los marcadores mostraron segregacion mendeliana y demostraron ser informativos para ser incluidos dentro del grupo de ligamiento correspondiente al cromosoma 5 bovino. En la figura 1 se muestra el orden y las distancias de mapa en cM de Kosambi. Los errores generados por dobles recombinantes fueron removidos.

[FIGURA 1 OMITIR]

Identificacion de QTL

En la tabla 3 se indican las caracteristicas evaluadas, el agrupamiento de los marcadores para el BTA5 en cada uno de los ensayos efectuados en donde se identificaron QTL significativos. Ademas, se describe la posicion estimada del QTL, los valores del F estadistico, el valor del F calculado, el porcentaje de verosimilitud (LR) y la familia significativa con su valor absoluto t (Ab(t)) que indica la evidencia del QTL en un analisis entre familias; estos resultados fueron dados por el programa QTLExpress. El valor de significancia de p es la diferencia del F estadistico en relacion con el F calculado e indica la significancia entre p [menor que o igual a] 0,05 y p [menor que o igual a] 0,01 para los QTL.

Como se observa en los resultados obtenidos en la tabla 3, para la caracteristica de peso0m se detecto un QTL (p [menor que o igual a] 0,05) para el grupo de marcadores BM6026MYF5-PDE1B-CSSM34-RM500ETH10-IGF1 a los 45 cM delimitado por los marcadores MYF5 y PDE1B (vease figura 2a), siendo las familias significativas la 4 con un valor de Ab(t) de 2,23, lo cual evidencio la presencia de un QTL en el analisis entre familias.

Para la caracteristica de peso 16 se identifico un QTL en la posicion de 105 cM para el grupo de marcadores BM6026-PDE1B-CSSM34-IGF1 con un p<0,05. El QTL se encontro delimitado por los marcadores CSSM34-IGF1 (veanse tabla 3 y figura 2b). La familia 6 fue significativa con un Ab(t) de 2,63.

En la posicion de 40 cM se identificaron dos QTL para las caracteristicas de AOL Peso12m y AOL Peso16m, para los grupos de marcadores BM6026MYF5-PDE1B-ETH10 con un p [menor que o igual a] 0,05 delimitado por los marcadores MYF5 (24 cM) y PDE1B (55 cM). Las familias informativas fueron la 4 y 1 con un Ab(t) de 2,44 y 3,06 respectivamente (veanse tabla 3 y figura 3a).

Para la caracteristica GDD se identifico un QTL a los 50 cM (p [menor que o igual a] 0,01) para el grupo de marcadores MYF5-PDE1B CSSM34-RM500 siendo la familia significativa la 12 con un Ab(t) de 3,46 (vease tabla 3 y figura 3b).

se identifico un QTL para la caracteristica GDPG con una significancia de (p [menor que o igual a] 0,05) para los grupos de marcadores BM6026-CSSM34-ETH10 a los 110 cM (vease tabla 3 y figura 3c). La familia 8 se observo como la mas significativa con un Ab(t) de 3,62.

DISCUSION DE RESULTADOS

En este trabajo se genero el segundo mapa de ligamiento para el BTA5 en la raza criolla romosinuano despues del reportado por Ariza et al. (14). La certeza en la ubicacion del orden de los marcadores a lo largo del mapa es considerada de gran importancia para la ubicacion de los genes responsables de caracteristicas de importancia zootecnica. El orden de los marcadores descrito en el presente estudio coincide totalmente con los mapas reportados por otros autores como Barendse et al. (22), Ozawa et al. (23) y Donato et al. (24) lo que permitiria comparar el mapa de ligamiento de la raza Romosinuano con los mapas de otras razas ya estudiadas facilitando la deteccion de QTL o genes candidatos relacionados con caracteristicas de crecimiento.

Ademas, este es el primer estudio de QTL asociados a caracteristicas de crecimiento para la raza criolla romosinuano que se reporta en la literatura. Por tanto, los resultados obtenidos son de gran valor y serviran de base para futuros estudios de genes candidatos relacionados con caracteristicas de produccion. Asi, para la discusion de estos resultados no se tiene un punto de referencia y por consiguiente esta comparacion se hace con trabajos semejantes en otras razas de origen europeo y cruces de estas con Bos indicus.

El QTL para peso0m identificado en este estudio se ubico a los 45 cM, de modo similar al QTL reportado por Casas et al. (3) (30 a 70 cM) y Kim et al. (4) (45,5 a 71,6 cM) para esta misma caracteristica. Las posicion de este mismo QTL es cercana a las regiones cromosomales reportadas por Li et al. (5) y Li et al. (12) quienes ubicaron un QTL entre 19 a 28,6 cM, pero se encuentra mas lejano al QTL reportado por otros autores como Machado et al. (6) (82,9 cM) y Gasparin et al. (13) (69 cM). Estos hallazgos confirman la existencia de un QTL para peso0m en el BTA5 en la raza romosinuano; aunque su posicion varia con respecto a algunos estudios, las diferencias pueden atribuirse a la poblacion estudiada y a los marcadores empleados en cada analisis.

Para la caracteristica de peso16m se reporta por primera un QTL en el BTA5 ubicado a los 105 cM y delimitado por los marcadores RM500 y ETH10, los cuales estan relacionados con crecimiento, como lo reportaron previamente Machado et al. (6) y Li et al. (12). Aunque este QTL no ha sido identificado para otras razas bovinas es importante destacar su efecto debido al crecimiento mas lento que se observa en el ganado criollo colombiano.

Para las caracteristicas de AOL peso12m y AOLpeso16m en este estudio se detectaron dos QTL ubicados a los 40 cM, de modo similar al analisis realizado por Casas et al. (3) para estas mismas caracteristicas. Esta similitud permitiria posicionar genes candidatos ya identificados en otras razas para estos rasgos y extrapolar estos datos a la raza romosinuano.

Los QTL detectados para ganancias de peso diarias GDD y GDPG se ubicaron a los 50 cM y 110 cM respectivamente. La ubicacion del primer QTL coincide con la region reportada por Li et al. (5) y Li et al. (12) a los 73 cM. Para la caracteristica GDPG, tambien se reporta por primera vez un QTL en el BTA5 en la raza romosinuano. Este QTL serviria de punto de partida para realizar el seguimiento durante esta etapa de crecimiento, lo que permitiria seleccionar animales con mejor comportamiento para su uso como parentales.

CONCLUSIONES

se reporta por primera vez un mapa de ligamiento en el cromosoma 5 bovino utilizando los marcadores BM6026, MYF5, PDE1B, CSSM34, RM500, ETH10, IGF1 para la raza romosinuano.

El orden de los marcadores encontrados en este estudio es similar a otras publicaciones recientes de los mapas de ligamiento para el cromosoma 5 bovino, aunque se presentan variaciones en las distancias entre los marcadores, lo que se puede deber a la raza y los genes y/o marcadores analizados.

Se reportan por primera vez seis QTL asociados a caracteristicas de crecimiento en la raza criollo romosinuano.

En el analisis entre familias se detectaron QTL en el BTA5 con significancia p [menor que o igual a] 0,05 para las caracteristicas de crecimiento relacionadas con peso: peso0m, peso16m, GDPG, para las caracteristicas de crecimiento medidas por ecografia: AOL peso12m, AOL peso16m y con significancia de p [menor que o igual a] 0,01 para la caracteristica GDD.

Las caracteristicas de crecimiento: peso0m, AOL peso12m, AOL peso16m se asocian con la presencia de los marcadores MYF5-PDE1B debido a que el umbral del QTL estuvo cercano a estos marcadores.

La seleccion de la progenie que heredara los rasgos analizados se facilitara debido al analisis de los QTL lo que permite identificar la familia y, por tanto, el parental que presenta el mayor efecto sobre la caracteristica de interes.

Se recomienda ampliar los estudios utilizando los toros de las familias 6, 8 y 12 para incrementar el numero de progenies dentro de estas y asi poder evaluar la segregacion de los rasgos en la poblacion.

Con el proposito de aumentar la eficacia en la construccion de un mapa de ligamiento genetico y determinar las regiones que presentan QTL asociados a caracteristicas de crecimiento en bovinos, se recomienda realizar estudios incluyendo individuos producto del cruzamiento del F2 debido a que poseen mayor poder para detectar efectos aditivos entre los alelos y permite una mayor informacion de los eventos recombinantes entre los gametos parentales.

[FIGURA 2 OMITIR]

[FIGURA 3 OMITIR]

Recibido 10/12/2009 y aprobado 05/03/2010

REFERENCIAS

(1.) Bryne PF, McMullen MD. Defining genes for agricultural traits: QTL analisis and the candidate gene approach. Probe 1996; 7: 24-27.

(2.) Moro J, Hayes J. Metodos de mapeo de loci de rasgos cuantitativos y sus aplicaciones potenciales en la industria lechera. Tec Pec Mex 2006; 44 (3) :329-350.

(3.) Casas E, shackelford sD, Keele JW, Koohmaraie M, Smith TP, Stone RT. Detection of quantitative trait loci for growth and carcass composition in cattle. J Anim sci 2003; 81: 2976-2983.

(4.) Kim J, Farnir F, savell J, Taylor J. Detection of quantitative trait loci for growth and beef carcass fatness traits in a cross between Bos taurus (Angus) and Bos indicus (Brahman) cattle. J Anim sci 2003; 81: 1933-1942.

(5.) Li C, Basarab J, snelling W, Benkel B, Murdoch B, Moore S. The identification of common haplotypes on bovine chromosome 5 within commercial lines of Bos taurus and their associations with growth traits. J Anim Sci 2002; 80: 1187-1194.

(6.) Machado M, Alencar M, Pereira A, Oliveira H, Casas E, Coutinho L, Regitano L. QTL affecting body weigth in a candidate region of cattle chromosome 5. Genetics and Molecular Biology 2003; 26 (3): 259-265.

(7.) Casas E, Shackelford S, Keele J, Stone R, Kappes S, Koomaraie M. Quantitative trait loci affecting growth and carcass composition of cattle segregating alternate forms of myosta tin. J Anim sci 2000; 78: 560-569.

(8.) Kneeland J, Li C, Basarab J, Snelling WM, Benkel B, Murdoch B, Hansen C, Moore SS. identification and fine mapping of quantitative trait loci for growth traits on bovine chromosome 2, 6, 14, 19, 21 and 23 within one comercial line of Bos Taurus. J Anim sci 2004; 82: 3405-3414.

(9.) Kirkpatrick B, Becky M, Gregory K. Mapping quantitative trait loci for bovine ovulation rate. Mamm Genome 2000; 11: 136-139.

(10.) Arias J, Kirkpatrick B. Mapping of bovine ovulation rate QTL: An analytical approach for three generation pedigree. Anim Genet 2004; 35: 7-13.

(11.) Stone R, Keele J, Shackelford S, Kappes S, Koomaraie M. A primary screen of the bovine genome for quantitative trait loci affecting carcass and growth traits. J Anim sci 1999; 77: 1379-1384.

(12.) Li C, Basarab J, snelling WM, Benkel B, Murdoch B, Hansen C. Moore SS. Assessment of positional candidate genes MYF5 and IGF1 for growth on bovine chromosome 5 in commercial lines of Bos taurus. J Anim Sci. 2004; 82: 1-7.

(13.) Gasparin G, Miyata M, Lehmann l, Martinez M, Vinicius M, Barbosa da silva G, Machado M, Campos A. Quantitative trait locus affecting birth weight on bovine chromosome 5 in a F2 Gyr x Holstein population. Genetics and Molecular Biology 2005; 28: 670-676.

(14.) Ariza F, Guerrero A, Fajardo C, Franco L, Vargas C, Ayala C, Pena L, Roa L, Barrera G. Martinez R. Asociacion de marcadores moleculares con peso al nacimiento en el ganado criollo romosinuano. V simposio iberoamericano sobre la conservacion y utilizacion de recursos zoogeneticos. Universidad Nacional de Peru; 2004.

(15.) Sambrook F, Fritsch EF, Maniatis T. Molecular cloning; a laboratory manual, Second Edition. Cold Spring Harbor Laboratory Press; 1989.

(16.) Stone RT, Casas E, Smith TP, Keele JW, Harhay G, Bennett GL, Koohmaraie M, Wheeler TL, Shackelford SD, snelling WM. Identification of genetic markers for fat deposition and meat tenderness on bovine chromosome 5: Development of a low-density single nucleotide polymorphism map. J Anim sci 2005; 83: 2280-2288.

(17.) Molecular Animals Genetics, CSIRO (Australia, comunicacion personal); 2000.

(18.) Barendse W, Armitage SM, Kossarek LM, Shalom A, Kirkpatrick BW, Ryan AM, Clayton D, Li L, Neibergs HL, Zhang Nl. A genetic linkage map of the bovine genome. Nat Genet 1994, 3: 227-235.

(19.) Georges M, Nielsen D, Mackinnon M. Mapping quantitative trait loci controlling milk production in dairy cattle by exploiting progeny testing. Genetics 1995; 139: 907-920.

(20.) Seaton G, Haley SA, Knott M, Kearsey PM, Visscher D. QTL express: mapping quantitative trait loci in simple and complex pedigrees. Bioinformatics 2004; 18: 339-340.

(21.) Churchill GA, Doerge RW. Empirical threshold values for quantitative trait mapping Genetics 1994; 138: 963-971.

(22.) Barendse W, Vaiman D, Kemp SJ, Sugimoto Y, Armitage SM, Williams JL, Sun HS, Eggen A, Agaba M, Aleyasin S.A. A medium-density genetic linkage map of the bovine genome. Mamm. Genome 1997; 8: 21-28.

(23.) Ozawa A, Band M, Larson J, Donovan J, Green C, Womack J, Lewin H. Comparative organization of cattle chromosome 5 revealed by comparative mapping by annotation and sequence similarity and radiation hybrid mapping. Proc Natl Acad sci 2000; 97 (8): 4150-4155.

(24.) Donato M, Brenneman RA, Stelly DM, Womack JE, Taylor JF. A methodological approach for the construction of a radiation hybrid map of bovine chromosome 5. Genetics and Molecular Biology 2004; 27 (1): 22-32.

R M. Rios [1], S. L. Castro [2], D. J. Moreno [3], J. S. Moncaleano [4], M. O. Santana [5] *, R. Barahona [6] **, B. F. Ariza [7]

Grupo de Investigacion Genetica Molecular Animal, Facultad de Medicina veterinaria y de Zootecnia Universidad Nacional de Colombia sede Bogota C. I. Turipana, Investigador * Universidad Nacional sede Medellin **

[1.] mriosr@unal.edu.co,

[2.] susancastr09@hotmail.com

[3.] dianamoga@gmail.com

[4.] jsmoncaleanov@unal.edu.co

[5.] mosantanar@gmail.com *

[6.] rolandobarahona2002@yahoo.com **

[7.] mfarizab@bt.unal.edu.co
Tabla 1. Secuencia de los iniciadores Forward y Reverse de los
marcadores que se utilizaron en el presente estudio y su
temperatura de anillamiento

Marcador    Iniciador Forward           Iniciador Reverse

MYF5 *      CCTATCTGGTCCAGAAAGAGCAG     TATATAAGTTAAGCATTGCAACAA
PDE1B *     AACCCTGGTCCCTGAGTCTCC       CGCAGTTGCTAGTCTGCTTG
IGF1 *      GCTTGGATGGACCATGTTG         CACTTGAGGGGCAAATGATT
BM6026 **   GCAACTAAGACCGAACCAAC        ACTGATGTGCTCAGGTATGACG
CSSM34 **   CCATAACTCCTGGGACTTTTCCTCA   ATGTTCAGCCATCTCTCTCCTTGT
RM500 **    CAGACACGACTAAGCGACCA        CCTACAATAAAGCACGGGGA
ETH10 **    GTTCAGGACTGGCCCTGCTAACA     CCTCCAGCCCACTTTCTCTTCTC

            Temperatura de
Marcador     anillamiento    Referencias

MYF5 *       60[grados]C         12
PDE1B *      55[grados]C         16
IGF1 *       60[grados]C         17
BM6026 **    59[grados]C         18
CSSM34 **    58[grados]C         18
RM500 **     54[grados]C         18
ETH10 **     58[grados]C         18

* Corresponde a un marcador de polimorfismo de nucleotido simple (sNP).

** Corresponde a un marcador de tipo microsatelite.

TABLA 2. Tamano de los fragmentos y
temperatura de corrida de los geles de
acrilamida para los microsatelites BM6026,
CSSM34, RM500, ETH10

Locus    pb        Temperatura de corrida

BM6026   148-168   1 hora 30 min
CSSM34   105-109   2 horas
RM500    124-132   1 hora 30 min
ETH10    212-224   1 hora 30 min

TABLA 3. QTL detectados por el programa QTLExpress para el
BTA5 utilizando diferentes grupos de marcadores para las
caracteristicas fenotipicas evaluadas.

                                              Posicion
                                              estimada
Caracteristica     Grupo de marcadores        del QTL    F estadistico

Peso0m (kg)        BM6026-MYF5-PDE1B-            45          1,82
                   CSSM34-RM500-ETH10-IGF1
Peso16m (kg)       BM6026-PDE1B-CSSM34-IGF1     105          1,91
AOLpeso12m (cm2)   BM6026-MYF5-PDE1B-ETH10       40          1,81
AOLpeso16m (cm2)   BM6026-MYF5-PDE1B-ETH10       40          2,29
GDD (kg)           MYF5-PDE1B-CSSM34-RM500       50          2,24
GDPG (kg)          BM6026-CSSM34-ETH10          110          2,39

                                         No. de familia
Caracteristica     F calculado    LR     significativa    Ab(t)     P

Peso0m (kg)           1,16       19,88         4          2,23    <0,05

Peso16m (kg)          1,17       18,97         6          2,63    <0,05
AOLpeso12m (cm2)      1,16       17,99         4          2,44    <0,05
AOLpeso16m (cm2)      1,26       21,9          1          3,06    <0,05
*GDD (kg)              1,24       23,54         12         3,46    <0,01
GDPG (kg)             1,27       22,74         8          3,62    <0,05
COPYRIGHT 2010 Universidad Nacional de Colombia, Facultad de Medicina Veterinaria y de Zootecnia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Investigacion
Author:Rios, R.M.; Castro, S.L.; Moreno, D.J.; Moncaleano, J.S.; Santana, M.O.; Barahona, R.; Ariza, B.F.
Publication:Revista Facultad de Medicina Veterinaria y de Zootecnia
Article Type:Report
Date:Jan 1, 2010
Words:4713
Previous Article:Aislamiento e identificacion de microorganismos entericos en muestras ambientales y cloacales en Crocodylus intermedius y Testudines de la Estacion...
Next Article:Cambios en la distribucion y abundancia de las garrapatas y su relacion con el calentamiento global.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |