Printer Friendly

Recent activity of the retrotransposable B2 element in hamsters and its use as a phylogenetic marker.

ABSTRACT

A recent analysis of DNA sequences of hamsters, in the rodent subfamily Cricetinae (family Cricetidae, superfamily Muroidea), generated a significant phylogenetic restructuring among the genera Tscherkia, Cricetus, Allocricetulus and Cricetulus. We present an analysis of this group of hamsters using retrotransposons as phylogenetic markers to further assess the modified phylogeny. Retrotransposons represent a group of transposable elements that integrate into new genomic locations via an RNA intermediate. The novel use of this tool is that organisms that share a specific retrotransposon integration should share a common ancestor. We present the first examples of recent retrotransposon integrations in the hamster genome and provide support for the revised phylogenetic relationship of hamsters. This study demonstrates that retrotransposons can be valuable tools in ascertaining phylogenetic relationships.

INTRODUCTION

The subfamily Cricetinae (family Cricetidae, superfamily Muroidea) consists of the group of rodents commonly referred to as hamsters. Members of Cricetinae are mouse-like animals with a thickset body, short tail, and cheek pouches (Nowak 1991). The subfamily Cricetinae is currently composed of seven genera: Allocricetulus, Cansumys, Cricetulus, Cricetus, Mesocricetus, Phodopus, and Tscherskia, with a total of eighteen species (Musser and Carleton 2005). The taxonomic relationships among extant Cricetinae were generated based on morphological (Carleton and Musser 1984) and cytological (Gamperl et al. 1978) data. Recent molecular phylogenies have been constructed for the superfamily Muroidea using DNA sequences from various genes: lecithin cholesterol acyl transferase (LCAT) gene and von Willebrand factor (vWF) gene (Michauex et al. 2001), interphotoreceptor retinoid binding protein (IRBP) gene (Jansa and Weksler 2003), growth hormone receptor (GHR), breast cancer gene 1 (BRCA1), recombination activating gene 1 (RAG1), and protooncogene c-myc (Steppan et al. 2004). However, none of these studies included adequate taxon sampling to assess the detailed phylogenetic relationships among members of the subfamily Cricetinae.

One detailed phylogenetic study of the Cricetinae subfamily (Neumann et al. 2006) utilized DNA sequences from two mitochondrial genes (cytochrome b and 12S rRNA) and one nuclear gene (von Willebrand Factor exon 28). Their phylogenetic tree argues against monophyly of the genus Cricetulus. Most notable was the formation of a clade consisting of Tscherskia triton, Cricetulus migratorius, Cricetus cricetus, and Allocricetulus eversmanni that branches off from a clade consisting of other Cricetulus species.

A relatively new phylogenetic tool involves short interspersed DNA elements (SINEs), which are groups of non-autonomous retrotransposons that are abundant in many mammalian genomes. SINEs can jump within the genome by a process called retrotransposition in which the retrotransposon "master gene" is copied into an RNA intermediate, reverse transcribed into DNA, and inserted into the genome of its host at a new location (Deininger et al. 1992). Known rodent SINEs include ID, Bl, B2, B4 and Bl-dID (Kramerov and Vassetzky 2005). SINEs have recently been regarded as highly informative genetic markers, as these are typically homoplasy-free, i.e. a shared SINE integration represents a synapomorphy (derived state that is identical by descent) in contrast to a nucleotide sequence which may be identical simply by state (e.g., reverse or parallel mutation). Numerous studies have been performed utilizing retrotransposons as markers to construct a molecular phylogeny or to help further clarify the species branching in a number of groups. These include analyses of salmons (Murata et al. 1993), whales (Shimamura et al. 1997), cichlid fishes (Takahashi et al. 2001; Terai et al. 2003), turtles (Sasaki et al. 2004), strepsirrhine primates (Roos et al. 2004), eels (Kajikawa et al. 2005), primates (Ray et al. 2005), and galliform birds (Kaiser et al. 2006).

Recent B2 integrations in the mouse have been described (Roy et al. 1998) and therefore have the potential for use as a phylogenetic tool. There are an estimated 80,000 copies of B2 elements in the hamster genome (Kass et al. 1997). In this study we identified "young" B2 elements from the GenBank database based on their sequence identity to a consensus sequence (Kass et al. 1997), which would represent the "master gene" or locus responsible for generating new elements. More recent integrations have had less time to acquire mutations and would be similar or identical to the master gene. We therefore utilized young B2 elements in a PCR assay to potentially identify recent genomic integrations in the hamster and determined their potential use in addressing the newly restructured taxonomic picture of hamsters.

MATERIALS AND METHODS

DNA Samples

DNA for the hamster species Cricetulus sokolovi (Sokolov's hamster), Cricetulus barabensis (striped dwarf hamster), Cricetulus longicaudatus (long-tailed dwarf hamster), Cricetulus pseudogriseus (Transbaikal hamster), Cricetulus migratorius (gray dwarf hamster), Cricetus cricetus (black-bellied hamster) and Allocricetulus eversmanni (Eversmann's hamster) were generously supplied by Dr. Karsten Neumann of the Institute of Zoology at the Martin-Luther-University in Germany. These hamsters were collected in their natural distribution area (Neumann et al. 2006). The DNA for Cricetulus griseus (Chinese hamster) was obtained from Chinese hamster ovary (CHO) cells in the laboratory of Dr. John Moran at the University of Michigan. The DNA from Mesocricetulus auratus (golden hamster) was generated in a previous study (Kass et al. 1997).

Identification of Loci Containing Hamster B2 Elements

The 169 bp consensus sequence for the hamster B2 element (Kass et al. 1997) was used to query the GenBank database via BLAST search (Altschul et al. 1990) to identify young hamster B2 sequences based on sequence identity.

PCR and DNA Sequencing

To assess the presence or absence of a B2 integration in orthologous loci, primer sets were designed that flank the B2 element insertions (Figure la) utilizing PrimerSelect from the Lasergene suite of software tools (DNASTAR, Inc), and BLAST searches were performed to verify lack of homology of the primers to repetitive DNA. PCR amplifications were performed in 25-[mu]l volumes containing IX Go Taq buffer (Promega), 3.0 mM of MgCl2, 0.20 mM of dNTPs, 0.25 mM of each primer (Table 1), 1 U GoTaq DNA polymerase (Promega), and 50 ng of template DNA. Reactions were performed using an MJ thermal cycler with various annealing temperatures (Tl and T2) for the different loci (Table 1) under the following conditions: 94[degrees]C for 2 min, IX; 94[degrees]C for 30s, T1[degrees]C for 20s, and 72[degrees]C for 20s, 5X; 94[degrees]C for 30s, T2[degrees]C for 20s, and 72[degrees]C for 20s, 25X; 72[degrees]C for 2 min. Amplification products were analyzed by 1% agarose gel electrophoresis and stained with ethidium bromide. Genetic loci lacking the B2 element would yield a PCR fragment approximately 200 base pairs (bp) smaller (Figure lb). PCR amplicons representing both the presence and absence forms were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) and directly sequenced by Functional Biosciences, Inc. to verify amplification of the correct locus.

[FIGURE 1 OMITTED]
TABLE 1. PCR conditions and expected amplicon sizes for screening of
four B2-containing loci found in hamster. F refers to the forward
primer and R refers to the reverse primer

Locus Accession Primer Sequence (5' to 3') Annealing Annealing
 Number Temp. 1 Temp. 2

X96664 1903053 F: CTTCGGAGGGATTACTTGGGTGAC 58 53

 R: CTCTATCTCAGGGCCCTTGTTTGT

AF193761 6274480 F: TTGGTTAGGTGTGAAGGAGTGA 50 45

 R: TGGAATGGAAAGCCAAAGAG

AY188393 30313796 F: GGCTGTCCTGGAGCTAGTTG 50 47

 R: AGCTTGGCTTCACTGCATTT

X96549 2879827 F: TTAAGCATATGTCCAAAGAG 50 47

 R: TACGCTTTTATTCCACATCATCCT

X96549 2879827 F: GTGCTCACAACCATCCGTTA 58 53

(set 2) R: GCCACTTGTCAGCCTCCTTA

Locus Expected Fragment Size (B2 Expected Fragment Size (B2
 Element Present) Element Absent)

X96664 499bp ~299bp
AF193761 366bp ~166bp
AY188393 366bp ~203bp
X96549 480bp ~280bp
X96549 385bp ~185bp
(set 2)


RESULTS

The GenBank database was queried with a consensus B2 sequence in order to potentially identify recently integrated B2 elements. Four Chinese hamster (Cricetulus griseus) loci were chosen which contained a B2 element that demonstrated high sequence identity to the consensus sequence. These include AF193761 (6274480) with 93% sequence identity to the query sequence, AY188393 (30313796) with 93% sequence identity to the query sequence, X96664 (1903053) with 97% sequence identity to the query sequence, and X96549 (2879827) with 91% sequence identity to the query sequence.

All of the species of hamster analyzed, except the distantly related Mesocricetulus auratus, were found to contain a B2 element within locus AF193761 (Figure 2, Table 2). The species Cricetulus sokolovi, Cricetulus barabensis, Cricetulus longicaudatus, Cricetulus pseudogriseus, and Cricetulus griseus were found to contain a B2 element within loci X96664, X96549, and AY188393 (Table 2). In contrast, the species Cricetulus migratorius, Cricetus cricetus, and Allocricetulus eversmanni were all found to lack the B2 element within loci X96664 and X96549 (Table 2). Additionally Cricetulus migratorius and Cricetus cricetus also lack the B2 element in AY188393, and no product was generated for Allocricetulus eversmanni (Table 2). The results of the analyses of the four loci are summarized in Table 2. A representative locus, X96664, is shown to demonstrate the presence and absence forms found at this locus (Figure 3). These results show that five species of Cricetulus form a clade (Figure 4) whereas Cricetulus migratorius, Cricetus cricetus, and Allocricetulus eversmanni are excluded from this clade. Additionally the AF193761 B2 element supports the exclusion of Mesocricetulus auratus from a clade consisting of all the other analyzed hamsters (Figure 4).

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]
TABLE 2. PCR-based analysis of the presence (+) or absence (-) of a B2
integration in four loci chosen by bias screening of the GenBank
database

 X96664 AF193761 AY1888393 X96549

C. sokolovi + + + +
C. barabensis + + + +
C. longicaudatus + + + +
C. pseudogriseus + + + +
C. migratorius - + - -
C. cricetus - + - -
A. eversmanni - + no clear result -
C. griseus + + + +


DISCUSSION

We present the first findings of recently integrated retrotransposons in the hamster. These four recently integrated hamster B2 elements were analyzed to assess their usefulness as a phylogenetic tool particularly in regards to the surprising restructuring of the hamster phylogenetic tree (Neumann et al. 2006). Most notable was the exclusion of Cricetulus migratorius from a clade consisting of various other Cricetulus species. Our analyses using SINEs were consistent with the restructured subfamily Cricetinae phylogenetic tree (Figure 4). As the hamster genetic database grows, a greater number of B2-containing loci can be analyzed, potentially providing a high-resolution hamster phylogenetic tree. Alternative PCR-based strategies have also been developed to isolate recent retrotransposons from the large background of older elements (Roy et al. 1999).

As more DNA sequences become available, other hamster species, such as those from the Phodopus and the Mesocricetus groups could be added to these studies. With genetic databases rapidly expanding and the growing number of genome projects, this could perhaps allow for a detailed analysis of the hamster phylogeny, as Neumann et al. (2006) have presented several phylogenetic questions among this group. Additionally, Bl and ID retrotransposons have been shown to recently integrate in rodent genomes (Kim et al. 1994; Kass et al. 1996; Kass et al. 2000; Gilbert et al. 2004) and can potentially be used for hamster analysis.

The method of using retrotransposons in the construction of a molecular phylogeny allows for a relatively simple and rapid, low-cost method of determining branching order for species. Additionally, these markers are virtually homoplasy free and therefore organisms that share the integration would share a common ancestor. Although an extremely are example of a parallel integration has been observed (Kass et al. 2000) the sequence analysis can verify a parallel versus shared integration, and therefore SINEs continue to provide a unique phylogenetic tool.

ACKNOWLEDGMENTS

This work was made possible by a grant from the Meta Hellwig Scholarship Fund at Eastern Michigan University awarded to J.A.K. and an NIH AREA grant (GM062828) to D.H.K.

REFERECES

ALTSCHUL, S.F., W.GISH, W.MILLER, E.W.MYERS AND D.J.LIPMAN. 1990. Basic local alignment search tool. Journal of Molecular Biology 215:403-410.

CARLETON, M.D., AND G. G. MUSSER. 1984. Muroid rodents. In Orders and Families of Recent Mammals of the World, ed. S. Anderson and J. K. Jones Jr., 289-379. New York: John Wiley and Sons.

DEININGER, P. L., M.A. BATZER, C. A. HUTCHINSON 3RD, AND M.H. EDGELL, 1992. Master genes in mammalian repetitive DNA amplification. Trends in Genetics 8:307-311.

GAMPERL, R., G. VISTORIN, AND W. ROZENKRANZ. 1978. Comparison of chromosome banding patterns in five members of Cricetinae with comments on possible relationships. Caryologia 3:343-353.

GILBERT, N., J.M. BOMAR, M. BURMEISTER, AND J.V. MORAN. 2004. Characterization of a mutagenic Bl retrotransposon insertion in the jittery mouse. Human Mutation 24:9-13.

JANSA, S.A., AND M. WEKSLER. 2003. Phylogeny of muroid rodents: Relationships within and among major lineages as determined by IRBP gene sequences. Molecular Phylogenetics and Evolution 31:256-276.

KAISER, V.B., M. VAN TUINEN, AND H. ELLEGREN. 2006. Insertion events of CRI retrotransposable elements elucidate the phylogenetic branching order in galliform birds. Molecular Biology and Evolution 24:338-347.

KAJIKAWA, M., K. ICHIYANAGI, N. TANAKA, AND N. OKADA. 2005. Isolation and characterization of active LINE and SINEs from the eel. Molecular Biology and Evolution 22:673-682.

KASS, D.H., J. KIM, NAD P.L. DEININGER. 1996. Sporadic amplification of ID elements in rodents. Journal of Molecular Evolution 42:7-14.

KASS, D.H., J. KIM, A. RAO, AND P.L. DEININGER. 1997. Evolution of the B2 repeats: The muroid explosion. Genetica 99:1-13.

KASS, D.H., M. E. RAYNOR, AND T.M. WILLAMS. 2000. Evolutionary history of B1 retroposons in the genus Mus. Journal of Molecular Evolution 51:256-264.

KIM, J., J. A. MARTIGNETTI, R. SHEN, J. BROSIUS, AND P. DEININGER. 1994. Rodent BC1 RNA gene as a master gene for ID element amplification. Proceedings of the National Academy of Sciences of the United States of America 91:3607-3611.

KRAMEROV, D.A., AND N.S. VASSETZKY. 2005. Short retroposons in eukaryotic genomes. International Review of Cytology 247:165-221.

MICHAUX, J., A. REYES, AND F. CATZEFLIS. 2001. Evolutionary history of the most speciose mammals: Molecular phylogeny of muroid rodents. Molecular Biology and Evolution 18:2017-2031.

MURATA, S., N. TAKASAKI, M. SAITCH, AND N. OKADA. 1993. Determination of the phylogenetic relationships among Pacific salmonids by using short interspersed elements (SINEs) as temporal landmarks of evolution. Proceedings of the National Academy of Sciences of the United States of America 90:6995-6999.

MUSSER, G. G., AND M. D. CARLETON. 2005. Superfamily Muroidea. In Mammal Species of the World: A Taxonomic and Geographic Reference, ed. D.E. Wilson and D.M. Reeder, 894-1531. Baltimore and London: The Johns Hopkins University Press.

NEUMANN, K., J. MICHAUX, V. LEBEDEV, N. YIGIT, E. COLAK, N. IVANOVA, A POLTORAUS, A. SUROV, G. MARKOV, S. MAAK, S. NEUMANN, AND R. GATTERMANN. 2006. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA gene and the nuclear vWF gene. Molecular Phylogenetics and Evolution 39: 135-148.

NOWAK, R. M. 1991. Walker's Mammals of the World. 5th ed. Vol. 2. Baltimore and London: The Johns Hopkins University Press.

RAY, D. A., J. XING, J. HEDGES, M. HALL, M. LABORDE, B. ANDERS, B. WHITE, N. STOILOVA, J. FOWLKES, K. LANDRY, L. CHEMNICK, O. RYDER, AND M. BATZER. 2005. Alu insertion loci and platyrrhine primate phylogeny. Molecular Phylogenetics and Evolution. 35:117-126.

ROOS, C., J. SCHMITZ, AND H. ZlSCHLER. 2004. Primate jumping genes elucidate strepsirrhine phylogeny. Proceedings of the National Academy of Sciences of the United States of America 101:10650-10654.

ROY, A. M., C. GONG, D.H. KASS, AND P.L. DEININGER. 1998. Recent B2 element insertions in the mouse genome. DNA Sequence 8:343-348.

ROY, A. M., M. L. CARROLL, D. H. KASS, S. V. NGUYEN, A. H. SALEM, M. A. BATZER, AND P.L. DEININGER. 1999. Recently integrated human Alu repeats: Finding needles in the haystack. Genetica 107: 149-161.

SASAKI, T., K. TAKAHASHI, M. NIKAIDO, S. MIURA, Y. YASUKAWA, AND N. OKADA. 2004. First application of the SINE (short interspersed repetitive element) method to infer phylogenetic relationships in reptiles: An example from the turtle superfamily Testudinoidea. Molecular Biology and Evolution 21:705-715.

SHIMAMURA, M., H. YASUE, K. OSHIMA, H. ABE, H. KATO, T. KISHIRO, M. GOTO, I. MUNECHIKA, AND N. OKADA. 1997. Molecular evidence from retroposons that whales form a clade within even-toed ungulates. Nature 338:666-670.

STEPPAN, S. J., R. M. ADKINS, AND J. ANDERSON. 2004. Phylogeny and divergence-data estimates of rapid radiations in muroid rodents based on multiple nuclear genes. Systematic Biology 53:533-553.

TAKAHASHI, K., M. NISHIDA, M. YUMA, AND N. OKADA. 2001. Retroposition of the AFC family of SINEs (short interspersed repetitive elements) before and during the adaptive radiation of cichlid fishes in Lake Malawi and related inferences about phylogeny. Journal of Molecular Evolution 53:496-507.

TERAI, Y., K. TAKAHASHI, M. NISHIDA, T. SATO, AND N. OKADA. 2003. Using SINEs to probe ancient explosive speciation: Hidden radiation of African cichlids? Molecular Biology and Evolution 20:924-930.

JOSEPH AKATAKOWSKI AND DAVID H KASS

Eastern Michigan University
COPYRIGHT 2008 Michigan Academy of Science Arts & Letters
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Katakowski, Joseph A.; Kass, David H.
Publication:Michigan Academician
Article Type:Report
Geographic Code:1U3MI
Date:Mar 22, 2008
Words:2758
Previous Article:Coprolites, cololites, and fish fossils in the Mississippian Michigan Formation, Western Michigan.
Next Article:The prince, prudence, and property in Giles of Rome.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |